Correction: Senn et al. The Community Structure of eDNA in the Los Angeles River Reveals an Altered Nitrogen Cycle at Impervious Sites. Diversity 2023, 15, 823

Savanah Senn; Sharmodeep Bhattacharyya; Gerald Presley; Anne E. Taylor; Rayne Stanis; Kelly Pangell; Daila Melendez; Jillian Ford

doi:10.3390/d17030208

,

and

¹

Environmental Sciences Graduate Program, Oregon State University, Corvallis, OR 97331, USA

²

Department of Agriculture Sciences, Los Angeles Pierce College, 6201 Winnetka Avenue, PMB 553, Woodland Hills, CA 91304, USA

³

Department of Statistics, Oregon State University, Corvallis, OR 97331, USA

⁴

Department of Wood Science & Engineering, Oregon State University, Corvallis, OR 97331, USA

Diversity2025, 17(3), 208;https://doi.org/10.3390/d17030208

Version Notes

Order Reprints

In the original publication [1], there was a mistake in Table 1 as published. There was a sorting error with the table before the references were added. The corrected Table 1 appears below. The authors state that the scientific conclusions are unaffected. This correction was approved by the Academic Editor. The original publication has also been updated.

Table 1. Tabulation of the multiple types of genomic data that were available for evaluation of the L.A. River, including eukaryotes [20,21].

Reference

Senn, S.; Bhattacharyya, S.; Presley, G.; Taylor, A.E.; Stanis, R.; Pangell, K.; Melendez, D.; Ford, J. The Community Structure of eDNA in the Los Angeles River Reveals an Altered Nitrogen Cycle at Impervious Sites. Diversity 2023, 15, 823. [Google Scholar] [CrossRef]

Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).

Marker	Description	Target Organisms	Forward Primer	Reverse Primer	Reference
16S	Prokaryotic rRNA small subunit	Bacteria, archaea	GTGYCAGCMGCCGCGGTAA	GGACTACNVGGGTWTCTAAT	F: 515F and R: 806R, see Caporaso et al., 2012 [22]
18S	Eukaryotic rRNA small subunit	Fungi, algae, protists	GTACACACCGCCCGTC	TGATCCTTCTGCAGGTTCACCTAC	Amaral-Zettler et al., 2009 [23]; Euk_1391f and EukBr
PITS	Plant rRNA internal transcribed spacer	Plants	ATGCGATACTTGGTGTGAAT	GACGCTTCTCCAGACTACAAT	Gu et al., 2013 [24]
CO1	Mitochondrial cytochrome oxidase subunit I	Animals	GGWACWGGWTGAACWGTWTAYCCYCC	TANACYTCnGGRTGNCCRAARAAYCA	Leray et al., 2013 [25]
FITS	Fungal rRNA internal transcribed spacer	Fungi	GGAAGTAAAAGTCGTAACAAGG	CAAGAGATCCGTTGTTGAAAGTT	F: ITS5, White et al., 1990 [26]; R: 5.8S, Epp et al., 2012 [27]
12S	Mitochondrial rRNA small subunit	Fish, birds, snakes, insects	TAGAACAGGCTCCTCTAG	TTAGATACCCCACTATGC	Epp et al., 2012 [27]

Correction: Senn et al. The Community Structure of eDNA in the Los Angeles River Reveals an Altered Nitrogen Cycle at Impervious Sites. Diversity 2023, 15, 823

Reference

Article Metrics

Citations

Article Access Statistics