New Insights About Distribution Areas of Telestes souffia and Telestes muticellus: Changes and Overlapping Zones for Community Interest Fish Species
Abstract
:1. Introduction
2. Materials and Methods
2.1. Study Area
2.2. Fish Samplings and Biometric and Meristic Analyses
2.3. Genetic Samplings
2.4. Genetic Analyses
2.5. Statistical Analyses
3. Results
3.1. Biometric and Meristic Characterization
3.2. Genetical Characterization
3.3. Phylogenetic Tree
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Costedoat, C.; Gilles, A. Quaternary pattern of freshwater fishes in Europe: Comparative phylogeography and conservation perspective. Open Conserv. Biol. J. 2009, 3, 36–48. [Google Scholar] [CrossRef]
- Schiavon, A.; Comoglio, C.; Candiotto, A.; Spairani, M.; Hölker, F.; Tarena, F.; Watz, J.; Nyqvist, D. Navigating the drought: Upstream migration of a small-sized Cypriniformes (Telestes muticellus) in response to drying in a partially intermittent mountain stream. Knowl. Manag. Aquat. Ecosyst. 2024, 425, 6. [Google Scholar] [CrossRef]
- Miqueleiz, I.; Miranda, R.; Cancellario, T. European water frame directive ecoregions do not adequately represent freshwater fish biogeography. Ecol. Inform. 2024, 81, 102629. [Google Scholar] [CrossRef]
- Wisz, M.S.; Hijmans, R.J.; Li, J.; Peterson, A.T.; Graham, C.H.; Guisan, A.; NCEAS Predicting Species Distributions Working Group. Effects of sample size on the performance of species distribution models. Divers. Distrib. 2008, 14, 763–773. [Google Scholar] [CrossRef]
- Münzel, F.M.; Salzburger, W.; Sanetra, M.; Grabherr, B.; Meyer, A. Genetic structure of the vairone Telestes souffia in the eastern part of Lake Constance, central Europe. J. Fish Biol. 2010, 77, 1158–1164. [Google Scholar] [CrossRef]
- Veličković, T.Z.; Simić, V.M.; Šanda, R.; Radenković, M.D.; Milošković, A.M.; Radojković, N.M.; Marić, S.P. New Record of a Population of Telestes souffia (Risso, 1827) (Actinopterygii: Cyprinidae) in Serbia. Acta Zool. Bulg. 2020, 72, 13–20. [Google Scholar]
- Gilles, A.; Costedoat, C.; Barascud, B.; Voisin, A.; Banarescu, P.; Bianco, P.G.; Economidis, P.S.; Marić, D.; Chappaz, R. Speciation pattern of Telestes souffia complex (Teleostei, Cyprinidae) in Europe using morphological and molecular markers. Zool. Scr. 2010, 39, 225–242. [Google Scholar] [CrossRef]
- Buj, I.; Marčić, Z.; Ćaleta, M.; Šanda, R.; Geiger, M.F.; Freyhof, J.; Machordom, A.; Vukić, J. Ancient connections among the European rivers and watersheds revealed from the evolutionary history of the genus Telestes (Actinopterygii; Cypriniformes). PLoS ONE 2017, 12, e0187366. [Google Scholar] [CrossRef]
- Curtean-Bănăduc, A.; Didenko, A.; Guti, G.; Bănăduc, D. Telestes souffia (Risso, 1827) species conservation at the eastern limit of Range–Vişeu river basin, Romania. Appl. Ecol. Envirion. Res. 2018, 16, 291–303. [Google Scholar] [CrossRef]
- Kottelat, M.; Freyhof, J. Handbook of European Freshwater Fishes; Kottelat, Cornol, Freyhof: Berlin, Germany, 2007. [Google Scholar]
- Marčić, Z.; Buj, I.; Duplić, A.; Ćaleta, M.; Mustafić, P.; Zanella, D.; Zupančič, P.; Mrakovčić, M. A new endemic cyprinid species from the Danube drainage. J. Fish Biol. 2011, 79, 418–430. [Google Scholar] [CrossRef]
- Bogutskaya, N.G.; Zupančič, P.; Bogut, I.; Naseka, A.M. Two new freshwater fish species of the genus Telestes (Actinopterygii, Cyprinidae) from karst poljes in Eastern Herzegovina and Dubrovnik littoral (Bosnia and Herzegovina and Croatia). ZooKeys 2012, 180, 53–80. [Google Scholar] [CrossRef] [PubMed]
- Froese, R.; Pauly, D. “Species in Genus Telestes”, FishBase. World Wide Web Electronic Publication, January 2024 Version. Available online: http://www.fishbase.org (accessed on 2 November 2024).
- Barbieri, R.; Stoumboudi, M.; Kalogianni, E.; Leonardos, I. First report on the spawning migration and early life development of a cyprinid species of the genus Telestes. J. Appl. Ichthyol. 2020, 36, 817–824. [Google Scholar] [CrossRef]
- Ketmaier, V.; Bianco, P.G.; Cobolli, M.; Krivokapic, M.; Caniglia, R.; De Matthaeis, E. Molecular phylogeny of two lineages of Leuciscinae cyprinids (Telestes and Scardinius) from the peri-Mediterranean area based on cytochrome b data. Mol. Phylogenet. Evol. 2004, 32, 1061–1071. [Google Scholar] [CrossRef] [PubMed]
- Freyhof, J.; Kottelat, M. Telestes souffia. The IUCN Red List of Threatened Species 2008: e.T61397A12461824. Available online: https://www.iucnredlist.org/species/61397/137342065 (accessed on 19 August 2024).
- Lorenzoni, M.; Borghesan, F.; Carosi, A.; Ciuffardi, L.; De Curtis, O.; Delmastro, G.B.; Di Tizio, L.; Franzoi, P.; Maio, G.; Mojetta, A.; et al. Check–List Dell’ittiofauna Delle Acque Dolci Italiane. Version 3.0.5. AIIAD. 2019. Available online: http://www.aiiad.it/sito/images/docs/sistematica/Check%20list%20ittiofauna%20Italiana_GdL3.0_05032021.pdf (accessed on 20 August 2024).
- Crivelli, A.J.; Bianco, P.G. Telestes muticellus. The IUCN Red List of Threatened Species 2006: e.T61389A12458554. Available online: https://www.iucnredlist.org/species/61389/137341872 (accessed on 19 August 2024).
- Rondinini, C.; Battistoni, A.; Teofili, C. Lista Rossa IUCN dei Vertebrati Italiani 2022; Comitato Italiano IUCN e Ministero dell’Ambiente e della Sicurezza Energetica: Rome, Italy, 2022. [Google Scholar]
- Mosetti, F. Quaderni, E.T.P. Sintesi Sull’idrologia del Friuli-Venezia Giulia; E.T.P.—Regione Friuli Venezia Giulia: Udine, Italy, 1983. [Google Scholar]
- Pastorino, P.; Bertoli, M.; Squadrone, S.; Brizio, P.; Piazza, G.; Oss Noser, A.G.; Prearo, M.; Abete, M.C.; Pizzul, E. Detection of trace elements in freshwater macrobenthic invertebrates of different functional feeding guilds: A case study in Northeast Italy. J. Ecohydrol. Hydrobiol. 2019, 19, 428–440. [Google Scholar] [CrossRef]
- Bertoli, M.; Piazza, G.; Pastorino, P.; Prearo, M.; Cozzoli, F.; Vignes, F.; Basset, A.; Pizzul, E. Macrobenthic invertebrate energy densities and ecological status in freshwater watercourses (Friuli Venezia Giulia, Northeast Italy). Aquat. Ecol. 2021, 55, 501–518. [Google Scholar] [CrossRef]
- Stoch, F.; Paradisi, S.; Buda Dancevich, M. Carta Ittica del Friuli–Venezia Giulia; Regione Autonoma Friuli–Venezia Giulia, Arti Grafiche Friulane: Udine, Italy, 1992. [Google Scholar]
- Pizzul, E.; Moro, A.; Battiston, F. Pesci e Acque Interne del Friuli–Venezia Giulia, Aggiornamento Parziale Alla Carta Ittica 1992; Ente Tutela Pesca del Friuli Venezia Giulia: Udine, Italy, 2006; Available online: www.entetutelapesca.it (accessed on 24 April 2023).
- Topic Popovic, N.; Strunjak-Perovic, I.; Coz-Rakovac, R.; Barisic, J.; Jadan, M.; Persin Berakovic, A.; Sauerborn Klobucar, R.S. Tricaine methane-sulfonate (MS-222) application in fish anaesthesia. J. Appl. Ichthyol. 2012, 28, 553–564. [Google Scholar] [CrossRef]
- Schneider, C.A.; Rasband, W.S.; Eliceiri, K.W. NIH Image to ImageJ: 25 years of image analysis. Nat. Methods 2012, 9, 671–675. [Google Scholar] [CrossRef]
- Tortonese, E. Fauna d’Italia. Osteichthyes (Pesci ossei); Calderini Ed.: Bologna, Italy, 1970. [Google Scholar]
- Vuković, T.; Ivanović, B. Freswater Fishes of Jugoslavija; Zemaljski muzej BiH: Sarajevo, Bosnia, 1971. (In Bosnian) [Google Scholar]
- Simonović, P. Freshwater Fish of Serbia; NNK Internacional, Zavod za Zaštitu Prirode Srbije, Biološki Fakultet: Beograd, Serbia, 2001. (In Bosnian) [Google Scholar]
- Keith, P.; Allardi, J. Atlas of Freshwater Fishes of France (Atlas des Poissons d’eau Douce de France); Muséum National d’Histoire Naturelle: Paris, France, 2001. (In French) [Google Scholar]
- Gandolfi, G.; Zerunian, S.; Torricelli, P.; Marconato, A. I Pesci Delle Acque Interne Italiane; Istituto Poligrafico e Zecca dello Stato—Libreria dello Stato: Roma, Italia, 1991. [Google Scholar]
- Zardoya, R.; Doadrio, I. Phylogenetic relationships of Iberian cyprinids: Systematic and biogeographical implications. Proc. R. Soc. B Biol. Sci. 1998, 265, 1365–1372. [Google Scholar] [CrossRef]
- Lopez, J.A.; Chen, W.; Ortì, G. Esociform phylogeny. Copeia 2004, 2004, 449–464. [Google Scholar] [CrossRef]
- Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef]
- Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular Evolutionary Genetics Analysis version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef] [PubMed]
- Lemoine, F.; Correia, D.; Lefort, V.; Doppelt-Azeroual, O.; Mareuil, F.; Cohen-Boulakia, S.; Gascuel, O. NGPhylogeny.fr: New generation phylogenetic services for nonspecialists. Nucleic Acids Res. 2019, 47, W260–W265. [Google Scholar] [CrossRef]
- Letunic, I.; Bork, P. Interactive Tree of Life (iTOL) v5: An online tool for phylogenetic tree display and annotation. Nucleic Acids Res. 2021, 49, W293–W296. [Google Scholar] [CrossRef] [PubMed]
- Conover, W.J.; Iman, R.L. On Multiple-Comparisons Procedures; Technical Report LA-7677-MS; Los Alamos Scientific Laboratory: Los Alamos, NM, USA, 1979. [Google Scholar]
- Conover, W.J. Practical Nonparametric Statistics; John Wiley & Sons: Hoboken, NJ, USA, 1999; Volume 350. [Google Scholar]
- González-Castro, M.; Rosso, J.J.; Mabragaña, E.; Díaz de Astarloa, J.M. Surfing among species, populations and morphotypes: Inferring boundaries between two species of new world silversides (Atherinopsidae). Comptes Rendus Biol. 2016, 339, 10–23. [Google Scholar] [CrossRef]
- Glon, M.G.; Thoma, R.F.; Daly, M.; Freudenstein, J.V. Lacunicambarus chimera: A new species of burrowing crayfish (Decapoda: Cambaridae) from Illinois, Indiana, Kentucky, and Tennessee. Zootaxa 2019, 4544, 451–478. [Google Scholar] [CrossRef]
- McCune, B.; Grace, J.B.; Urban, D.L. Analysis of Ecological Communities; MjM Software Design: Gleneden Beach, OR, USA, 2002. [Google Scholar]
- Fetzner, J.W.; Taylor, C.A. Two new species of freshwater crayfish of the genus Faxonius (Decapoda: Cambaridae) from the Ozark Highlands of Arkansas and Missouri. Zootaxa 2018, 4399, 491–520. [Google Scholar] [CrossRef]
- Clarke, K.R. Non-parametric multivariate analyses of changes in community structure. Aust. J. Ecol. 1993, 18, 117–143. [Google Scholar] [CrossRef]
- Anderson, M.J. Distance-based tests for homogeneity of multivariate dispersions. Biometrics 2006, 62, 245–253. [Google Scholar] [CrossRef]
- R Core Team. R: A Language and Environment for Statistical Computing; R Foundation for Statistical Computing: Vienna, Austria, 2021; Available online: https://www.R-project.org/ (accessed on 1 September 2024).
- RStudio Team. RStudio: Integrated Development Environment for R; R Studio, PBC: Boston, MA, USA, 2021; Available online: http://www.rstudio.com/ (accessed on 1 September 2024).
- Oksanen, J.; Blanchet, F.G.; Friendly, M.; Kindt, R.; Legendre, P.; McGlinn, D.; Minchin, P.R.; O’Hara, R.B.; Simpson, G.L.; Solymos, P.; et al. Vegan: Community Ecology Package. R Package Version 2.5-2. 2018. Available online: http://CRAN.Rproject.org/package=vegan (accessed on 11 July 2024).
- Perea, S.; Bohme, M.; Zupančič, P.; Freyhof, J.; Šanda, R.; Ozuluğ, M.; Abdoli, A.; Doadrio, I. Phylogenetic relationships and biogeographical patterns in Circum-Mediterranean subfamily Leuciscinae (Teleostei, Cyprinidae) inferred from both mitochondrial and nuclear data. BMC Evol. Biol. 2010, 10, 265. [Google Scholar] [CrossRef]
- Schönhuth, S.; Vukić, J.; Šanda, R.; Yang, L.; Mayden, R.L. Phylogenetic relationships and classification of the Holarctic family Leuciscidae (Cypriniformes: Cyprinoidei). Mol. Phylogenet. Evol. 2018, 127, 781–799. [Google Scholar] [CrossRef]
- Benovics, M. Host-Specific Parasites (Dactylogyrus, Monogenea) as Indicator of Evolution and Historical Dispersion of Their Cyprinid Fish Hosts in the Mediterranean Region. Ph.D. Thesis, Department of Botany and Zoology, Masaryk University, Brno, Czechia, 2020. [Google Scholar]
- Stefani, F.; Galli, P.; Zaccara, S.; Crosa, G. Genetic variability and phylogeography of the cyprinid Telestes muticellus within the Italian peninsula as revealed by mitochondrial DNA. J. Zool. Syst. Evol. Res. 2004, 42, 323–331. [Google Scholar] [CrossRef]
- Zaccara, S.; Stefani, F.; Delmastro, G.B. Phylogeographical structure of vairone Telestes muticellus (Teleostei, Cyprinidae) within three European peri-Mediterranean districts. Zool. Scr. 2007, 36, 443–453. [Google Scholar] [CrossRef]
- Gridelli, E. I Pesci D’acqua Dolce Della Venezia Giulia; Del Bianco e Figlio: Udine, Italy, 1936. [Google Scholar]
- Marchetto, F.; Zaccara, S.; Muenzel, F.M.; Salzburger, W. Phylogeography of the Italian vairone (Telestes muticellus, Bonaparte 1837) inferred by microsatellite markers: Evolutionary history of a freshwater fish species with a restricted and fragmented distribution. BMC Evol. Biol. 2010, 10, 111. [Google Scholar] [CrossRef]
- GBIF.org. GBIF Home Page. 2024. Available online: https://www.gbif.org (accessed on 11 October 2024).
- Bianco, P.G. Factors affecting the distribution of freshwater fishes especially in Italy. Cybium 1995, 19, 241–259. [Google Scholar]
- Chiesa, S.; Filonzi, L.; Ferrari, C.; Vaghi, M.; Bilò, F.; Piccinini, A.; Zuccon, G.; Wilson, R.C.; Ulheim, J.; Nonnis Marzano, F. Combinations of distinct molecular markers allow to genetically characterize marble trout (Salmo marmoratus) breeders and stocks suitable for reintroduction plans. Fish. Res. 2016, 176, 55–64. [Google Scholar] [CrossRef]
- Gandolfi, A.; Ferrari, C.; Crestanello, B.; Girardi, M.; Lucentini, L.; Meraner, A. Population genetics of pike, genus Esox (Actinopterygii, Esocidae), in Northern Italy: Evidence for mosaic distribution of native, exotic and introgressed populations. Hydrobiologia 2017, 794, 73–92. [Google Scholar] [CrossRef]
- Zaccara, S.; Quadroni, S.; Vanetti, I.; Carosi, A.; La Porta, G.; Crosa, G.; Britton, R.; Lorenzoni, M. Morphologic and genetic variability in the Barbus fishes (Teleostei, Cyprinidae) of Central Italy. Zool. Scr. 2019, 48, 289–301. [Google Scholar] [CrossRef]
- Salzburger, W.; Brandstätter, A.; Gilles, A.; Parson, W.; Hempel, M.; Sturmbauer, C.; Meyer, A. Phylogeography of the vairone (Leuciscus souffia, Risso 1826) in Central Europe. Mol. Ecol. 2003, 12, 2371–2386. [Google Scholar] [CrossRef]
- Dubut, V.; Fouquet, A.; Voisin, A.; Costedoat, C.; Chappaz, R.; Gilles, A. From Late Miocene to Holocene: Processes of Differentiation within the Telestes Genus (Actinopterygii: Cyprinidae). PLoS ONE 2012, 7, e34423. [Google Scholar] [CrossRef]
- Webb, J.F.; Ramsay, J.B. New Interpretation of the 3-D Configuration of Lateral Line Scales and the Lateral Line Canal Contained within Them. Copeia 2017, 105, 339–347. [Google Scholar] [CrossRef]
Site | Watercourse | Coordinates | Temperature | pH | Dissolved Oxygen | Conductivity | PO43− | NO3− | NH4+ | Environmental Diversity | Main | Vegetation | ||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Longitude | Latitude | (°C) | (mg L−1) | (%) | (µS cm−1) | (mg L−1) | (mg L−1) | (mg L−1) | (Mesohabitat) | Substrates | Cover (%) | |||
1 | Isonzo River | 13.604039 | 45.948905 | 16.5 | 8 | 9.8 | 100.5 | 291.5 | 0.1 | 3.2 | 0.1 | Uniform flow areas (30%), pools (70%) | Cobbles and boulders 60%, coarse gravel and cobbles 30%, coarse and fine gravel 10% | Absent |
2 | Chiarò Creek | 13.459667 | 46.063598 | 14.9 | 7.6 | 9.3 | 91 | 488.5 | 0.1 | 3.3 | 0.1 | Uniform flow areas (30%), pools (70%), riffles (20%), glides (10%) | Cobbles and boulders 10%, coarse gravel and cobbles 60%, coarse and fine gravel 30% | Absent |
3 | Natisone River | 13.384925 | 46.037147 | 24.5 | 8.7 | 8.1 | 96 | 268 | 0.1 | 6.8 | 0.1 | Uniform flow areas (60%), pools (30%), riffles (10%), glides (10%) | Coarse gravel and cobbles 50%, coarse and fine gravel 40%, fine gravel 10% | Absent |
4 | Cividina Ditch | 13.258357 | 46.171388 | - | - | - | - | - | - | - | - | Uniform flow areas (100%) | Artificial (concrete) 100% | 60% |
5 | Miliana Ditch | 13.093943 | 45.872071 | 18.5 | 7.9 | 10.2 | 108 | 598 | 0.1 | 23.6 | 0 | Uniform flow areas (50%), pools (30%), riffles (10%), glides (20%) | Coarse and fine gravel 20%, sand and fine gravel 40%, mud 40% | 60% |
6 | Cerclizza Ditch | 13.081191 | 45.873725 | 18.6 | 8 | 10.7 | 105 | 595 | 0.1 | 19.5 | 0.1 | Uniform flow areas (50%), pools (30%), riffles (10%), glides (20%) | Cobbles and gravel 20%, coarse and fine gravel 30%, sand and fine gravel 20%, mud 30% | Absent |
7 | Brentella Ditch | 12.797391 | 45.993459 | 19 | 8.1 | 10.1 | 100 | 487 | 0 | 9.9 | 0.1 | Uniform flow areas (60%), pools (20%), riffles (20%) | Coarse and fine gravel 30%, sand and fine gravel 30%, mud 40% | 40% |
8 | Ledra River | 13.061988 | 46.199219 | 14.5 | 8.2 | 10.7 | 109 | 516.5 | 0.1 | 6.1 | 0.1 | Uniform flow areas (50%), pools (30%), riffles (20%) | Coarse gravel and cobbles 10%, coarse and fine gravel 50%, sand and fine gravel 10%, mud 20%, woody debris and roots 10% | 30% |
9 | Tagliamento River | 13.093955 | 46.280339 | 13.8 | 7.8 | 9.7 | 97.5 | 503.5 | 0.1 | 6.1 | 0.1 | Uniform flow areas (60%), pools (30%), riffles (10%) | Cobbles and boulders 30%, coarse gravel and cobbles 40%, coarse and fine gravel 20%, sand and fine gravel 10% | Absent |
Telestes souffia | Telestes muticellus | |||
---|---|---|---|---|
Kottelat and Freyhof [10], Vuković and Ivanović [28], Simonović [29], Keith and Allardi [30] | Veličković et al. (2020) [6] | Gandolfi et al. (1991) [31] | Tortonese (1970) [27] | |
LL | 50–57 + 2–3 | 50–53 + 2–3 | 45–51 | 45–53 |
SALL | 8–9 | 8–10 | ||
SBLL | 41/2–5 | 5 | 4–5 | 4–5 |
PD | 7 | 7 | 10–12 | 8–10 |
PC | 17–21 | 18–20 | 19–21 | |
PP | 14–16 | |||
PV | 10 | 9 | 8 | |
PA | 11 | 11 | 10–12 | 8–10 |
Marker | Primer Name | Sequence (5′-3′) | Reference |
---|---|---|---|
cyt b | Glu-F | GAAGAACCACCGTTGTTATTCAA | Zardoya et al. [32] |
Thr-R | ACCTCCRATCTYCGGATTACA | ||
RAG1 | RAG1F1 | CTGAGCTGCAGTCAGTACCATAAGATGT | López et al. [33] |
RAG1R1 | CTGAGTCCTTGTGAGCTTCCATRAAYTT | ||
RAG1R2 | TGAGCCTCCATGAACTTCTGAAGRTAYTT | ||
RAG1_CM | RAG1_CM_FW | TGGGAGATGTCAGCGAGAAG | This work |
RAG1_CM_RV | ATCCAGAGTAGGCTGGGTCT |
Meristic Characters | Code | Average Dissimilarity | Contribution % | Cumulative Contribution % |
---|---|---|---|---|
Number of lateral line scales | LL | 1.37 | 44.54 | 44.54 |
Number of rays in anal fin | PA | 0.62 | 20.37 | 64.91 |
Number of rays in dorsal fin | PD | 0.37 | 12.07 | 76.98 |
Number of rays in pectoral fin | PP | 0.35 | 11.31 | 88.28 |
Number of rays in ventral fin | PV | 0.21 | 6.87 | 95.16 |
Number of scales below the lateral line | SBLL | 0.15 | 4.85 | 100.00 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bertoli, M.; Manfrin, C.; Giulianini, P.G.; Pallavicini, A.; Pastorino, P.; Pizzul, E. New Insights About Distribution Areas of Telestes souffia and Telestes muticellus: Changes and Overlapping Zones for Community Interest Fish Species. Diversity 2024, 16, 713. https://doi.org/10.3390/d16120713
Bertoli M, Manfrin C, Giulianini PG, Pallavicini A, Pastorino P, Pizzul E. New Insights About Distribution Areas of Telestes souffia and Telestes muticellus: Changes and Overlapping Zones for Community Interest Fish Species. Diversity. 2024; 16(12):713. https://doi.org/10.3390/d16120713
Chicago/Turabian StyleBertoli, Marco, Chiara Manfrin, Piero Giulio Giulianini, Alberto Pallavicini, Paolo Pastorino, and Elisabetta Pizzul. 2024. "New Insights About Distribution Areas of Telestes souffia and Telestes muticellus: Changes and Overlapping Zones for Community Interest Fish Species" Diversity 16, no. 12: 713. https://doi.org/10.3390/d16120713
APA StyleBertoli, M., Manfrin, C., Giulianini, P. G., Pallavicini, A., Pastorino, P., & Pizzul, E. (2024). New Insights About Distribution Areas of Telestes souffia and Telestes muticellus: Changes and Overlapping Zones for Community Interest Fish Species. Diversity, 16(12), 713. https://doi.org/10.3390/d16120713