Recent Advances in Aptamer Sensors
Abstract
1. Introduction
2. Colorimetric Aptasensor


3. Fluorescence Aptasensor



4. Electrochemical Aptasensor
5. Conclusions and Future Outlook
| Sensor Type | Target | Aptamer Sequence | Detection Range | LOD | Ref. |
|---|---|---|---|---|---|
| Colorimetric | E. coli | Fp: TAGGGAAGAGAAGGACATATGAT, Rp: TTGACTAGTACATGACCACTTGA) | 101–108 cells/mL | 101 cells/mL | [84] |
| Malathion | 5′-TAT ACA CAA TTG TTT TTC TCT TAA CTT CTT GAC TGC-3′ | 0–4000 ng/L | 5.24 ng/L | [85] | |
| Cd2+ | 5′-CTCAGGACGACGGGTTCACAGTCCGTTGTC-3′ | 1–400 ng/L | 1 ng/L | [86] | |
| Salmonella typhimurium | Apt1: 5′-biotin-GAGGAAAGTCTATAGCAGAGGAGATGTGTGAACCGAGTAA-3′ | 3.3 × 101–3.3 × 106 CFU/mL | 33 CFU/mL | [87] | |
| Apt2: 5′-CTCCTCTGACTGTAACCACGGAGTTAATCAATACAAGGCGGGAACATCCTTGGCGGTGCCGCATAGGTAGTCCAGAAGCC-3′ | |||||
| Salmonella typhimurium | NH2-GCGCTCGGCCTCCTCTGCCATCTCATTCGCGAGCGC | 100–109 CFU/mL | 16 CFU/mL | [88] | |
| AFM1 | 5-Biotin-ACTGCTAGAGATTTTCCACAT-3′ | 0.3–75 ng/mL | 0.03 ng/mL | [89] | |
| AFB1 | 5′-GTTGGGCACGTGTTGTCTCTCTGTGTCTCGTGCCCTTCGCTAGGCCCACA-3′ | 1–6 ng/mL | 0.18 ng/mL | [90] | |
| Salmonella typhimurium | Apt1 5′-AGT AAT GCC CGG TAG TTA TTC AAA GAT GAG TAG GAA AAG A-C6-SH-3′ | 101–106 CFU mL−1 | 1 CFU/mL | [97] | |
| Apt2 5′-TAT GGC GGC GTC ACC CGA CGG GGA CTT GAC ATT ATG ACA G-C6-SH-3′ | |||||
| ABA | AAAATGGGTTAGGTGGAGGTGGTTATTCCGGGAATTCGCCCTAAATACGAGCAAC | 1 nM to 10 μM | 0.51 nM | [98] | |
| Cortisol | 5′-GGA ATG GAT CCA CAT CCA TGG ATG GGC AAT GCG GGG TGG AGA ATG GTT GCC GCA CTT CGG CTT CAC TGC AGA CTT GAC GAA GCT T-3′ | 0.1–1000 nM | 0.1 nM | [99] | |
| Thrombin | TBA1 (5′-thiolated-TTT TTT TTT TTT TTT GGT TGG TGT GGT TGG-3′) | 0–10 μg/mL | 1.33 μg/mL | [100] | |
| TBA2 (5′-thiolated-TTT TTA GTC CGT GGT AGG GCA GGT TGG GGT GAC T-3′) | |||||
| Cd2+ | 5′-biotin-ACC GAC CGT GCT GGA CTC TGG ACT GTT GTG GTA TTA TTT TTG GTT GTG CAG TAT GAG CGA GCG TTG CG-3 | 1–500 ng/mL | 0.7 ng/mL | [101] | |
| PDGF-BB | 5′-CAGGCTACGGCACGTAGAGCATCACCATGATCCTG-3′ | 1–25 pM | 0.94 pM | [103] | |
| ATP | 5′-ACC TGG GGG AGT ATT GCG GAG GAA GGT-3′ | 0.50–100 μM | 0.09 μM | [106] | |
| Pb2+ | 5′-biotin-GGGTGGGTGGGTGGGT-3′ | 1–300 ng/mL | 0.63 ng/mL | [107] | |
| E. coli | Apt1: 5′-biotin-TGAGCCCAAGCCCTGGTATGCGGATAACGAGGTATTCACGACTGGTCGTCAGGTATGGTTGGCAGGTCTACTTTGGGATC-3′ | 16 to 1.6 × 106 CFU/mL | 2 CFU/mL | [108] | |
| Apt1: 5′-biotin-TGAGCCCAAGCCCTGGTATGAGCCCACGGAACACTGGTCGCGCCCACTGGTTTCTATATTGGCAGGTCTACTTTGGGATC-3′ | |||||
| 17β-E2 | 5′-GCTTCCAGCTTATTGAATTACACGCAGAGGGTAGCGGCTCTGCGCATTCAATTGCTGCGCGCTGAAGCGCGGAAGC-3′ | 1.5–50 nM | 1.5 nM | [109] | |
| AFB1 | 5′-biotin-GTT GGG CAC GTG TTG TCT CTC TGT GTC TCG TGC CCT TCG CTA GGC CCA CA-3′ | ND | 0.1 ng/mL | [110] | |
| PSA | 5′-Biotin-ATTAAAGCTCGCCATCAAATAGC-3′ | 0–2.1 ng/mL | 0.15 ng/mL | [111] | |
| E.coli O157: H7 | 5′-ATCCGTCACACCTGCTCTGTCTGCGAGCGGGGCG | 500–5 × 107 CFU/mL | 250 CFU/mL | [112] | |
| CGGGCCCGGCGGGGGATGCGTGGTGTTGGCTCCCGTAT-3′ | |||||
| Fluorometric | T-2 | 5′-CAGCTCAGAAGCTTGATCCTGTATATCAAGCATCGCGTGTTTACACATGCGAGAGGTGAAGACTCGAAGTCGTGCATCTG-3′ | 0.001−100 ng/mL | 0.57 pg/mL | [119] |
| DGX | 5′-AGCGAGGGCGGTGTCCAACAGCGGTTTTTTCACGAGGAGGTTGGCGGTGG-3′ | 0.001 to 0.5 ng/mL | 0.0032 ng/mL | [120] | |
| ZEN | 5′-NH2-AGCAGCACAGAGGTCAGATGTCATCTATCTATGGTACATTACTATCTGTAATGTGATATGCCTATGCGTGCTACCGTGAA-3′ | 31.4–628 nM | 7.5 nM | [121] | |
| PAT | 5′-GGC CCG CCA ACC CGC ATC ATC TAC ACT GAT ATT TTA CCT T-3′CFL | 5–300 ng/mL | 0.13 ng/mL | [130] | |
| AFB1 | TARMA-5′-GTT GGG CAC GTG TTG TCT CTC TGT GTC TCG TGC CCT TCG CTA GGC CCA CA-3′ | 0–180 ng/mL | 0.35 ng/mL | [123] | |
| AMP | 5′-CACGGCATGGTGGGCGTCGTG-Thiol-3′ | 100–1000 pM | 29.2 pM | [131] | |
| IFN-γ | Apt1: 5′-H2N-C6-CCGCCCAAATCCCTAAGAGAAGACTGTAATGAC ATCAAACCAGACACACACTACACACGCA-3′ | 2.0 × 10−18–5.0 × 10−8 M | 0.178 fM | [132] | |
| Apt2: 5′-TGGGGTTGGTTGTGTTGGGTGTTGTG-Azide(N3)-3′ | |||||
| MUC1 | 5′-Cy3-GCAGTTGATCCTTTGGATACCCTGG-NH2-3′ | 0–50 nM | 0.8 nM | [133] | |
| Isocarbophos | 5′-AGCT2GCTGCAGCGAT2CT2GATCGC2ACAGAGCT-3’ | 10–500 nM | 3.38 nM | [134] | |
| Hg2+ | 5′-FAM-TTC TTT CTT CCC CTT GTT TGT T-3′ | 20–150 nM | 15 nM | [135] | |
| E. coli | 5′-CCG GAC GCT TAT GCC TTG CCA TCT ACA GAG CAG GTG TGA CGG-C6 NH2-3′ | 85 to 85 × 107 CFU/mL | 17 CFU/mL | [140] | |
| E. coli ATCC8739 | 5′-ATCCGTCACACCTGCTCTGTCTGCGAGCGGGGCGCGGGCCCGGCGGGGGATGCGTGGTGTTGGCTCCCGTAT-3′ | 58–58 × 106 CFU/mL | 10 CFU/mL | [141] | |
| Malathion | 5′-ATCCGTCACACCTGCTCTTATACACAATTGTTTTTCTCTTAACT TCTTGACTGCTGGTGTTGGCTCCCGTAT-3′ | of 0.01–1 μM | 1.42 nM | [142] | |
| Pb2+ | Apt1: 5′-Biotin-CGA TCA CTA ACT ATr AGG AAG AGA TG-HS-3′ | 25–1400 nM | 5.7 nM | [143] | |
| Apt2: 5′-NH2-TGA GTG ATA AAG CTG GCC GAG CCT CTT CTC TAC-3′ | |||||
| Chlorpyrifos | 5′-CCTGCCACGCTCCGCAAGCTTAGGGTTACGCCTGCAGCGATTCTTGATCGCGCTGCTGGTAATCCTTCTTTAAGCTTGGCACCCGCATCGT-3′ | 5–600 nM | 3.8 nM | [144] | |
| ATP | 5′-CCCCAACTCCTTCCCGAAACCTACCTGGGGGAGTATTGCGGAGGAAGGTTTCGGG-3′ | 20–220 μM | 0.38 μM | [145] | |
| ATP | 5′-CCCCCCCCCCCCCACCTGGGGGAGTATTGCGGAGGAAGGT-3′ | 50 pM–1.0 nM | 26 pM | [152] | |
| AFB1 | 5′-GTT GGG CAC GTG TTG TCT CTC TGT GTC TCG TGC CCT TCG CTA GGC CCA CA-3′ | 2–400 ng/mL | 1.82 ng/mL | [153] | |
| Acetamiprid | 5′-TGT AAT TTG TCT GCA GCG GTT CTT GAT CGC TGA CAC CAT ATT ATG AAG A-3′ | 5 nM–1.2 μM | 3 nM | [154] | |
| Exosomes | 5′-CATCCATGGGAATTCGTCGACCCTGCAGGCATGCAAGCTTTCCCTATAGTGAGTCGTATTACTGCCTAGGCTCGAGCTCG-3′ | 0.68–30.4 pM | 0.57 pM | [121] | |
| ATP | 5′-FAM-AATTCTGGGGGAGCCTTTTGT GGG TAGGGC GGG TTG GTT TTG CCC CGG AGG AGG AATT-BHQ1-3′ | 1−500,000 μM | ND | [159] | |
| Cd2+ | 5′-AGTGACGTGCTGGACTCCGGACTATTGTGGTATGATCTGGTTGTGACTATGCAGTGCGTGCA-(CH2)3-SH-3′ | 20 pM–12 nM | 1.2 pM | [161] | |
| MC-LR | 5′-GGC GCC AAA CAG GAC CAC CAT GAC AAT TAC CCA TAC CAC CTC ATT ATG CCC CAT CTC CGC-3′ | 0.01 to 1000 μg/L | 4.8 ng/L | [162] | |
| Chloramphenicol | 5′-AGCAGCACAGAGGTCAGATGACTTCAGTGAGTTGTCCCACGGTCGGCGAGTCGGTGGTAGCCTATGCGTGCTACCGTGAA-3′ | 10–107 pg/mL | 0.987 pg/mL | [163] | |
| Electrochemical | OTA | 5′-triple SH-GAT CGG GTG TGG GTG GCG TAA AGG GAG CAT CGG ACA-3′ | 1 × 10−5–10 nM | 3.3 × 10−3 pM | [190] |
| Amoxicillin | 5′-(SH)-TTA GTT GGG GTT CAG TTG G-3′ | 0.5–3 nM | 0.2 nM | [191] | |
| Thrombin | Apt1: 5′-COOH-(CH2)10-GGTTGGTGTGGTTGG-3′. | 1 pM–10 nM | 0.64 pM | [192] | |
| Apt2: 5′-NH2-(CH2)6-AGTCCGTGGTAGGGCAGGTTGGGGTGACT-3′ | |||||
| PSA | 5′-NH2-TTT TTA ATT AAA GCT CGC CAT CAA ATA GCT TT-3′ | 0.0001–100 ng/mL | 0.085 pg/mL | [169] | |
| OTC | 5′-SH-GGA ATT CGC TAG CAC GTT GAC GCT GGT GCC CGG TTG TGG TGC GAG TGT TGT GTG GAT CCG AGC TCC ACG TG-3′ | 1 × 10−13 to 1 × 10−5 g/mL | 3.1 × 10−14 g/mL | [196] | |
| PAT | 5′-NH2-GGCCCGCCAACCCGCATCATCTACACTGATATTTTACCTT-3′ | 5 × 10−8–5 × 10−1 μg/ | 1.46 × 10−8 μg/mL | [43] | |
| Thrombin | 5′-AGTCCGTGGTAGGGCAGGTTGGGGTGACT-3′ | 1 fM–1 nM | 0.57 fM | [13] | |
| Pb2+ | 5′-GGGTGGGTGGGTGGGT-3′ and its complementary strand 5′-CCACCCACCC–(CH2)6–SH-3′ | 0.5–25 ppb | 0.6 ppb | [197] | |
| H5N1 | 5′-biotin-GTGTGCATGGATAGCACGTAACGGTGTAGTAGTAACGTGCGGGTAGGAAGAAAGGGAAATAGTTGTCGTGTTG-3′ | 0.001 to 1 HAU | 8 × 10–4 HAU | [201] | |
| Sulfadimethoxine | 5′-GAG GGC AAC GAG TGT TTA TAG A-3′, DNA probe, 5′–SH–TCT ATA AAC ACT CGT TGC CCT C-3′ | 0.1–500 nM | 0.038 nM | [203] | |
| Malathion | 5′-COOH-ATCCGTCACACCTGCTCTTATACACAATTGTTTTTCTCTT AACTTCTTGACTGCTGGTGTTGGCT-3′ | 0.5–600 ng/L | 0.5 ng/L | [204] | |
| ATZ | 5′-TGT-ACC-GTC-TGA-GCG-ATT-CGT-ACG-AAC-GGC-TTT-GTA-CTG-TTT-GCA-CTG-GCG-GAT-TTA-GCC-AGT-CAG-TGT-TAA-GGA-GTG-C-3′ | 50-fM–0.3 nM | 12.0 fM | [206] | |
| OTA | 5′-AAAGATCGGGTGTGGGTGGCGTAA AGGGAGCATCGGACA-3′ | 0.01–1 ng/mL | 0.004 ng/mL | [205] |
Funding
Acknowledgments
Conflicts of Interest
References
- Tuerk, C.; Gold, L. Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science 1990, 249, 505–510. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ellington, A.D.; Szostak, J.W. In vitro selection of RNA molecules that bind specific ligands. Nat. Cell Biol. 1990, 346, 818–822. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stoltenburg, R.; Reinemann, C.; Strehlitz, B. SELEX—A (r)evolutionary method to generate high-affinity nucleic acid ligands. Biomol. Eng. 2007, 24, 381–403. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhuo, Z.; Yu, Y.; Wang, M.; Li, J.; Zhang, Z.-K.; Liu, J.; Wu, X.; Lu, A.; Zhang, G.; Zhang, B.-T. Recent Advances in SELEX Technology and Aptamer Applications in Biomedicine. Int. J. Mol. Sci. 2017, 18, 2142. [Google Scholar] [CrossRef] [Scilit]
- Wu, Y.X.; Kwon, Y.J. Aptamers: The “evolution” of SELEX. Methods 2016, 106, 21–28. [Google Scholar] [CrossRef] [Scilit]
- Ohuchi, S. Cell-SELEX Technology. BioRes. Open Access 2012, 1, 265–272. [Google Scholar] [CrossRef] [Scilit]
- Qi, X.; Yan, X.; Zhao, Y.; Li, L.; Wang, S. Highly sensitive and specific detection of small molecules using advanced aptasensors based on split aptamers: A review. TrAC Trends Anal. Chem. 2020, 133, 116069. [Google Scholar] [CrossRef] [Scilit]
- Xu, L.; Duan, W.; Chen, F.; Zhang, J.; Li, H. A photoelectrochemical aptasensor for the determination of bisphenol A based on the Cu (I) modified graphitic carbon nitride. J. Hazard. Mater. 2020, 400, 123162. [Google Scholar] [CrossRef] [Scilit]
- Ojha, Y.R.; Giovannucci, D.R.; Cameron, B.D. Selection and characterization of structure-switching DNA aptamers for the salivary peptide histatin 3. J. Biotechnol. 2021, 327, 9–17. [Google Scholar] [CrossRef] [Scilit]
- Liu, Z.; Yuan, Y.; Wu, X.; Ning, Q.; Wu, S.; Fu, L. A turn-off colorimetric DNAzyme-aptasensor for ultra-high sensitive detection of viable Cronobacter sakazakii. Sens. Actuators B Chem. 2020, 322, 128646. [Google Scholar] [CrossRef] [Scilit]
- Chen, H.; Park, S.-G.; Choi, N.; Moon, J.-I.; Dang, H.; Das, A.; Lee, S.; Kim, D.-G.; Chen, L.; Choo, J. SERS imaging-based aptasensor for ultrasensitive and reproducible detection of influenza virus A. Biosens. Bioelectron. 2020, 167, 112496. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fan, Y.-Y.; Deng, X.; Wang, M.; Li, J.; Zhang, Z.-Q. A dual-function oligonucleotide-based ratiometric fluorescence sensor for ATP detection. Talanta 2020, 219, 121349. [Google Scholar] [CrossRef] [Scilit]
- Ren, Q.; Mou, J.; Guo, Y.; Wang, H.; Cao, X.; Zhang, F.; Xia, J.; Wang, Z. Simple homogeneous electrochemical target-responsive aptasensor based on aptamer bio-gated and porous carbon nanocontainer derived from ZIF-8. Biosens. Bioelectron. 2020, 166, 112448. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dong, H.; Chen, H.; Jiang, J.; Zhang, H.; Cai, C.; Shen, Q. Highly Sensitive Electrochemical Detection of Tumor Exosomes Based on Aptamer Recognition-Induced Multi-DNA Release and Cyclic Enzymatic Amplification. Anal. Chem. 2018, 90, 4507–4513. [Google Scholar] [CrossRef] [Scilit]
- Jepsen, M.D.; Sparvath, S.M.; Nielsen, T.B.; Langvad, A.H.; Grossi, G.; Gothelf, K.V.; Andersen, E.S. Development of a genetically encodable FRET system using fluorescent RNA aptamers. Nat. Commun. 2018, 9, 18. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kun, Q.; Lin, Y.; Peng, H.; Cheng, L.; Cui, H.; Hong, N.; Xiong, J.; Fan, H. A “signal-on” switch electrochemiluminescence biosensor for the detection of tumor cells. J. Electroanal. Chem. 2018, 808, 101–106. [Google Scholar] [CrossRef] [Scilit]
- Huang, K.; Doyle, F.; Wurz, Z.E.; Tenenbaum, S.A.; Hammond, R.K.; Caplan, J.; Meyers, B.C. FASTmiR: An RNA-based sensor for in vitro quantification and live-cell localization of small RNAs. Nucleic Acids Res. 2017, 45, e130. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, J.; Cheng, F.-F.; Zheng, T.; Zhu, J.-J. Versatile aptasensor for electrochemical quantification of cell surface glycan and naked-eye tracking glycolytic inhibition in living cells. Biosens. Bioelectron. 2017, 89, 937–945. [Google Scholar] [CrossRef] [Scilit]
- Mao, Y.; Chen, Y.; Li, S.; Lin, S.; Jiang, Y. A Graphene-Based Biosensing Platform Based on Regulated Release of an Aptameric DNA Biosensor. Sensors 2015, 15, 28244–28256. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fellows, T.; Ho, L.; Flanagan, S.; Fogel, R.; Ojo, D.; Limson, J. Gold nanoparticle-streptavidin conjugates for rapid and efficient screening of aptamer function in lateral flow sensors using novel CD4-binding aptamers identified through Crossover-SELEX. Analyst 2020, 145, 5180–5193. [Google Scholar] [CrossRef] [Scilit]
- Shafiei, F.; McAuliffe, K.; Bagheri, Y.; Sun, Z.; Yu, Q.; Wu, R.; You, M. Paper-based fluorogenic RNA aptamer sensors for label-free detection of small molecules. Anal. Methods 2020, 12, 2674–2681. [Google Scholar] [CrossRef] [Scilit]
- Lisi, F.; Peterson, J.R.; Gooding, J.J. The application of personal glucose meters as universal point-of-care diagnostic tools. Biosens. Bioelectron. 2020, 148, 111835. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, Z.-H.; Mohamed, M.A.; Mohan, A.; Zhu, Z.; Sharma, V.; Mishra, G.K.; Mishra, R.K. Application of Electrochemical Aptasensors toward Clinical Diagnostics, Food, and Environmental Monitoring: Review. Sensors 2019, 19, 5435. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shaban, S.M.; Abd-Elaal, A.A. Studying the silver nanoparticles influence on thermodynamic behavior and antimicrobial activities of novel amide Gemini cationic surfactants. Mater. Sci. Eng. C 2017, 76, 871–885. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shaban, S.M.; Lee, J.-Y.; Kim, D.-H. Dual-Surfactant-Capped Ag Nanoparticles as a Highly Selective and Sensitive Colorimetric Sensor for Citrate Detection. ACS Omega 2020, 5, 10696–10703. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shaban, S.M.; Kim, D.H. The influence of the Gemini surfactants hydrocarbon tail on in-situ synthesis of silver nanoparticles: Characterization, surface studies and biological performance. Korean J. Chem. Eng. 2020, 37, 1008–1019. [Google Scholar] [CrossRef] [Scilit]
- Hussain, F.; Shaban, S.M.; Kim, J.; Kim, Y.-J. One-pot synthesis of highly stable and concentrated silver nanoparticles with enhanced catalytic activity. Korean J. Chem. Eng. 2019, 36, 988–995. [Google Scholar] [CrossRef] [Scilit]
- Badr, E.A.; Hefni, H.H.; Shafek, S.; Shaban, S.M. Synthesis of anionic chitosan surfactant and application in silver nanoparticles preparation and corrosion inhibition of steel. Int. J. Biol. Macromol. 2020, 157, 187–201. [Google Scholar] [CrossRef] [Scilit]
- Aiad, I.; Shaban, S.M.; Tawfik, S.M.; Khalil, M.M.; El-Wakeel, N. Effect of some prepared surfactants on silver nanoparticles formation and surface solution behavior and their biological activity. J. Mol. Liq. 2018, 266, 381–392. [Google Scholar] [CrossRef] [Scilit]
- Shaban, S.M.; Aiad, I.; Yassin, F.A.; Mosalam, A. The Tail Effect of Some Prepared Cationic Surfactants on Silver Nanoparticle Preparation and Their Surface, Thermodynamic Parameters, and Antimicrobial Activity. J. Surfactants Deterg. 2019, 22, 1445–1460. [Google Scholar] [CrossRef] [Scilit]
- Sharifi, S.; Vahed, S.Z.; Ahmadian, E.; Dizaj, S.M.; Eftekhari, A.; Khalilov, R.; Ahmadi, M.; Hamidi-Asl, E.; Labib, M. Detection of pathogenic bacteria via nanomaterials-modified aptasensors. Biosens. Bioelectron. 2020, 150, 111933. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Meng, T.; Jia, H.; Ye, H.; Zeng, T.; Yang, X.; Wang, H.; Zhang, Y. Facile preparation of CoMoO4 nanorods at macroporous carbon hybrid electrocatalyst for non-enzymatic glucose detection. J. Colloid Interface Sci. 2020, 560, 1–10. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, B.; Luo, J.; Huang, X.; Lin, L.; Wang, L.; Hu, M.; Tang, L.; Xue, H.; Gao, J.; Mai, Y.-W. A highly stretchable, super-hydrophobic strain sensor based on polydopamine and graphene reinforced nanofiber composite for human motion monitoring. Compos. Part B Eng. 2020, 181, 107580. [Google Scholar] [CrossRef] [Scilit]
- Iranmanesh, T.; Foroughi, M.M.; Jahani, S.; Zandi, M.S.; Nadiki, H.H. Green and facile microwave solvent-free synthesis of CeO2 nanoparticle-decorated CNTs as a quadruplet electrochemical platform for ultrasensitive and simultaneous detection of ascorbic acid, dopamine, uric acid and acetaminophen. Talanta 2020, 207, 120318. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shetti, N.P.; Bukkitgar, S.D.; Reddy, K.R.; Reddy, C.V.; Aminabhavi, T.M. ZnO-based nanostructured electrodes for electrochemical sensors and biosensors in biomedical applications. Biosens. Bioelectron. 2019, 141, 111417. [Google Scholar] [CrossRef] [Scilit]
- Deshmukh, S.; Patil, S.; Mullani, S.; Delekar, S.D. Silver nanoparticles as an effective disinfectant: A review. Mater. Sci. Eng. C 2019, 97, 954–965. [Google Scholar] [CrossRef] [Scilit]
- Han, S.; Yang, L.; Wen, Z.; Chu, S.; Wang, M.; Wang, Z.; Jiang, C. A dual-response ratiometric fluorescent sensor by europium-doped CdTe quantum dots for visual and colorimetric detection of tetracycline. J. Hazard. Mater. 2020, 398, 122894. [Google Scholar] [CrossRef] [Scilit]
- Kong, D.; Yao, J.; Li, X.; Luo, J.; Yang, M. A reusable AuNPS with increased stability applied for fast screening of trace heavy metals in edible and medicinal marine products. Ecotoxicol. Environ. Saf. 2020, 204, 111107. [Google Scholar] [CrossRef] [Scilit]
- Cheng, N.; Song, Y.; Fu, Q.; Du, D.; Luo, Y.; Wang, Y.; Xu, W.; Lin, Y. Aptasensor based on fluorophore-quencher nano-pair and smartphone spectrum reader for on-site quantification of multi-pesticides. Biosens. Bioelectron. 2018, 117, 75–83. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.; Sha, H.; Ke, H.; Xiong, X.; Jia, N. A sandwich-type electrochemiluminescence aptasensor for insulin detection based on the nano-C60/BSA@luminol nanocomposite and ferrocene derivative. Electrochim. Acta 2018, 290, 90–97. [Google Scholar] [CrossRef] [Scilit]
- Wei, B.; Mao, K.; Liu, N.; Zhang, M.; Yang, Z. Graphene nanocomposites modified electrochemical aptamer sensor for rapid and highly sensitive detection of prostate specific antigen. Biosens. Bioelectron. 2018, 121, 41–46. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Arvand, M.; Mirroshandel, A.A. An efficient fluorescence resonance energy transfer system from quantum dots to graphene oxide nano sheets: Application in a photoluminescence aptasensing probe for the sensitive detection of diazinon. Food Chem. 2019, 280, 115–122. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- He, B.; Dong, X. Hierarchically porous Zr-MOFs labelled methylene blue as signal tags for electrochemical patulin aptasensor based on ZnO nano flower. Sens. Actuators B Chem. 2019, 294, 192–198. [Google Scholar] [CrossRef] [Scilit]
- Sarabaegi, M.; Roushani, M. A nano-sized chitosan particle based electrochemical aptasensor for sensitive detection of P. aeruginosa. Anal. Methods 2019, 11, 5591–5597. [Google Scholar] [CrossRef] [Scilit]
- Wang, J.; Guo, X.; Liu, R.; Guo, J.; Zhang, Y.; Zhang, W.; Sang, S. Detection of carcinoembryonic antigen using a magnetoelastic nano-biosensor amplified with DNA-templated silver nanoclusters. Nanotechnology 2019, 31, 015501. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Abazar, F.; Noorbakhsh, A. Chitosan-carbon quantum dots as a new platform for highly sensitive insulin impedimetric aptasensor. Sens. Actuators B Chem. 2020, 304, 127281. [Google Scholar] [CrossRef] [Scilit]
- He, Z.-J.; Kang, T.-F.; Lu, L.-P.; Cheng, S.-Y. An electrochemiluminescence aptamer sensor for chloramphenicol based on GO-QDs nanocomposites and enzyme-linked aptamers. J. Electroanal. Chem. 2020, 860, 113870. [Google Scholar] [CrossRef] [Scilit]
- Walter, J.-G.; Eilers, A.; Alwis, L.S.M.; Roth, B.; Bremer, K. SPR Biosensor Based on Polymer Multi-Mode Optical Waveguide and Nanoparticle Signal Enhancement. Sensors 2020, 20, 2889. [Google Scholar] [CrossRef] [Scilit]
- Pla, L.; Santiago-Felipe, S.; Tormo-Mas, M.; Pemán, J.; Sancenón, F.; Aznar, E.; Martínez-Máñez, R. Aptamer-Capped nanoporous anodic alumina for Staphylococcus aureus detection. Sens. Actuators B Chem. 2020, 320, 128281. [Google Scholar] [CrossRef] [Scilit]
- Wang, Z.; Lu, Y. Functional DNA directed assembly of nanomaterials for biosensing. J. Mater. Chem. 2009, 19, 1788–1798. [Google Scholar] [CrossRef] [Scilit]
- Lu, Y.; Liu, J. Functional DNA nanotechnology: Emerging applications of DNAzymes and aptamers. Curr. Opin. Biotechnol. 2006, 17, 580–588. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Farzin, L.; Shamsipur, M.; Sheibani, S. A review: Aptamer-based analytical strategies using the nanomaterials for environmental and human monitoring of toxic heavy metals. Talanta 2017, 174, 619–627. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhu, C.; Yang, G.; Li, H.; Du, D.; Lin, Y. Electrochemical Sensors and Biosensors Based on Nanomaterials and Nanostructures. Anal. Chem. 2014, 87, 230–249. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Goyal, R.N.; Gupta, V.K.; Chatterjee, S. Voltammetric biosensors for the determination of paracetamol at carbon nanotube modified pyrolytic graphite electrode. Sens. Actuators B Chem. 2010, 149, 252–258. [Google Scholar] [CrossRef] [Scilit]
- Urmann, K.; Modrejewski, J.; Scheper, P.T.; Walter, J.-G. Aptamer-modified nanomaterials: Principles and applications. BioNanoMaterials 2016, 18. [Google Scholar] [CrossRef] [Scilit]
- Xiao, Z.; Farokhzad, O.C. Aptamer-Functionalized Nanoparticles for Medical Applications: Challenges and Opportunities. ACS Nano 2012, 6, 3670–3676. [Google Scholar] [CrossRef] [Scilit]
- Yue, F.; Li, F.; Kong, Q.; Guo, Y.; Sun, X. Recent advances in aptamer-based sensors for aminoglycoside antibiotics detection and their applications. Sci. Total Environ. 2021, 762, 143129. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, N.; Liu, B.; Cui, X.; Li, Y.; Tang, J.; Wang, H.; Zhang, D.; Li, Z. Recent Advances in Aptasensors for Mycotoxin Detection: On the Surface and in the Colloid. Talanta 2021, 223, 121729. [Google Scholar] [CrossRef] [Scilit]
- Ghorbani, F.; Abbaszadeh, H.; Dolatabadi, J.E.N.; Aghebati-Maleki, L.; Yousefi, M. Application of various optical and electrochemical aptasensors for detection of human prostate specific antigen: A review. Biosens. Bioelectron. 2019, 142, 111484. [Google Scholar] [CrossRef] [Scilit]
- Rajabnejad, S.-H.; Badibostan, H.; Verdian, A.; Karimi, G.R.; Fooladi, E.; Feizy, J. Aptasensors as promising new tools in bisphenol A detection—An invisible pollution in food and environment. Microchem. J. 2020, 155, 104722. [Google Scholar] [CrossRef] [Scilit]
- Zhuang, Y.; Liu, L.; Wu, X.; Tian, Y.; Zhou, X.; Xu, S.; Xie, Z.; Ma, Y. Size and Shape Effect of Gold Nanoparticles in “Far-Field” Surface Plasmon Resonance. Part. Part. Syst. Charact. 2019, 36, 1800077. [Google Scholar] [CrossRef] [Scilit]
- El-Brolossy, T.A.; Abdallah, T.; Mohamed, M.B.; Easawi, K.; Negm, S.; Talaat, H. Shape and size dependence of the surface plasmon resonance of gold nanoparticles studied by Photoacoustic technique. Eur. Phys. J. Spéc. Top. 2008, 153, 361–364. [Google Scholar] [CrossRef] [Scilit]
- Bin Jeon, H.; Tsalu, P.V.; Ha, J.W. Shape Effect on the Refractive Index Sensitivity at Localized Surface Plasmon Resonance Inflection Points of Single Gold Nanocubes with Vertices. Sci. Rep. 2019, 9, 13635. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chang, D.; Zakaria, S.; Deng, M.; Allen, N.; Tram, K.; Li, Y. Integrating Deoxyribozymes into Colorimetric Sensing Platforms. Sensors 2016, 16, 2061. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shalkevich, N.; Escher, W.; Bürgi, T.; Michel, B.; Si-Ahmed, L.; Poulikakos, D. On the Thermal Conductivity of Gold Nanoparticle Colloids. Langmuir 2010, 26, 663–670. [Google Scholar] [CrossRef] [Scilit]
- Jeon, H.; Lee, K. Effect of gold nanoparticle morphology on thermal properties of polyimide nanocomposite films. Coll. Surf. A Physicochem. Eng. Asp. 2019, 579, 123651. [Google Scholar] [CrossRef] [Scilit]
- Sunil, J.; Alex, S.; Pravin, A.A.; Pooja, M.D.; Ginil, R. Thermal properties of aqueous silver nanoparticle dispersion. Mater. Today Proc. 2020. [Google Scholar] [CrossRef] [Scilit]
- Lucas, T.M.; Moiseeva, E.V.; Zhang, G.; Gobin, A.M.; Harnett, C.K. Thermal properties of infrared absorbent gold nanoparticle coatings for MEMS applications. Sens. Actuators A Phys. 2013, 198, 81–86. [Google Scholar] [CrossRef] [Scilit]
- Taghdisi, S.M.; Danesh, N.M.; Lavaee, P.; Ramezani, M.; Abnous, K. An aptasensor for selective, sensitive and fast detection of lead (II) based on polyethyleneimine and gold nanoparticles. Environ. Toxicol. Pharmacol. 2015, 39, 1206–1211. [Google Scholar] [CrossRef] [Scilit]
- Priyadarshni, N.; Nath, P.; Hanumaiah, N.; Chanda, N. DMSA-Functionalized Gold Nanorod on Paper for Colorimetric Detection and Estimation of Arsenic (III and V) Contamination in Groundwater. ACS Sustain. Chem. Eng. 2018, 6, 6264–6272. [Google Scholar] [CrossRef] [Scilit]
- Li, H.; Rothberg, L. Colorimetric detection of DNA sequences based on electrostatic interactions with unmodified gold nanoparticles. Proc. Natl. Acad. Sci. USA 2004, 101, 14036–14039. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Guo, X.-L.; Yuan, D.-D.; Song, T.; Li, X. DNA nanopore functionalized with aptamer and cell-penetrating peptide for tumor cell recognition. Anal. Bioanal. Chem. 2017, 4, 3789–3797. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Guo, L.; Jackman, J.A.; Yang, H.-H.; Chen, P.; Cho, N.-J.; Kim, D.-H. Strategies for enhancing the sensitivity of plasmonic nanosensors. Nano Today 2015, 10, 213–239. [Google Scholar] [CrossRef] [Scilit]
- Puiu, M.; Bala, C. SPR and SPR Imaging: Recent Trends in Developing Nanodevices for Detection and Real-Time Monitoring of Biomolecular Events. Sensors 2016, 16, 870. [Google Scholar] [CrossRef] [Scilit]
- Nusz, G.J.; Curry, A.C.; Marinakos, S.M.; Wax, A.; Chilkoti, A. Rational Selection of Gold Nanorod Geometry for Label-Free Plasmonic Biosensors. ACS Nano 2009, 3, 795–806. [Google Scholar] [CrossRef] [Scilit]
- Zijlstra, P.; Paulo, P.M.R.; Orrit, M. Optical detection of single non-absorbing molecules using the surface plasmon resonance of a gold nanorod. Nat. Nanotechnol. 2012, 7, 379–382. [Google Scholar] [CrossRef] [Scilit]
- Xu, W.; Xue, X.; Li, T.; Zeng, H.; Liu, X. Ultrasensitive and Selective Colorimetric DNA Detection by Nicking Endonuclease Assisted Nanoparticle Amplification. Angew. Chem. Int. Ed. 2009, 48, 6849–6852. [Google Scholar] [CrossRef] [Scilit]
- Li, J.; Deng, T.; Chu, X.; Tan, W.; Jiang, J.-H.; Shen, G.; Yu, R. Rolling Circle Amplification Combined with Gold Nanoparticle Aggregates for Highly Sensitive Identification of Single-Nucleotide Polymorphisms. Anal. Chem. 2010, 82, 2811–2816. [Google Scholar] [CrossRef] [Scilit]
- Xu, W.; Xie, X.; Li, D.; Yang, Z.; Li, T.; Liu, X. Ultrasensitive Colorimetric DNA Detection using a Combination of Rolling Circle Amplification and Nicking Endonuclease-Assisted Nanoparticle Amplification (NEANA). Small 2012, 8, 1846–1850. [Google Scholar] [CrossRef] [Scilit]
- Zhou, W.; Huang, P.-J.J.; Ding, J.; Liu, J. Aptamer-based biosensors for biomedical diagnostics. Analyst 2014, 139, 2627–2640. [Google Scholar] [CrossRef] [Scilit]
- Niazov, T.; Pavlov, V.; Xiao, Y.; Gill, A.R.; Willner, I. DNAzyme-Functionalized Au Nanoparticles for the Amplified Detection of DNA or Telomerase Activity. Nano Lett. 2004, 4, 1683–1687. [Google Scholar] [CrossRef] [Scilit]
- Weizmann, Y.; Beissenhirtz, M.K.; Cheglakov, Z.; Nowarski, R.; Kotler, M.; Willner, I. A Virus Spotlighted by an Autonomous DNA Machine. Angew. Chem. Int. Ed. 2006, 45, 7384–7388. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, C.; Lates, V.; Prieto-Simón, B.; Marty, J.L.; Yang, X. Aptamer-DNAzyme hairpins for biosensing of Ochratoxin A. Biosens. Bioelectron. 2012, 32, 208–212. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gupta, R.; Kumar, A.; Kumar, S.; Pinnaka, A.K.; Singhal, N.K. Naked eye colorimetric detection of Escherichia coli using aptamer conjugated graphene oxide enclosed Gold nanoparticles. Sens. Actuators B Chem. 2021, 329, 129100. [Google Scholar] [CrossRef] [Scilit]
- Lai, X.; Zhang, S.; Du, G.; Wang, Y.; Han, Y.; Ye, N.; Xiang, Y. Ultrasensitive Determination of Malathion in Apples by Aptamer-Based Resonance Scattering. Anal. Lett. 2020, 1–15. [Google Scholar] [CrossRef] [Scilit]
- Xu, L.; Liang, J.; Wang, Y.; Ren, S.; Wu, J.; Zhou, H.; Gao, Z. Highly Selective, Aptamer-Based, Ultrasensitive Nanogold Colorimetric Smartphone Readout for Detection of Cd (II). Molecules 2019, 24, 2745. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, S.; Yang, X.; Fu, S.; Qin, X.; Yang, T.; Man, C.; Jiang, Y. A novel AuNPs colorimetric sensor for sensitively detecting viable Salmonella typhimurium based on dual aptamers. Food Control 2020, 115, 107281. [Google Scholar] [CrossRef] [Scilit]
- Yi, J.; Wu, P.; Li, G.; Xiao, W.; Li, L.; He, Y.; He, Y.; Ding, P.; Chen, C. A composite prepared from carboxymethyl chitosan and aptamer-modified gold nanoparticles for the colorimetric determination of Salmonella typhimurium. Microchim. Acta 2019, 186, 711. [Google Scholar] [CrossRef] [Scilit]
- Jalalian, S.H.; Lavaee, P.; Ramezani, M.; Danesh, N.M.; Alibolandi, M.; Abnous, K.; Taghdisi, S.M. An optical aptasensor for aflatoxin M1 detection based on target-induced protection of gold nanoparticles against salt-induced aggregation and silica nanoparticles. Spectrochim. Acta Part A Mol. Biomol. Spectrosc. 2021, 246, 119062. [Google Scholar] [CrossRef] [Scilit]
- Lerdsri, J.; Chananchana, W.; Upan, J.; Sridara, T.; Jakmunee, J. Label-free colorimetric aptasensor for rapid detection of aflatoxin B1 by utilizing cationic perylene probe and localized surface plasmon resonance of gold nanoparticles. Sens. Actuators B Chem. 2020, 320, 128356. [Google Scholar] [CrossRef] [Scilit]
- Liu, X.; He, F.; Zhang, F.; Zhang, Z.; Huang, Z.; Liu, J. Dopamine and Melamine Binding to Gold Nanoparticles Dominates Their Aptamer-Based Label-Free Colorimetric Sensing. Anal. Chem. 2020, 92, 9370–9378. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zong, C.; Liu, J. The Arsenic-Binding Aptamer Cannot Bind Arsenic: Critical Evaluation of Aptamer Selection and Binding. Anal. Chem. 2019, 91, 10887–10893. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cao, R.; Li, B.; Zhang, Y.; Zhang, Z. Naked-eye sensitive detection of nuclease activity using positively-charged gold nanoparticles as colorimetric probes. Chem. Commun. 2011, 47, 12301–12303. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bian, X.; Song, Z.-L.; Qian, Y.; Gao, W.; Cheng, Z.-Q.; Chen, L.; Liang, H.; Ding, D.; Nie, X.-K.; Chen, Z.; et al. Fabrication of Graphene-isolated-Au-nanocrystal Nanostructures for Multimodal Cell Imaging and Photothermal-enhanced Chemotherapy. Sci. Rep. 2014, 4, 6093. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Qi, Y.; Chen, Y.; Xiu, F.-R.; Hou, J. An aptamer-based colorimetric sensing of acetamiprid in environmental samples: Convenience, sensitivity and practicability. Sens. Actuators B Chem. 2020, 304, 127359. [Google Scholar] [CrossRef] [Scilit]
- Qi, Y.; Ma, J.; Chen, X.; Xiu, F.-R.; Chen, Y.; Lu, Y. Practical aptamer-based assay of heavy metal mercury ion in contaminated environmental samples: Convenience and sensitivity. Anal. Bioanal. Chem. 2019, 412, 439–448. [Google Scholar] [CrossRef] [Scilit]
- Chen, Q.; Gao, R.; Jia, L. Enhancement of the peroxidase-like activity of aptamers modified gold nanoclusters by bacteria for colorimetric detection of Salmonella typhimurium. Talanta 2021, 221, 121476. [Google Scholar] [CrossRef] [Scilit]
- Wang, S.; Zhang, H.; Li, W.; Birech, Z.; Ma, L.; Li, D.; Li, S.; Wang, L.; Shang, J.; Hu, J. A multi-channel localized surface plasmon resonance system for absorptiometric determination of abscisic acid by using gold nanoparticles functionalized with a polyadenine-tailed aptamer. Microchim. Acta 2019, 187, 20. [Google Scholar] [CrossRef] [Scilit]
- Jo, S.; Lee, W.; Park, J.; Kim, W.; Kim, W.; Lee, G.; Hong, J.; Park, J. Localized surface plasmon resonance aptasensor for the highly sensitive direct detection of cortisol in human saliva. Sens. Actuators B Chem. 2020, 304, 127424. [Google Scholar] [CrossRef] [Scilit]
- Lee, W.; Shaban, S.M.; Pyun, D.G.; Kim, Y.-J. Solid-phase colorimetric apta-biosensor for thrombin detection. Thin Solid Films 2019, 686, 137428. [Google Scholar] [CrossRef] [Scilit]
- Tao, Z.; Wei, L.; Wu, S.; Duan, N.; Li, X.; Wang, Z. A colorimetric aptamer-based method for detection of cadmium using the enhanced peroxidase-like activity of Au–MoS2 nanocomposites. Anal. Biochem. 2020, 608, 113844. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yan, X.-L.; Xue, X.-X.; Luo, J.; Jian, Y.-T.; Tong, L.; Zheng, X.-J. Construction of chemiluminescence aptasensor platform using magnetic microsphere for ochratoxin A detection based on G bases derivative reaction and Au NPs catalyzing luminol system. Sens. Actuators B Chem. 2020, 320, 128375. [Google Scholar] [CrossRef] [Scilit]
- Miao, X.; Zhu, Z.; Jia, H.; Lu, C.; Liu, X.; Mao, D.; Chen, G. Colorimetric detection of cancer biomarker based on enzyme enrichment and pH sensing. Sens. Actuators B Chem. 2020, 320, 128435. [Google Scholar] [CrossRef] [Scilit]
- Zhang, G.; Zhang, L.; Yu, Y.; Lin, B.; Wang, Y.; Guo, M.; Cao, Y. Dual-mode of electrochemical-colorimetric imprinted sensing strategy based on self-sacrifice beacon for diversified determination of cardiac troponin I in serum. Biosens. Bioelectron. 2020, 167, 112502. [Google Scholar] [CrossRef] [Scilit]
- Wang, J.; Wang, Q.; Zhong, Y.; Wu, D.; Gan, N. A sandwich-type aptasensor for point-of-care measurements of low-density lipoprotein in plasma based on aptamer-modified MOF and magnetic silica composite probes. Microchem. J. 2020, 158, 105288. [Google Scholar] [CrossRef] [Scilit]
- Li, S.; Zhao, X.; Yu, X.; Wan, Y.; Yin, M.; Zhang, W.; Cao, B.; Wang, H. Fe3O4 Nanozymes with Aptamer-Tuned Catalysis for Selective Colorimetric Analysis of ATP in Blood. Anal. Chem. 2019, 91, 14737–14742. [Google Scholar] [CrossRef] [Scilit]
- Tao, Z.; Zhou, Y.; Duan, N.; Wang, Z. A Colorimetric Aptamer Sensor Based on the Enhanced Peroxidase Activity of Functionalized Graphene/Fe3O4-AuNPs for Detection of Lead (II) Ions. Catalysts 2020, 10, 600. [Google Scholar] [CrossRef] [Scilit]
- Duan, N.; Yang, W.; Wu, S.; Zou, Y.; Wang, Z. A Visual and Sensitive Detection of Escherichia coli Based on Aptamer and Peroxidase-like Mimics of Copper-Metal Organic Framework Nanoparticles. Food Anal. Methods 2020, 13, 1433–1441. [Google Scholar] [CrossRef] [Scilit]
- Huang, Y.; Zhang, L.; Li, Z.; Gopinath, S.C.; Chen, Y.; Xiao, Y. Aptamer–17β-estradiol–antibody sandwich ELISA for determination of gynecological endocrine function. Biotechnol. Appl. Biochem. 2020. [Google Scholar] [CrossRef] [Scilit]
- Xing, K.-Y.; Peng, J.; Shan, S.; Liu, D.-F.; Huang, Y.-N.; Lai, W. Green Enzyme-Linked Immunosorbent Assay Based on the Single-Stranded Binding Protein-Assisted Aptamer for the Detection of Mycotoxin. Anal. Chem. 2020, 92, 8422–8426. [Google Scholar] [CrossRef] [Scilit]
- Wei, Y.; Wang, D.; Zhang, Y.; Sui, J.; Xu, Z.-R. Multicolor and photothermal dual-readout biosensor for visual detection of prostate specific antigen. Biosens. Bioelectron. 2019, 140, 111345. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, T.; Ou, G.; Chen, X.; Li, Z.; Hu, R.; Li, Y.; Yang, Y.; Liu, M. Naked-eye based point-of-care detection of E.coli O157: H7 by a signal-amplified microfluidic aptasensor. Anal. Chim. Acta 2020, 1130, 20–28. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pehlivan, Z.S.; Torabfam, M.; Kurt, H.; Ow-Yang, C.; Hildebrandt, N.; Yüce, M. Aptamer and nanomaterial based FRET biosensors: A review on recent advances (2014–2019). Microchim. Acta 2019, 186, 563. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Şahin, S.; Caglayan, M.O.; Üstundağ, Z. A review on nanostructure-based mercury (II) detection and monitoring focusing on aptamer and oligonucleotide biosensors. Talanta 2020, 220, 121437. [Google Scholar] [CrossRef] [Scilit]
- Li, F.; Pei, H.; Wang, L.; Lu, J.; Gao, J.; Jiang, B.; Zhao, X.; Fan, C. Nanomaterial-Based Fluorescent DNA Analysis: A Comparative Study of the Quenching Effects of Graphene Oxide, Carbon Nanotubes, and Gold Nanoparticles. Adv. Funct. Mater. 2013, 23, 4140–4148. [Google Scholar] [CrossRef] [Scilit]
- Chen, L.; Lee, S.; Lee, M.; Lim, C.; Choo, J.; Park, J.Y.; Lee, S.; Joo, S.-W.; Lee, K.-H.; Choi, Y.-W. DNA hybridization detection in a microfluidic channel using two fluorescently labelled nucleic acid probes. Biosens. Bioelectron. 2008, 23, 1878–1882. [Google Scholar] [CrossRef] [Scilit]
- Shi, J.; Tian, F.; Lyu, J.; Yang, M. Nanoparticle based fluorescence resonance energy transfer (FRET) for biosensing applications. J. Mater. Chem. B 2015, 3, 6989–7005. [Google Scholar] [CrossRef] [Scilit]
- Wang, L.; Zhu, F.; Chen, M.; Zhu, Y.; Xiao, J.; Yang, H.; Chen, X. Rapid and visual detection of aflatoxin B1 in foodstuffs using aptamer/G-quadruplex DNAzyme probe with low background noise. Food Chem. 2019, 271, 581–587. [Google Scholar] [CrossRef] [Scilit]
- Khan, I.M.; Niazi, S.; Yu, Y.; Pasha, I.; Yue, L.; Mohsin, A.; Shoaib, M.; Iqbal, M.W.; Khaliq, A.; Wang, Z. Fabrication of PAA coated green-emitting AuNCs for construction of label-free FRET assembly for specific recognition of T-2 toxin. Sens. Actuators B Chem. 2020, 321, 128470. [Google Scholar] [CrossRef] [Scilit]
- Shirani, M.; Kalantari, H.; Khodayar, M.J.; Kouchak, M.; Rahbar, N. A novel strategy for detection of small molecules based on aptamer/gold nanoparticles/graphitic carbon nitride nanosheets as fluorescent biosensor. Talanta 2020, 219, 121235. [Google Scholar] [CrossRef] [Scilit]
- Tan, X.; Wang, X.; Hao, A.; Liu, Y.; Wang, X.; Chu, T.; Jiang, M.; Yang, Y.; Ming, D. Aptamer-based ratiometric fluorescent nanoprobe for specific and visual detection of zearalenone. Microchem. J. 2020, 157, 104943. [Google Scholar] [CrossRef] [Scilit]
- Guo, Y.; Zhang, J.; Zhang, W.; Hu, D. Green fluorescent carbon quantum dots functionalized with polyethyleneimine, and their application to aptamer-based determination of thrombin and ATP. Microchim. Acta 2019, 186, 717. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jia, Y.; Zhou, G.; Wang, X.; Zhang, Y.; Li, Z.; Liu, P.; Yu, B.; Zhang, J. A metal-organic framework/aptamer system as a fluorescent biosensor for determination of aflatoxin B1 in food samples. Talanta 2020, 219, 121342. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, D.; Guo, J.; Zhao, L.; Zhang, G.; Yan, G. A label-free RTP sensor based on aptamer/quantum dot nanocomposites for cytochrome c detection. RSC Adv. 2019, 9, 31953–31959. [Google Scholar] [CrossRef] [Scilit]
- Xiong, J.; Li, S.; Li, Y.; Chen, Y.; Liu, Y.; Gan, J.; Ju, J.; Xian, Y.; Xiong, X. Fluorescent Aptamer-Polyethylene Glycol Functionalized Graphene Oxide Biosensor for Profenofos Detection in Food. Chem. Res. Chin. Univ. 2019, 36, 787–794. [Google Scholar] [CrossRef] [Scilit]
- Pang, S.; Liu, S.; Su, X. An ultrasensitive sensing strategy for the detection of lead (II) ions based on the intermolecular G-quadruplex and graphene oxide. Sens. Actuators B Chem. 2015, 208, 415–420. [Google Scholar] [CrossRef] [Scilit]
- Qian, Z.S.; Shan, X.Y.; Chai, L.J.; Chen, J.R.; Feng, H. A fluorescent nanosensor based on graphene quantum dots–aptamer probe and graphene oxide platform for detection of lead (II) ion. Biosens. Bioelectron. 2015, 68, 225–231. [Google Scholar] [CrossRef] [Scilit]
- Li, M.; Zhou, X.; Guo, S.; Wu, N. Detection of lead (II) with a “turn-on” fluorescent biosensor based on energy transfer from CdSe/ZnS quantum dots to graphene oxide. Biosens. Bioelectron. 2013, 43, 69–74. [Google Scholar] [CrossRef] [Scilit]
- Jia, Y.; Wu, F.; Liu, P.; Zhou, G.; Yu, B.; Lou, X.; Xia, F. A label-free fluorescent aptasensor for the detection of Aflatoxin B1 in food samples using AIEgens and graphene oxide. Talanta 2019, 198, 71–77. [Google Scholar] [CrossRef] [Scilit]
- Khan, R.; Sherazi, T.A.; Catanante, G.; Rasheed, S.; Marty, J.L.; Hayat, A. Switchable fluorescence sensor toward PAT via CA-MWCNTs quenched aptamer-tagged carboxyfluorescein. Food Chem. 2020, 312, 126048. [Google Scholar] [CrossRef] [Scilit]
- Esmaelpourfarkhani, M.; Abnous, K.; Taghdisi, S.M.; Chamsaz, M. A novel turn-off fluorescent aptasensor for ampicillin detection based on perylenetetracarboxylic acid diimide and gold nanoparticles. Biosens. Bioelectron. 2020, 164, 112329. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wen, D.; Liu, Q.; Li, L.; Yang, H.; Kong, J. Ultrasensitive aptamer fluorometric detection of IFN-γ by dual atom transfer radical polymerization amplification. Sens. Actuators B Chem. 2019, 295, 40–48. [Google Scholar] [CrossRef] [Scilit]
- Wang, D.-E.; Gao, X.; You, S.; Chen, M.; Ren, L.; Sun, W.; Yang, H.; Xu, H. Aptamer-functionalized polydiacetylene liposomes act as a fluorescent sensor for sensitive detection of MUC1 and targeted imaging of cancer cells. Sens. Actuators B Chem. 2020, 309, 127778. [Google Scholar] [CrossRef] [Scilit]
- Fan, K.; Yang, R.; Zhao, Y.; Zang, C.; Miao, X.; Qu, B.; Lu, L. A fluorescent aptasensor for sensitive detection of isocarbophos based on AT-rich three-way junctions DNA templated copper nanoparticles and Fe3O4@GO. Sens. Actuators B Chem. 2020, 321, 128515. [Google Scholar] [CrossRef] [Scilit]
- Wang, S.-E.; Si, S. Aptamer biosensing platform based on carbon nanotube long-range energy transfer for sensitive, selective and multicolor fluorescent heavy metal ion analysis. Anal. Methods 2013, 5, 2947–2953. [Google Scholar] [CrossRef] [Scilit]
- Wang, M.; Hou, W.; Mi, C.-C.; Wang, W.-X.; Xu, Z.-R.; Teng, H.-H.; Mao, C.-B.; Xu, S.-K. Immunoassay of Goat Antihuman Immunoglobulin G Antibody Based on Luminescence Resonance Energy Transfer between Near-Infrared Responsive NaYF4:Yb, Er Upconversion Fluorescent Nanoparticles and Gold Nanoparticles. Anal. Chem. 2009, 81, 8783–8789. [Google Scholar] [CrossRef] [Scilit]
- Chen, Z.; Chen, H.; Hu, H.; Yu, M.; Li, F.; Zhang, Q.; Zhou, Z.; Yi, T.; Huang, C. Versatile Synthesis Strategy for Carboxylic Acid−functionalized Upconverting Nanophosphors as Biological Labels. J. Am. Chem. Soc. 2008, 130, 3023–3029. [Google Scholar] [CrossRef] [Scilit]
- Huang, L.; Wu, J.; Zheng, L.; Qian, H.; Xue, F.; Wu, Y.; Pan, D.; Adeloju, S.B.; Chen, W. Rolling Chain Amplification Based Signal-Enhanced Electrochemical Aptasensor for Ultrasensitive Detection of Ochratoxin A. Anal. Chem. 2013, 85, 10842–10849. [Google Scholar] [CrossRef] [Scilit]
- Wang, F.; Liu, X. Recent advances in the chemistry of lanthanide-doped upconversion nanocrystals. Chem. Soc. Rev. 2009, 38, 976–989. [Google Scholar] [CrossRef] [Scilit]
- Wang, P.; Wang, A.; Hassan, M.; Ouyang, Q.; Li, H.; Chen, Q. A highly sensitive upconversion nanoparticles-WS2 nanosheet sensing platform for Escherichia coli detection. Sens. Actuators B Chem. 2020, 320, 128434. [Google Scholar] [CrossRef] [Scilit]
- Li, H.; Ahmad, W.; Rong, Y.; Chen, Q.; Zuo, M.; Ouyang, Q.; Guo, Z. Designing an aptamer based magnetic and upconversion nanoparticles conjugated fluorescence sensor for screening Escherichia coli in food. Food Control 2020, 107, 106761. [Google Scholar] [CrossRef] [Scilit]
- Chen, Q.; Sheng, R.; Wang, P.; Ouyang, Q.; Wang, A.; Ali, S.; Zareef, M.; Hassan, M. Ultra-sensitive detection of malathion residues using FRET-based upconversion fluorescence sensor in food. Spectrochim. Acta Part A Mol. Biomol. Spectrosc. 2020, 241, 118654. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, M.; Hassan, M.; Li, H.; Chen, Q. Fluorometric determination of lead (II) by using aptamer-functionalized upconversion nanoparticles and magnetite-modified gold nanoparticles. Microchim. Acta 2020, 187, 85. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, Q.; Wang, H.; Han, P.; Feng, X. Fluorescent aptasensing of chlorpyrifos based on the assembly of cationic conjugated polymer-aggregated gold nanoparticles and luminescent metal–organic frameworks. Analyst 2019, 144, 6025–6032. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Qiu, Q.; Gao, R.-R.; Xie, A.; Jiao, Y.; Dong, W. A ratiometric fluorescent sensor with different DNA-templated Ag NCs as signals for ATP detection. J. Photochem. Photobiol. A Chem. 2020, 400, 112725. [Google Scholar] [CrossRef] [Scilit]
- Huang, L.; Wang, D.-B.; Singh, N.; Yang, F.; Gu, N.; Zhang, M. A dual-signal amplification platform for sensitive fluorescence biosensing of leukemia-derived exosomes. Nanoscale 2018, 10, 20289–20295. [Google Scholar] [CrossRef] [Scilit]
- Yu, X.; He, L.; Pentok, M.; Yang, H.; Yang, Y.; Li, Z.; He, N.; Deng, Y.; Li, S.; Liu, T.; et al. An aptamer-based new method for competitive fluorescence detection of exosomes. Nanoscale 2019, 11, 15589–15595. [Google Scholar] [CrossRef] [Scilit]
- Huang, R.; He, L.; Li, S.; Liu, H.; Jin, L.; Chen, Z.; Zhao, Y.; Li, Z.; Deng, Y.; He, N. A simple fluorescence aptasensor for gastric cancer exosome detection based on branched rolling circle amplification. Nanoscale 2019, 12, 2445–2451. [Google Scholar] [CrossRef] [Scilit]
- Gao, M.-L.; He, F.; Yin, B.-C.; Ye, B.-C. A dual signal amplification method for exosome detection based on DNA dendrimer self-assembly. Analyst 2019, 144, 1995–2002. [Google Scholar] [CrossRef] [Scilit]
- Zhao, X.; Zhang, W.; Qiu, X.; Mei, Q.; Yang, M.; Fu, W. Rapid and sensitive exosome detection with CRISPR/Cas12a. Anal. Bioanal. Chem. 2020, 412, 601–609. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.; Kang, K.; Wang, S.; Kang, W.; Cheng, C.; Niu, L.M.; Guo, Z. A novel label-free fluorescence aptasensor for dopamine detection based on an Exonuclease III- and SYBR Green I- aided amplification strategy. Sens. Actuators B Chem. 2020, 305, 127348. [Google Scholar] [CrossRef] [Scilit]
- Xue, N.; Wu, S.; Li, Z.; Miao, X. Ultrasensitive and label-free detection of ATP by using gold nanorods coupled with enzyme assisted target recycling amplification. Anal. Chim. Acta 2020, 1104, 117–124. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Guo, Z.; Lv, L.; Cui, C.; Wang, Y.; Ji, S.; Fang, J.; Yuan, M.; Yu, H. Detection of aflatoxin B1 with a new label-free fluorescent aptasensor based on exonuclease I and SYBR Gold. Anal. Methods 2020, 12, 2928–2933. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lu, X.; Fan, Z. RecJf exonuclease-assisted fluorescent self-assembly aptasensor for supersensitive detection of pesticides in food. J. Lumin. 2020, 226, 117469. [Google Scholar] [CrossRef] [Scilit]
- Li, B.; Liu, C.; Pan, W.; Shen, J.; Guo, J.; Luo, T.; Feng, J.; Situ, B.; An, T.; Zhang, Y.; et al. Facile fluorescent aptasensor using aggregation-induced emission luminogens for exosomal proteins profiling towards liquid biopsy. Biosens. Bioelectron. 2020, 112520. [Google Scholar] [CrossRef] [Scilit]
- Zhang, J.; Shi, J.; Liu, W.; Zhang, K.; Zhao, H.; Zhang, H.; Zhangabc, Z. A simple, specific and “on-off” type MUC1 fluorescence aptasensor based on exosomes for detection of breast cancer. Sens. Actuators B Chem. 2018, 276, 552–559. [Google Scholar] [CrossRef] [Scilit]
- Zhu, C.; Li, L.; Wang, Z.; Irfan, M.; Qu, F. Recent advances of aptasensors for exosomes detection. Biosens. Bioelectron. 2020, 160, 112213. [Google Scholar] [CrossRef] [Scilit]
- Sapkota, K.; Dhakal, S. FRET-Based Aptasensor for the Selective and Sensitive Detection of Lysozyme. Sensors 2020, 20, 914. [Google Scholar] [CrossRef] [Scilit]
- Kang, B.; Park, S.V.; Soh, H.T.; Oh, S.S. A Dual-Sensing DNA Nanostructure with an Ultrabroad Detection Range. ACS Sens. 2019, 4, 2802–2808. [Google Scholar] [CrossRef] [Scilit]
- Lan, Y.; Qin, G.; Wei, Y.; Dong, C.; Wang, L. Highly sensitive analysis of tetrodotoxin based on free-label fluorescence aptamer sensing system. Spectrochim. Acta Part A Mol. Biomol. Spectrosc. 2019, 219, 411–418. [Google Scholar] [CrossRef] [Scilit]
- Li, S.; Ma, X.; Pang, C.; Tian, H.; Xu, Z.; Yang, Y.; Lv, D.; Ge, H. Fluorometric aptasensor for cadmium (II) by using an aptamer-imprinted polymer as the recognition element. Microchim. Acta 2019, 186, 823. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, Y.; Lai, Y.; Teng, X.; Pu, S.; Yang, Z.; Pang, P.; Wang, H.; Yang, C.; Yang, W.; Barrow, C.J. Facile fluorescence strategy for sensitive detection of microcystin-LR based on dsDNA-templated copper nanoclusters. Anal. Methods 2020, 12, 1752–1758. [Google Scholar] [CrossRef] [Scilit]
- Sharma, R.; Akshath, U.S.; Bhatt, P.; Raghavarao, K.S.M.S. Fluorescent aptaswitch for chloramphenicol detection—Quantification enabled by immobilization of aptamer. Sens. Actuators B Chem. 2019, 290, 110–117. [Google Scholar] [CrossRef] [Scilit]
- Mansouri-Majd, S.; Ghasemi, F.; Salimi, A.; Sham, T. Transport Properties of a Molybdenum Disulfide and Carbon Dot Nanohybrid Transistor and Its Applications as a Hg2+ Aptasensor. ACS Appl. Electron. Mater. 2020, 2, 635–645. [Google Scholar] [CrossRef] [Scilit]
- Zhao, Y.; Cui, L.; Sun, Y.; Zheng, F.; Ke, W. Ag/CdO NP-Engineered Magnetic Electrochemical Aptasensor for Prostatic Specific Antigen Detection. ACS Appl. Mater. Interfaces 2018, 11, 3474–3481. [Google Scholar] [CrossRef] [Scilit]
- Adegokea, O.; Pereira-Barros, M.A.; Zolotovskaya, S.; Abdolvand, A.; Nic Daeid, N. Aptamer-based cocaine assay using a nanohybrid composed of ZnS/Ag2Se quantum dots, graphene oxide and gold nanoparticles as a fluorescent probe. Microchim. Acta 2020, 187, 104–112. [Google Scholar] [CrossRef] [Scilit]
- Li, J.; Liu, L.; Ai, Y.; Liu, Y.; Sun, H.; Liang, Q. Self-Polymerized Dopamine-Decorated Au NPs and Coordinated with Fe-MOF as a Dual Binding Sites and Dual Signal-Amplifying Electrochemical Aptasensor for the Detection of CEA. ACS Appl. Mater. Interfaces 2020, 12, 5500–5510. [Google Scholar] [CrossRef] [Scilit]
- Kassahun, G.; Griveau, S.; Juillard, S.; Champavert, J.; Ringuedé, A.; Bresson, B.; Tran, Y.; Bedioui, F.; Slim, C. Hydrogel Matrix-Grafted Impedimetric Aptasensors for the Detection of Diclofenac. Langmuir 2020, 36, 827–836. [Google Scholar] [CrossRef] [Scilit]
- Shu, Y.; Ma, W.; Ji, W.; Wei, H.; Mao, L. Aptamer superstructure-based electrochemical biosensor for sensitive detection of ATP in rat brain with in vivo microdialysis. Analyst 2019, 144, 1711–1717. [Google Scholar] [CrossRef] [Scilit]
- Wang, L.; Wu, A.; Wei, G. Graphene-based aptasensors: From molecule–interface interactions to sensor design and biomedical diagnostics. Analyst 2018, 143, 1526–1543. [Google Scholar] [CrossRef] [Scilit]
- Du, Y.; Li, B.; Wei, H.; Wang, Y.; Wang, E. Multifunctional Label-Free Electrochemical Biosensor Based on an Integrated Aptamer. Anal. Chem. 2008, 80, 5110–5117. [Google Scholar] [CrossRef] [Scilit]
- Goud, K.Y.; Hayat, A.; Catanante, G.; Satyanarayana, M.; Gobi, K.V.; Marty, J.L. An electrochemical aptasensor based on functionalized graphene oxide assisted electrocatalytic signal amplification of methylene blue for aflatoxin B1 detection. Electrochim. Acta 2017, 244, 96–103. [Google Scholar] [CrossRef] [Scilit]
- Cui, L.; Lu, M.; Li, Y.; Tang, B.; Zhang, C.-Y. A reusable ratiometric electrochemical biosensor on the basis of the binding of methylene blue to DNA with alternating AT base sequence for sensitive detection of adenosine. Biosens. Bioelectron. 2018, 102, 87–93. [Google Scholar] [CrossRef] [Scilit]
- Cheng, A.K.H.; Ge, B.; Yu, H.-Z. Aptamer-Based Biosensors for Label-Free Voltammetric Detection of Lysozyme. Anal. Chem. 2007, 79, 5158–5164. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gao, J.; Chen, Y.; Ji, W.; Gao, Z.; Zhang, J. Synthesis of a CdS-decorated Eu-MOF nanocomposite for the construction of a self-powered photoelectrochemical aptasensor. Analyst 2019, 144, 6617–6624. [Google Scholar] [CrossRef] [Scilit]
- Kwon, J.; Lee, Y.; Lee, T.; Ahn, J.-H. Aptamer-Based Field-Effect Transistor for Detection of Avian Influenza Virus in Chicken Serum. Anal. Chem. 2020, 92, 5524–5531. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, M.; Hu, M.; Li, Z.; He, L.; Song, Y.; Jia, Q.; Du, M.; Du, M. Construction of Tb-MOF-on-Fe-MOF conjugate as a novel platform for ultrasensitive detection of carbohydrate antigen 125 and living cancer cells. Biosens. Bioelectron. 2019, 142, 111536. [Google Scholar] [CrossRef] [Scilit]
- Ran, G.; Wu, F.; Ni, X.; Li, X.; Li, X.; Liu, D.; Sun, J.; Xie, C.; Yao, D.-S.; Bai, W. A novel label-free electrochemical aptasensor with one-step assembly process for rapid detection of lead (II) ions. Sens. Actuators B Chem. 2020, 320, 128326. [Google Scholar] [CrossRef] [Scilit]
- Zhang, J.; Shang, M.; Gao, Y.; Yan, J.; Song, W. High-performance VS2 QDs-based type II heterostructured photoanode for ultrasensitive aptasensing of lysozyme. Sens. Actuators B Chem. 2020, 304, 127411. [Google Scholar] [CrossRef] [Scilit]
- Chen, Y.; Xiang, J.; Liu, B.; Chen, Z.; Zuo, X. Gold nanoparticle-engineered electrochemical aptamer biosensor for ultrasensitive detection of thrombin. Anal. Methods 2020, 12, 3729–3733. [Google Scholar] [CrossRef] [Scilit]
- Zhou, J.; Cheng, K.; Chen, X.; Yang, R.; Lu, M.; Ming, L.; Chen, Y.; Lin, Z.; Chen, D. Determination of soluble CD44 in serum by using a label-free aptamer based electrochemical impedance biosensor. Analyst 2019, 145, 460–465. [Google Scholar] [CrossRef] [Scilit]
- Mohan, H.K.S.V.; Chee, W.K.; Li, Y.; Nayak, S.; Poh, C.L.; Thean, A.V.-Y. A highly sensitive graphene oxide based label-free capacitive aptasensor for vanillin detection. Mater. Des. 2020, 186, 108208. [Google Scholar] [CrossRef] [Scilit]
- Akhtartavan, S.; Karimi, M.; Sattarahmady, N.; Heli, H. An electrochemical signal-on apta-cyto-sensor for quantitation of circulating human MDA-MB-231 breast cancer cells by transduction of electro-deposited non-spherical nanoparticles of gold. J. Pharm. Biomed. Anal. 2020, 178, 112948. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Diaz-Amaya, S.; Lin, L.-K.; DiNino, R.E.; Ostos, C.; Stanciu, L. Inkjet printed electrochemical aptasensor for detection of Hg2+ in organic solvents. Electrochim. Acta 2019, 316, 33–42. [Google Scholar] [CrossRef] [Scilit]
- Ho, L.S.J.; Fogel, R.; Limson, J. Generation and screening of histamine-specific aptamers for application in a novel impedimetric aptamer-based sensor. Talanta 2020, 208, 120474. [Google Scholar] [CrossRef] [Scilit]
- Song, Y.; Xu, M.; Li, Z.; He, L.; Hu, M.; He, L.; Zhang, Z.; Du, M. Ultrasensitive detection of bisphenol A under diverse environments with an electrochemical aptasensor based on multicomponent AgMo heteronanostructure. Sens. Actuators B Chem. 2020, 321, 128527. [Google Scholar] [CrossRef] [Scilit]
- Zhang, P.; Zhang, Y.; Xiong, X.; Lu, Y.; Jia, N. A sensitive electrochemiluminescence immunoassay for glycosylated hemoglobin based on Ru(bpy)32+ encapsulated mesoporous polydopamine nanoparticles. Sens. Actuators B Chem. 2020, 321, 128626. [Google Scholar] [CrossRef] [Scilit]
- Douaki, A.; Abera, B.D.; Cantarella, G.; Shkodra, B.; Mushtaq, A.; Ibba, P.; Inam, A.S.; Petti, L.; Lugli, P. Flexible Screen Printed Aptasensor for Rapid Detection of Furaneol: A Comparison of CNTs and AgNPs Effect on Aptasensor Performance. Nanomaterials 2020, 10, 1167. [Google Scholar] [CrossRef] [Scilit]
- Zhao, J.; Liang, D.; Gao, S.; Hu, X.; Koh, K.; Chen, H. Analyte-resolved magnetoplasmonic nanocomposite to enhance SPR signals and dual recognition strategy for detection of BNP in serum samples. Biosens. Bioelectron. 2019, 141, 111440. [Google Scholar] [CrossRef] [Scilit]
- Yang, Y.-J.; Zhou, Y.; Xing, Y.; Zhang, G.-M.; Zhang, Y.; Zhang, C.-H.; Lei, P.; Dong, C.; Deng, X.; He, Y.; et al. A Label-free aptasensor based on Aptamer/NH2 Janus particles for ultrasensitive electrochemical detection of Ochratoxin A. Talanta 2019, 199, 310–316. [Google Scholar] [CrossRef] [Scilit]
- Song, J.; Huang, M.; Jiang, N.; Zheng, S.; Mu, T.; Meng, L.; Liu, Y.; Liu, J.; Chen, G. Ultrasensitive detection of amoxicillin by TiO2-g-C3N4@AuNPs impedimetric aptasensor: Fabrication, optimization, and mechanism. J. Hazard. Mater. 2020, 391, 122024. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, X.; Gao, F.; Gong, Y.; Liu, G.; Zhang, Y.; Ding, C. Electrochemical aptasensor based on conductive supramolecular polymer hydrogels for thrombin detection with high selectivity. Talanta 2019, 205, 120140. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, M.; Yin, J.; Gao, C.; Qiu, G.; Meng, A.; Li, Q. The construction of electrochemical aptasensor based on coral-like poly-aniline and Au nano-particles for the sensitive detection of prostate specific antigen. Sens. Actuators B Chem. 2019, 295, 93–100. [Google Scholar] [CrossRef] [Scilit]
- Mir, M.; Vreeke, M.; Katakis, I. Different strategies to develop an electrochemical thrombin aptasensor. Electrochem. Commun. 2006, 8, 505–511. [Google Scholar] [CrossRef] [Scilit]
- Wu, Q.; Tan, R.; Mi, X.; Tu, Y. Electrochemiluminescent aptamer-sensor for alpha synuclein oligomer based on a metal–organic framework. Analyst 2020, 145, 2159–2167. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- He, B.; Wang, L.; Dong, X.; Yan, X.; Li, M.; Yan, S.; Yan, D. Aptamer-based thin film gold electrode modified with gold nanoparticles and carboxylated multi-walled carbon nanotubes for detecting oxytetracycline in chicken samples. Food Chem. 2019, 300, 125179. [Google Scholar] [CrossRef] [Scilit]
- Ding, J.; Zhang, D.; Liu, Y.; Yu, M.; Zhan, X.; Zhang, D.; Zhou, P. An electrochemical aptasensor for detection of lead ions using a screen-printed carbon electrode modified with Au/polypyrrole composites and toluidine blue. Anal. Methods 2019, 11, 4274–4279. [Google Scholar] [CrossRef] [Scilit]
- Mazaafrianto, D.N.; Ishida, A.; Maeki, M.; Tani, H.; Tokeshi, M. An Electrochemical Sensor Based on Structure Switching of Dithiol-modified Aptamer for Simple Detection of Ochratoxin A. Anal. Sci. 2019, 35, 1221–1226. [Google Scholar] [CrossRef] [Scilit]
- Wang, C.; Li, Y.; Zhao, Q. A competitive electrochemical aptamer-based method for aflatoxin B1 detection with signal-off response. Anal. Methods 2019, 12, 646–650. [Google Scholar] [CrossRef] [Scilit]
- Ghalehno, M.H.; Mirzaei, M.; Torkzadeh-Mahani, M. Electrochemical aptasensor for activated protein C using a gold nanoparticle—Chitosan/graphene paste modified carbon paste electrode. Bioelectrochemistry 2019, 130, 107322. [Google Scholar] [CrossRef] [Scilit]
- Fu, Y.; Callaway, Z.; Lum, J.; Wang, R.; Lin, J.; Li, Y. Exploiting Enzyme Catalysis in Ultra-Low Ion Strength Media for Impedance Biosensing of Avian Influenza Virus Using a Bare Interdigitated Electrode. Anal. Chem. 2014, 86, 1965–1971. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Svigelj, R.; Dossi, N.; Pizzolato, S.; Toniolo, R.; Miranda-Castro, R.; De-Los-Santos-Álvarez, N.; Lobo-Castañón, M.J. Truncated aptamers as selective receptors in a gluten sensor supporting direct measurement in a deep eutectic solvent. Biosens. Bioelectron. 2020, 165, 112339. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bai, Z.; Chen, Y.; Li, F.; Yin, H.; Yin, H.; Ai, S. Electrochemical aptasensor for sulfadimethoxine detection based on the triggered cleavage activity of nuclease P1 by aptamer-target complex. Talanta 2019, 204, 409–414. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, G.; Hou, J.; Zhao, Y.; Bao, J.; Yang, M.; Fa, H.; Yang, Y.; Li, L.; Huo, D.; Hou, C. Dual-signal aptamer sensor based on polydopamine-gold nanoparticles and exonuclease I for ultrasensitive malathion detection. Sens. Actuators B Chem. 2019, 287, 428–436. [Google Scholar] [CrossRef] [Scilit]
- Tan, Y.; Wei, X.; Zhang, Y.; Wang, P.; Qiu, B.; Guo, L.; Lin, Z.; Yang, H.-H. Exonuclease-Catalyzed Target Recycling Amplification and Immobilization-free Electrochemical Aptasensor. Anal. Chem. 2015, 87, 11826–11831. [Google Scholar] [CrossRef] [Scilit]
- Sun, C.; Liu, M.; Sun, H.; Lu, H.; Liu, M. Immobilization-free photoelectrochemical aptasensor for environmental pollutants: Design, fabrication and mechanism. Biosens. Bioelectron. 2019, 140, 111352. [Google Scholar] [CrossRef] [Scilit]
- Zhang, R.; Wang, Y.; Qu, X.; Li, S.; Zhao, Y.; Zhang, F.; Liu, S.; Huang, J.; Yu, J. A label-free electrochemical platform for the detection of antibiotics based on cascade enzymatic amplification coupled with a split G-quadruplex DNAzyme. Analyst 2019, 144, 4995–5002. [Google Scholar] [CrossRef] [Scilit]
- Yi, J.; Liu, Z.; Liu, J.; Liu, H.; Xia, F.; Tian, D.; Zhou, C. A label-free electrochemical aptasensor based on 3D porous CS/rGO/GCE for acetamiprid residue detection. Biosens. Bioelectron. 2020, 148, 111827. [Google Scholar] [CrossRef] [Scilit]
- Wang, H.; Liu, S.; Yu, J.; Xu, W.; Guo, Y.; Huang, J. Target–aptamer binding triggered quadratic recycling amplification for highly specific and ultrasensitive detection of antibiotics at the attomole level. Chem. Commun. 2015, 51, 8377–8380. [Google Scholar] [CrossRef] [Scilit]
- Wang, W.; Xu, Y.; Cheng, N.; Xie, Y.; Huang, K.; Xu, W. Dual-recognition aptazyme-driven DNA nanomachine for two-in-one electrochemical detection of pesticides and heavy metal ions. Sens. Actuators B Chem. 2020, 321, 128598. [Google Scholar] [CrossRef] [Scilit]






Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Shaban, S.M.; Kim, D.-H. Recent Advances in Aptamer Sensors. Sensors 2021, 21, 979. https://doi.org/10.3390/s21030979
Shaban SM, Kim D-H. Recent Advances in Aptamer Sensors. Sensors. 2021; 21(3):979. https://doi.org/10.3390/s21030979
Chicago/Turabian StyleShaban, Samy M., and Dong-Hwan Kim. 2021. "Recent Advances in Aptamer Sensors" Sensors 21, no. 3: 979. https://doi.org/10.3390/s21030979
APA StyleShaban, S. M., & Kim, D.-H. (2021). Recent Advances in Aptamer Sensors. Sensors, 21(3), 979. https://doi.org/10.3390/s21030979
