Similar Ones Are Not Related and Vice Versa—New Dendronotus Taxa (Nudibranchia: Dendronotidae) from the North Atlantic Ocean Provide a Platform for Discussion of Global Marine Biodiversity Patterns

Korshunova, Tatiana; Grøtan, Viktor V.; Johnson, Kjetil B.; Bakken, Torkild; Picton, Bernard E.; Martynov, Alexander

doi:10.3390/d15040504

Open AccessArticle

Similar Ones Are Not Related and Vice Versa—New Dendronotus Taxa (Nudibranchia: Dendronotidae) from the North Atlantic Ocean Provide a Platform for Discussion of Global Marine Biodiversity Patterns^†

by

Tatiana Korshunova

¹

,

Viktor V. Grøtan

²

,

Kjetil B. Johnson

²

,

Torkild Bakken

³

,

Bernard E. Picton

^4,5

and

Alexander Martynov

^6,*

¹

Koltzov Institute of Developmental Biology RAS, Moscow 119334, Russia

²

Ørland Froskemannsklubb (Ørland Diveclub), 7142 Uthaug, Norway

³

NTNU University Museum, Norwegian University of Science and Technology, 7491 Trondheim, Norway

⁴

National Museums Northern Ireland, Holywood BT18 0EU, UK

⁵

Marine Laboratory, Queen’s University Belfast, Belfast BT22 1PF, UK

⁶

Zoological Museum, Moscow State University, Moscow 125009, Russia

^*

Author to whom correspondence should be addressed.

^†

http://urn:lsid:zoobank.org:act:A2FF984D-B84C-4AD2-A686-56485F5F1FB8.

Diversity 2023, 15(4), 504; https://doi.org/10.3390/d15040504

Submission received: 13 February 2023 / Revised: 12 March 2023 / Accepted: 20 March 2023 / Published: 1 April 2023

(This article belongs to the Special Issue Diversity in 2023)

Download

Browse Figures

Versions Notes

Abstract

:

One new species of the genus Dendronotus (Nudibranchia: Dendronotidae) is described from Norway and Northern Ireland, as well as from the adjacent North Sea, and one new subspecies of Dendronotus arcticus is described from Norway by applying a combination of fine-scale morphological and molecular phylogenetic data. The present case demonstrates multilevel morphological and molecular similarities and differences considering on the one hand a grouping of three similar looking sympatric taxa (D. yrjargul, D. arcticus gartensis n. subsp. and D. keatleyae n. sp.), and on the other hand two different looking apparently allopatric subspecies (D. arcticus arcticus and D. arcticus gartensis n. subsp.). The type species of the genus, D. frondosus, which is the commonest dendronotid in Norway and the United Kingdom, consistently demonstrates substantial molecular and fine-scale morphological differences from D. keatleyae n. sp. The present study, apart from providing purely taxonomic information, also provides new data for a broad discussion of global biodiversity patterns.

Keywords:

multilevel organismal diversity; molecular phylogeny; phylogeography; species delimitation; taxonomy

1. Introduction

Biodiversity studies, including a fundamental understanding of taxonomic richness, are among the main aims of biology [1,2,3], especially in our time of pollution of marine habitats and global climate change [4,5,6,7]. The nudibranch fauna of the northern Atlantic Ocean, spanning from Norway to the United Kingdom, has been historically assessed as rich and diverse [8,9,10,11,12]. Moreover, in recent years further and previously undetected diversity has been documented from Norway, the United Kingdom and neighbouring northern European localities [13,14,15,16,17,18]. A particular focus in recent years in connection with these biodiversity studies has been the family Dendronotidae and genus Dendronotus Alder and Hancock, 1845, which includes common shallow water species and for which a series of major revisions including the description of several new species has been conducted [19,20,21,22,23,24]. A new species of Dendronotus that spans both insular Europe (the United Kingdom) and European continent (Norway) was recently described as D. europaeus [25].

Increasingly, there has been a practice of recognising and celebrating the considerable contribution made by citizen scientists to the discovery of hidden worldwide diversity [26]. All this makes a solid base for the continuation of research on nudibranch biodiversity in northern Europe, with collaboration between scientists and citizen scientists. As an example of this partnership, recent sampling in the Ørland region and in Northern Ireland have resulted in the discovery of previously unrecognised ‘new’ diversity within the genus Dendronotus [23]. The specimens investigated here are compared with D. yrjargul Korshunova et al., 2020 that occurs sympatrically in the Ørland region of Norway. Both have subdued colouration, but they form a distinct grouping based on molecular phylogenetic data. In Northern Ireland, these species co-occur with the three common European species D. frondosus (Ascanius, 1774), D. lacteus (Thompson, 1840) and D. europaeus Korshunova et al. 2017, but all are readily distinguished by molecular markers, and also by fine-scale morphological differences. Moreover, in the Ørland region, additional Dendronotus specimens were also discovered, which are strongly similar externally to the brightly coloured D. yrjargul, but they are related to the geographically distant Dendronotus arcticus Korshunova et al., 2016 according to molecular data. This intricate combination of the degree of morphological disparity and molecular divergence is providing a solid platform for better understanding the diversity within Dendronotus and other organisms [19,23,27,28], and this contribution continues this theme.

2. Materials and Methods

2.1. Data Collection

Specimens of Dendronotus were collected by V. V. Grøtan, K.B. Johnson, H. Jensen and A.V. Martynov in the vicinity of Trondheim, Ørland, Norway (63°41′ N, 9°39′ E), and in Portrush in Northern Ireland (55°12′ N, 6°39′ E) by B. Picton and L. Keatley. Others were collected in the North Sea during research cruises conducted by the Thünen Institute of Sea Fisheries (Hamburg, Germany) on board the research vessels ‘Walther Herwig III’ and ‘Solea’ within the framework of the VECTORS European Union project, the International Bottom Trawl Survey (IBTS), the German Small-scale Bottom Trawl Survey (GSBTS), and R.V. ‘Senckenberg’ [29,30]. The specimens that were studied have been stored in the mollusc collections at the Norwegian University of Science and Technology (NTNU), NTNU University Museum (NTNU-VM) [31], Senckenberg Natural History Museum, Frankfurt, Germany (SMF), and Zoological Museum, Moscow State University (ZMMU). ZooBank registration: urn:lsid:zoobank.org:pub: A2FF984D-B84C-4AD2-A686-56485F5F1FB8.

2.2. Morphological Analysis

External and internal morphology was studied under a stereomicroscope with either a Nikon D-810 digital camera or Nikon Z6 digital camera attached. The radula and jaws of each specimen was extracted and processed in a 10% sodium hypochlorite. The jaws and reproductive systems were analysed under a stereomicroscope. The jaws and radulae were coated, then examined and photographed using a scanning electron microscope (either CamScan, Camscan Electron Optics Ltd., Cambridge, UK; or a JSM, JEOL Ltd., Tokyo, Japan, or a Quattro S, Thermo Fisher Scientific Inc., Waltham, MA, USA).

2.3. Molecular Analysis

Nine specimens were sequenced for the mitochondrial genes cytochrome c oxidase subunit I (COI) and 16S rRNA. The DNA extraction procedure, PCR amplification options, and sequencing have been previously described in detail in Korshunova et al. [21,22,23,25]. All the procedures were carried out without protocol modifications. Extracted DNA was used as a template for the amplification of partial sequences of the COI and 16S, using the primers: LCO1490 (GGTCAACAAATCATAAAGATATTGG, [32]); HCO2198 (TAAACTTCAGGGTGACCAAAAAATCA, [32]); 16SarL (CGCCTGTTTAACAAAAACAT, [33]); 16SR (CCGRTYTGAACTCAGCTCACG, [34]). COI sequences were translated into amino acids to verify coding regions and avoid improper base-calling. All new sequences were deposited in GenBank (Table 1, highlighted in bold). Four specimens collected in Northern Ireland were sequenced for COI via a commercial laboratory (Canadian Centre for DNA Barcoding, BOLD systems) also using standard Folmer primers [32].

Before analyses, all sequences were validated via BLAST comparisons. A preliminary analysis was undertaken with a full dataset used in a recently published synoptic review of the Dendronotidae, with the addition of new molecular data obtained in this study (in total 226 sequences, Supplementary Material S1), using the same methodology [23]. Separate analyses were conducted for COI (658 bp), 16S (465 bp), and the concatenated dataset (1123 bp). To conduct a detailed and comparative analysis, data newly obtained in this study together with data for closely related taxa, demonstrating similar external morphology, were selected, based on the preliminary analysis. In total, 79 sequences were selected of 42 specimens (including data for two outgroup specimens). All sequences were aligned with MAFFT [35]. Separate analyses were conducted for COI (658 bp), 16S (464 bp), and the concatenated dataset (1122 bp). Evolutionary models for each dataset were selected using MEGA11 [36]. For full dataset analyses, the HKY+I+G was chosen for the COI dataset, the GTR+I+G for the 16S dataset, and the GTR+I+G model for the concatenated COI+16S dataset. For selected dataset analyses, the HKY+G model was chosen for the COI dataset, GTR+I+G for the 16S dataset, and HKY+G model for the concatenated COI+16S dataset. Two different phylogenetic methods, Bayesian inference (BI) and maximum likelihood (ML), were used to infer evolutionary relationships. Bayesian estimation of posterior probability was performed in MrBayes 3.2 [37]. Four Markov chains were sampled at intervals of 500 generations. Analysis was started with random starting trees and 5 × 10⁷ generations. Maximum likelihood-based phylogeny inference was performed in RAxML 7.2.8 [38] with bootstrap in 1000 pseudo-replications. Final phylogenetic tree images were rendered in FigTree 1.4.2 (http://tree.bio.ed.ac.uk, accessed on 25 November 2018). Species delimitation was performed using different methods: ABGD (automatic barcode gap detection [39], https://bioinfo.mnhn.fr/abi/public/abgd/abgdweb.html, accessed on 1 June 2022), ASAP (assemble species by automatic partitioning [40], https://bioinfo.mnhn.fr/abi/public/asap/asapweb.html, accessed on 1 June 2022), single-threshold GMYC (general mixed Yule coalescent [41], https://species.h-its.org/gmyc/, accessed on 1 June 2022), PTP (Poisson tree processes [42]), and the refined multi-rate PTP (mPTP) version (multiple Poisson tree process [43], https://mptp.h-its.org/#/tree, accessed on 1 June 2022). The ABGD analysis was performed with the following settings: a priori for the maximum value of intraspecific divergence between 0.001 and 0.1, 10 recursive steps within the primary partitions defined by the first estimated gap, and a gap width of 1. The alignments were analysed using both ABGD and ASAP, separately, using both Jukes-Cantor (JC69) and Kimura (K80) proposed models. GMYC, PTP and mPTP were performed on the Bayesian trees from the BEAST package (http://beast2.org/, accessed on 1 June 2022). All these analyses were conducted for the COI and 16S datasets of Dendronotus specimens, separately. The program MEGA11 [36] also was used to determine the uncorrected p-distances.

3. Results

3.1. Systematics

Order Nudibranchia Cuvier, 1817

Family Dendronotidae Allman, 1845

Genus Dendronotus Alder & Hancock, 1845

Type species Amphitrite frondosa Ascanius, 1774.

Diagnosis

Cladobranch nudibranchs with distinct dorsolateral appendages, but appendages can be secondarily partially reduced; dorsolateral appendages can bear distinct (but again sometimes partially reduced) branches. Oral veil with branched appendages. Jaws usually with set of tightly packed, ridge-like, semi-discoid structures, with denticles. Radula commonly with more than eight lateral teeth in adult specimens. Central tooth with cusp integrated within lateral denticles or within body of tooth if denticles are absent; denticle-bearing section of central teeth separated from sides by usually distinct shoulder, thus central teeth with triangular top and squarish base. Prostate with conspicuous alveolar glands, commonly represented by a discoid structure varying from flattened to compressed spherical structure, rarely non-discoidal and linear. Copulatory organ essentially conical, with various ratios of length and width and degrees of tapering [based on 23].

Dendronotus keatleyae n. sp.

The intended authors of this new taxon are Korshunova, Grøtan, Johnson, Bakken, Picton and Martynov. As a patronym, the name is intended as a noun in apposition.

Figure 1

ZooBank registration:

http://urn:lsid:zoobank.org:act:EA2995B0-BFE3-4A1C-AB52-F625767243C9.

Etymology

Named after Seasearch diver Libby Keatley, who attracted the attention of one of the authors (BP) to a specimen of this new species during an ascidian training course at Portrush, Northern Ireland.

Material examined

Type material. Holotype. NTNU-VM-82155, Norwegian Sea, mouth of Trondheimsfjord, Ørland, Breivika, 63°41′8.66″ N 9°39′58.79″ E, 18 June 2020, 28 m depth, on hydroids growing on rocks, collector Viktor V. Grøtan.

Paratypes. 1 individual, NTNU-VM-82154, Norwegian Sea, mouth of Trondheimsfjord, Ørland, Uthaug, Rogna, 28 January 2019, 25 m depth, on hydroids growing on rocks, collector Viktor V. Grøtan. 1 individual, CCMMO067-21, Northern Ireland, Portrush, 6 June 2021, 10–30 m depth, collectors Bernard Picton and Libby Keatley. 2 individuals, MT09656, North Sea, 24 March 2012, depth 47.4 m depth, collector not specified.

Diagnosis

Oral veil with 5–6 branched appendages; lateral papilla present on rhinophoral sheath; 7 pairs of dorsolateral appendages with elongate primary stalk, moderately branched elongate secondary branches, short tertiary branches; colour (in life) semi-transclucent white to pale greyish-brown, commonly also brownish spots and broken line-like patterns, including small white to yellowish spots and pointed tubercles, some specimens almost without any additional spots and lines; tips of appendages covered with white to yellowish contrasting pigment, no intense golden-yellow pigment; central tooth of radula with deep to partially reduced furrows, moderately denticulated, 11 distinct (to reduced) denticles on each side; ampulla massive, large; prostate discoidal, with 10–20 alveolar glands; copulatory organ moderately long, partially curved; vas deferens moderate in length; bursa copulatrix large, rounded, seminal receptaculum placed distally.

Figure 1. Dendronotus keatleyae n. sp. (A–L) Holotype, NTNU-VM-82155, Norway: (A) dorsal view; (B) ventral view; (C) lateral view; (D) in situ; (E) rhinophore; (F) dorsolateral appendages, details; (G) jaw, light microscopy; (H) jaw, SEM, scale bar 500 µm; (I) denticles on the masticatory edge, SEM, scale bar 30 µm; (J) discoid structures on the masticatory edge, SEM, scale bar 30 µm; (K) details of discoid structures on the masticatory edge, SEM, scale bar 10 µm; (L) radula, posterior part, SEM, scale bar 100 µm; (M) radula, posterior part, details, SEM, scale bar 50 µm; (N) radula, posterior part, details, SEM, scale bar 30 µm; (O) radula, anterior part, SEM, scale bar 40 µm; (P) Paratype, CCMMO067-21, the United Kingdom, lateral view of a living specimen; (Q) the same, latero-ventral view; (R) the same, living specimen in situ. (S) the same, dorsolateral appendages, details; (T–Y) Paratype, NTNU-VM-82154, Norway: (T) living specimen in situ; (U) living specimen, dorsal view; (V) the same, dorsolateral appendages, details; (W) jaw, light microscopy; (X) jaw, SEM, scale bar 1 mm; (Y) radula, posterior part, details, SEM, 50 scale bar µm. Photographs of living animals by Viktor V. Grøtan and Bernard Picton. SEM micrographs and light microscopy images by Alexander Martynov.

Description

Body elongate, living specimens (Figure 1) up to 35 mm in length when live. Holotype 25 mm when live. Oral veil with 5–6 main appendages, all branched. Up to 6 appendages on rhinophoral stalks. Rhinophores with 11–14 lamellae; rhinophoral sheath with a lateral papilla. Adult with 7 pairs of dorsolateral appendages (including one rudimentary appendage posteriorly); each appendage with elongate primary stalk, moderately branched elongate secondary branches and short tertiary branches (Figure 1A–D,P). Basal colour semi-translucent white to pale greyish-brown; some specimens almost without any additional spots or lines (only very rare small white spots) or with more distinct brownish spots and broken line-like patterns, including small white and yellowish spots and pointed tubercles; upper part of dorsolateral appendages not covered with bright golden-yellow pigment; tips of appendages covered with white to yellowish bright contrasting pigment. Lip papillae up to 10. Jaws strong, oval, dorsal processes of jaws inclined posteriorly (Figure 1G–K,S,T). Masticatory border of jaw with ridge-like discoidal denticles (Figure 1I–K). Radular formula 33–34 × 0–9.1.9–0 (the zero represents the state at the anteriormost section of the radula where the laterals can be completely absent). Central (rachidian) tooth moderately denticulated, bearing up to 11 distinct denticles on each side (Figure 1 L–O,Y); denticles sometimes reduced. Denticles with deep (to partially reduced) furrows. Slightly curved, bearing up to 8 denticles, elongated lateral teeth (Figure 1 L–O,Y). Ampulla of reproductive system massive, large (Figure 2A). Bursa copulatrix large, rounded, with seminal receptaculum placed distally. Prostate discoidal, consisting of about 10–20 alveolar glands. Distal part of vas deferens moderate in length, transitioning to moderately long, partially curved copulatory organ.

Distribution and ecological observations

Dendronotus keatleyae n. sp. is presently known from the Norwegian Sea to the North Sea and the United Kingdom (only Northern Ireland to date). In Norway, the distribution is at least from Ørland to Oslofjord. This species occurs at upper subtidal depths and is associated with hydroids; our specimens were observed associated with the following four species of leptothecate hydroids—Abietinaria abietina (Linnaeus, 1758), Sertularia argentea Linnaeus, 1758, Thuiaria thuja (Linnaeus, 1758) and Hydrallmania falcata (Linnaeus, 1758).

Comparative remarks

According to the molecular phylogenetic analysis (see the Molecular phylogeny section), Dendronotus keatleyae n. sp. is placed in a distinct clade, but it shows few external morphological differences from D. frondosus (Ascanius, 1774) with which it co-occurs—hence, the title of this paper. However, the presence of small white or yellowish spots and markings, as well as the bright, white or yellowish tips to the lateral appendages—even in the case of almost uniform morphs—distinguishes D. keatleyae n. sp. from D. frondosus (Figure 1, Table 2). Additionally, specimens of D. keatleyae n. sp. bearing brownish irregular lines on the body (Figure 1A,P) are consistently distinguished from D. frondosus. The other sympatric taxa, Dendronotus yrjargul Korshunova et al., 2020 and D. arcticus gartensis n. subsp. newly described below, are readily distinguished from D. keatleyae n. sp. by the presence of striking golden-yellow colouration on the upper part of dorsolateral appendages and by their shape (Figure 1, Figure 3 and Figure 4). Dendronotus europaeus Korshunova et al., 2017 and D. lacteus (W. Thompson, 1840), which also commonly occur in northern Europe, differ from D. keatleyae n. sp. by the shape of their dorsolateral appendages and the colour pattern (see review in [23,25]).

The radula of D. keatleyae possesses relatively deep furrows and demonstrates fine-scale differences from D. frondosus, D. yrjargul (Figure 3, Table 2) and D. arcticus gartensis n. subsp. (Figure 4, Table 2). The radula of adult D. keatleyae n. sp. differs from D. yrjargul and D. arcticus gartensis n. subsp. in the presence of more distinct furrows (and corresponding ribs) compared to D. keatleyae n. sp. However, we must emphasise that the radula of juveniles, and especially that of subadult individuals (which can be retained at the anterior end of the adult radula), are fundamentally similar across the majority of Dendronotus species. This is due to the ontogenetic phenomenon of phylotypic periods [44]. The radulae of the sympatric D. lacteus and D. europaeus strongly differ from that of D. keatleyae n. sp., either by the presence of foliated furrows on the central teeth (D. lacteus) or by the considerably reduced furrows (D. europaeus) [23,25]. Dedronotus keatleyae n. sp. is differentiated from all the other Dendronotus species by a combination of external colouration and radular features [23].

Table 2. Key morphological characters of Dendronotus taxa. For a comparison with other species of the genus Dendronotus, see the detailed synopsis of Korshunova et al. (2020, [23]).

	Colouration	Body Length	Dorsolateral Appendages (Pairs)	Appendages of Oral Veil	Appendages of Rhinophoral Stalks	Rhinophoral Lamellae	Radula	Ampulla	Bursa Copulatrix	Prostate	Copulatory Organ (Penis)	Distribution	References
Dendronotus frondosus	Brownish to reddish-brown, often with small white and yellow specks, but usually without opaque white stripes between dorsolateral processes, to completely white translucent specimens	Up to 50 mm (live)	Up to 6, with relatively long primary stalk; moderately branched secondary branches bear elongate tertiary branches	Up to 7	Up to 5	Up to 12	Up to 42 rows of teeth. Central tooth with deep furrows and with up to 14 (common range 8–12) distinct denticles. Up to 10 (usually up to 8) lateral teeth, bearing up to seven denticles	Voluminous, folded	Large, oval to rounded	Up to 30 alveolar glands	Relatively long, curved	Boreal waters of North Atlantic; do not penetrate to the true Arctic further than easternmost Barents Sea	Korshunova et al., 2020 [23]
Dendronotus arcticus arcticus	Brownish, highly consistent in all observed specimens, with scattered distinct opaque white dots on dorsal side and appendages; upper part of the dorsolateral appendages not covered with golden yellow pigment	Up to 19 mm (preserved)	Up to 6, with a moderate primary stalk; moderately branched secondary branches, and short tertiary branches	Up to 8	Up to 6	Up to 18	Up to 39 rows of teeth. Central tooth with up to 14 small denticles and reduced furrows. Up to nine lateral teeth, bearing up to 9 denticles	Folded	Large and rounded	Up to 30 alveolar glands	Long and twisted	Restricted to the true Arctic waters: Laptev Sea, Kara Sea, easternmost part of Barents Sea adjacent to Kara Sea	Korshunova et al., 2016 [22]; present study
Dendronotus arcticus gartensis n. subsp.	Semi-translucent, highly consistent in all observed specimens, with bright yellow spots scattered dorsally and laterally, supplemented with dark brownish to deep violet markings, and similarly coloured cores of the dorsolateral appendages; upper part of the dorsolateral appendages covered with bright golden yellow to yellowish pigment	Up to 40 mm (live)	Up to 6, with elongate and pointed primary stalk, secondary branches reduced towards the tip of primary stalk and short tertiary branches, general spinose appearance	Up to 8	Up to 7	Up to 13	Up to 46 rows of teeth. Central tooth moderately denticulated and bearing up to 20 distinct denticles from each side. Denticles with relatively deep furrows. Up to eight lateral teeth, bearing up to eight denticles	Large, folded	Large, rounded	Up to 40 and more alveolar glands	Long, strongly convoluted	Restricted to the boreal waters of middle Norway	Present study
Dendronotus keatleyae n. sp.	Semi-transclucent white to pale greyish-brown, in some specimens almost without any additional spots and lines (only very rare small white spots) or with more distinct brownish spots and broken line-like patterns, including small yellowish spots and pointed tubercles; upper part of dorsolateral appendages not covered with bright golden-yellow pigment; tips of appendages covered with white to yellowish bright contrasting pigment	Up to 35 mm (live)	Up to 7, with elongate primary stalk, moderately branched elongate secondary branches and short tertiary branches	Up to 6	Up to 6	Up to 14	Up to 34 rows of teeth. Central tooth moderately denticulated and bearing up to 11 distinct to reduced denticles from each side. Denticles with relatively deep to reduced furrows. Up to nine lateral teeth, bearing up to eight denticles	Massiv, large	Large, rounded	About 10–20 alveolar glands	Moderately long, partially curved	Middle to southern Norway, North Sea, the UK	Present study
D. yrjargul	Semi-translucent white to greyish, with characteristic two thin wavy subparallel brownish-orange to brownish lines running from the head nearly to the tail. There are no specimens with brownish basal colour; upper part of the dorsolateral appendages covered with bright golden- yellow to yellowish pigment. Foot bordered with thin brownish orange line	Up to 95 mm (live)	Up to 8, with relatively short primary stalk, strongly branched secondary branches and elongate tertiary branches	Up to 6	Up to 5	Up to 30	Up to 50 rows of teeth. Central (rachidian) tooth moderately denticulated and bearing up to 16distinct denticles. Denticles with deep furrows. Up to 9 lateral teeth, bearing up to 7 denticles	Kidney-shaped, thickened	Large, rounded	Up to 50 alveolar glands	Long, thick, curved	Middle Norway to Kara Sea	Korshunova et al., 2020 [23]; present study
Dendronotus kalikal	Brownish, with creamy to whitish areas, dorsum, dorsolateral appendages, and upper sides of foot bear brownish orange lines and dots, partly arranged in blurred subparallel pattern, no golden- yellow pigment on the upper part of dorso-lateral appendages	Up to 15 mm (preserved)	Up to 5 (plus 2–3 smaller), with relatively long primary stalk, moderately branched thin secondary branches	Up to 5	Up to 5	Up to 14 mm	Up to 31 rows of teeth. Central tooth with deep furrows and with up to 18 distinct denticles. Up to eight lateral teeth, bearingup to 8 denticles	Moderately voluminous, folded	Large, considerably elongate, narrow ly-oval	Up to circa 20 alveolar glands	Relatively long, slightly curved	Kurile Islands to Bering Strait	Korshunova et al., 2019 [27], 2020 [23]

Figure 3. Dendronotus kalikal (A–G): (A) holotype of D. kalikal in life (ZMMU Op-283), Kamchatka, dorsal view; (B) dorsolateral appendages, holotype; (C) specimen (ZMMU Op-808) from Urup Island, the Kuril Islands, dorsolateral appendages; (D) D. kalikal in life, specimen from Urup Island; (E) jaw of D. kalikal, specimen (ZMMU Op-657) from Matua Island, the Kuril Islands, SEM, scale bar, 200 µm; (F) discoid structures on the masticatory edge of the same specimen, SEM, scale bar 20 µm; (G) anterior part of radula of the same specimen, SEM, scale bar 50 µm. Dendronotus yrjargul (H–Q): (H) holotype of D. yrjargul in life (NTNU-VM-76306), Norway, dorsal view; (I) D. yrjargul in life (ZMMU Op-809), Norway, dorsal view; (J) living specimen (ZMMU Op-809), Norway, ventral view; (K) living specimen (ZMMU Op-809), Norway, lateral view; (L) D. yrjargul in life (ZMMU Op-809), Norway, dorsolateral appendages; (M) jaws of paratype (NTNU-VM-76302), SEM, scale bar 500 µm; (N) discoid structures on the masticatory edge of the same paratype, SEM, scale bar 20 µm; (O) details of discoid structures on the masticatory edge of the same paratype, SEM, scale bar, 5 µm; (P) anterior part of radula of holotype, SEM, scale bar, 50 µm; (Q) central teeth of radula of paratype (NTNU-VM-76302), SEM scale bar, 20 µm. Photographs of living animals by Viktor V. Grøtan, Tatiana Korshunova and Alexander Martynov. SEM micrographs and light microscopy images by Alexander Martynov.

Dendronotus arcticus arcticus Korshunova et al., 2016.

Figure 4A–F.

Dendronotus arcticus Korshunova et al. 2016 [22] (pp. 26–28), Figure 1 and Figure 3; Korshunova et al. 2020 [23] (p. 21), Figure 7.

Material examined

Type material. Holotype. ZMMU Op-561, Laptev Sea, R/V “Dalnie Zelentsy”, station O-48, 74°34.9′ N–74°35.1′ N, 115°43.4′ E–115°42.2′ E, 4 October 2014, 15 m depth, benthic trawl, collector O.L. Zimina. Paratypes. 3 individuals, ZMMU Op-562–Op-564, same data as holotype.

Diagnosis

Oral veil with 6–8 branched appendages; lateral papilla present; 5–6 pairs of dorsolateral appendages; dorsolateral appendages non-spinose, with a moderate primary stalk, moderately branched secondary branches, and short tertiary branches; colour in life brownish with scattered white dots, upper part of the dorsolateral appendages not covered with golden yellow pigment; central tooth weakly denticulated, bearing up to 14 small denticles with reduced furrows; lateral teeth short and slightly curved; ampulla folded twice; prostate with 25–30 alveolar glands; vas deferens moderate in length; bursa copulatrix large and rounded; small seminal receptaculum placed distally; penis long and twisted.

The complete description of D. arcticus is included below because we have separated it into two subspecies, this description being assignable to the subspecies named D. a. arcticus.

Description

Holotype 19 mm in life. Body elongate, up to 19 mm in length when live (Figure 4A–C). Oral veil bearing 6–8 branched appendages. Rhinophoral stalk bearing 5–6 appendages; 15–18 rhinophoral lamellae, branched rhinophoral lateral papilla present; 15–25 lip papillae. Dorsolateral appendages in 5–pairs, each with a moderate primary stalk, moderately branched secondary branches, short tertiary branches (Figure 4A–C). Basal colour highly consistent in all observed specimens, brownish with scattered distinct opaque white dots on notum, as well as tips of lateral appendages, oral appendages, lip papillae and rhinophores; upper part of the dorsolateral appendages not covered with golden yellow pigment (Figure 4A–C). Dorsal processes of jaws inclined posteriorly at approximately longitudinal axis to body of jaw (Figure 4D,E). Masticatory processes apparently bear indistinct denticles. Radula formula 39 × 3–9.1.9–3. Central tooth weakly denticulated with up to 14 small denticles (Figure 4F) with reduced furrows. Lateral teeth short, slightly curved, with up to 9 elongate denticles (Figure 4F). Ampulla folded twice; prostate consisting of 25–30 alveolar glands; vas deferens moderate in length expanding to voluminous penial sheath; penis long and twisted; vagina long and twisted; bursa copulatrix large, rounded, elongate; small seminal receptaculum placed distally.

Distribution and ecological observations

Central and eastern coastal waters of the Arctic Ocean. Inhabits soft substrates (sands, muds) with gravel and small stones.

Comparative remarks

See below under Dendronotus arcticus gartensis n. subsp.

Figure 4. Dendronotus arcticus arcticus (A–F): (A) holotype D. arcticus arcticus in life (ZMMU Op-561) from the Laptev Sea, dorsal view; (B) paratype D. arcticus arcticus in life (ZMMU Op-562) from the Laptev Sea, lateral view; (C) dorsolateral appendages of the same paratype; (D) holotype jaws, light microscopy; (E) the same, discoid structures on the masticatory edge, SEM, scale bar 10 µm; (F) holotype, posterior part of radula, SEM, scale bar 30 µm. Dendronotus arcticus gartensis n. subsp. g–t: (G) holotype in life (ZMMU Op-802) from Norway, dorsal view; (H) holotype in life, ventral view; (I) the same, lateral view; (J) the same, dorsolateral appendages; (K) holotype, jaws, SEM, scale bar, 500 µm; (L) the same, discoid structures on the masticatory edge SEM, scale bar 50 µm; (M) holotype, radula, posterior part, SEM, scale bar, 50 µm; (N) the same, posterior part, details, SEM, scale bar 50 µm; (O) paratype ZMMU Op-807 from Norway, dorsal view; (P) the same, dorsolateral appendages; (Q) paratype ZMMU Op-807, jaws, light microscopy; (R) the same, jaws, SEM, scale bar, 500 µm; (S) the same, discoid structures on the masticatory edge, SEM, scale bar 200 µm; (T) radula, posterior part, SEM, scale bar 50 µm. Photographs of living animals by Viktor V. Grøtan, Alexander Martynov and Olga Zimina. SEM micrographs and light microscopy images by Alexander Martynov.

Dendronotus arcticus gartensis n. subsp.

The intended authors of this new taxon are Korshunova, Grøtan, Johnson, Bakken, Picton and Martynov. The name is adjectical.

Figure 2B and Figure 4G–T.

ZooBank registration:

http://urn:lsid:zoobank.org:act:3399D8E6-D563-49FE-A24B-371EF38E4723

Etymology

Dendronotus arcticus gartensis n. subsp. is named after the island Garten in Ørland municipality, where the type locality of Breivika is located. The subspecific name is intended to be adjectival.

Material examined

Type material. Holotype. (ZMMU Op-802), Norwegian Sea, mouth of Trondheimsfjord, Ørland, Breivika, 1 January 2020, 26 m depth, on hydroids growing on rocks, collector Viktor V. Grøtan.

Paratypes (all same locality and substrate as holotype). 1 individual, NTNU-VM-82156, 16 February 2020, 28 m depth, collector Viktor V. Grøtan. NTNU-VM-82157, 14 March 2021, 28 m depth, collector Viktor V. Grøtan. 1 individual, NTNU-VM-82158, 15 April 2020, 28 m depth, collector Viktor V. Grøtan. 1 individual, ZMMU Op-803, 28 January 2019, 26 m depth, collector Viktor V. Grøtan. 1 individual, ZMMU Op-804, 1 January 2020, 26 m depth, collector Viktor V. Grøtan. 1 individual, ZMMU Op-805, 10 February 2022, 26 m depth, collector Viktor V. Grøtan. 1 individual, ZMMU Op-806, 10 February 2022, 25 m depth, collector Viktor V. Grøtan. 1 individual, ZMMU Op-807, 3 April 2022, 25 m depth, collectors Alexander Martynov, Viktor V. Grøtan & Heine Jensen.

Diagnosis

Oral veil with 5–8 branched appendages; lateral papilla present on rhinophoral sheath; up to 6 pairs of spinose dorsolateral appendages with elongate and pointed primary stalk, secondary branches reduced towards to the tip of primary stalk and short tertiary branches; colour semi-translucent, with bright yellow spots and dark brownish to deep violet markings, cores of dorsolateral appendages covered with bright golden-yellow pigment; central tooth of radula with relatively deep furrows, moderately denticulated, bearing up to 20 distinct denticles on each side; ampulla large, folded; prostate large, discoidal, with more than 40 alveolar glands; vas deferens long; bursa copulatrix large, rounded; seminal receptaculum placed distally; copulatory organ long, strongly convoluted.

Description

Holotype 40 mm in life. Body moderately broad, living specimens up to 40 mm in length (Figure 4G–I,O). Oral veil with 5–8 main branched appendages. Lip papillae up to 20. Up to 7 appendages on rhinophoral stalks. Rhinophores with 10–13 lamellae; branched lateral papilla present on rhinophoral sheath. Dorsolateral appendages up to 6 pairs (including one rudimentary) in adult specimens; spinose in appearance, with elongate and pointed primary stalk, secondary branches reduced towards the tip of the primary stalk and short tertiary branches (Figure 4 G–J,O,P). Basal colour semi-translucent, highly consistent in all observed specimens, with bright yellow spots scattered dorsally and laterally, supplemented with dark brownish to deep violet markings, and similarly coloured cores of the dorsolateral appendages; upper part of dorsolateral appendages covered with bright golden-yellow pigment. Jaws strong, oval; dorsal processes of jaws inclined posteriorly to the longitudinal axis of jaw itself (Figure 4K,Q,R); masticatory border of jaw with ridge-like denticles (Figure 4L,S). Radular formula: 33–46 × 0–8.1.8–0 (however, the laterals can be completely absent in juveniles and this is reflected in the “0” in the formula). Central (rachidian) tooth moderately denticulated, bearing up to 20 distinct denticles on each side (Figure 4N,M,T); denticles with relatively deep furrows. Lateral teeth elongate, slightly curved, bearing up to 8 denticles (Figure 4N,M,T). Ampulla large, folded (Figure 2B). Prostate large discoidal, consisting of more than 40 alveolar glands. Distal part of vas deferens long, transitioning to long, strongly convoluted penis. Bursa copulatrix large, rounded; seminal receptaculum placed distally.

Distribution and ecological observations

This new subspecies occurs in the Norwegian Sea, where it is only known so far from the Trondheimsfjord region in middle Norway. It inhabits rocky and stony substrates. The new subspecies is associated with hydroids, including possibly Abietinaria abietina. Its spawn is a convoluted and moderately narrow, slightly pinkish cord.

Comparative remarks

Dedronotus arcticus gartensis n. subsp. shows a remarkable similarity to D. yrjargul in the colouration of the body and dorsolateral appendages (Figure 3 and Figure 4, Table 1); however, it is significantly different from D. yrjargul according to our molecular phylogenetic data (Figure 5). There are fine morphological differences between these taxa in the numbers of dorsolateral and oral veil appendages, as well as details of the central radular teeth (Figure 4). Dendronotus arcticus arcticus ranges from the core of the Arctic region [22], including the Laptev and Kara Seas, to the easternmost part of the Barents Sea adjacent to the Kara Sea. By contrast, D. arcticus gartensis n. subsp. occurs only in the boreal waters of mid-Norway.

Significantly, Dendronotus arcticus arcticus and D. arcticus gartensis n. subsp. share much molecular phylogenetic data but are readily differentiated by external morphology and colouration (Figure 4, Table 2). In particular, all the specimens of D. arcticus arcticus we studied have brownish basal colouration. Their dorsolateral appendages are not considerably spinose in general appearance and they lack golden-yellow upper parts and white spots on the dorsal side (Figure 4A,B and Figure 6), whereas D. arcticus gartensis n. subsp. has translucent basal colouration, spinose dorsolateral appendages with golden-yellow upper parts and bright yellow spots on the dorsal side (Figure 4G,I,O,P). There are also potential fine-scale morphological differences between these subspecies internally in the relatively greater number of denticles on the rachidian teeth, copulatory organ and shape of the ampulla, and the number of prostatic alveoles (Figure 2B [22]).

The separation of such morphologically distinct forms as subspecies meets the requirements of both the International Code of Zoological Nomenclature [45] and general taxonomic practice considering that, regardless of molecular differences, subspecies status commonly implies a geographic separation. The hydrological regimes where these Arctic and boreal subspecies occur are considerably different and they might contribute to the formation of these differences: D. arcticus arcticus lives commonly in the freezing waters of the high Arctic, whereas D. arcticus gartensis n. subsp. inhabits boreal Norwegian waters that are warmed by the North Atlantic Current (which is part of the Gulf Stream), which never freezes. Further explanations of the (assumedly) convergent D. yrjargul and D. arcticus gartensis n. subsp. could include some other factors, such as common food stuffs, or hydrological peculiarities, or composition of elements in the seawater. Although we have accumulated a significant amount of data on the nudibranch molluscs of the subarctic Barents Sea and northern Norway, we have never detected either D. arcticus gartensis n. subsp. or D. arcticus arcticus there [31,46,47]. Another significant piece of evidence for the separate status is that truly Arctic D. arcticus arcticus apparently displays no colour variation, being consistently brownish without golden-yellow upper parts of the dorsolateral appendages (Figure 4). By contrast, the common European D. frondosus displays considerable colour variation, but without any geographic structure [23]. Addtionally, the sympatric D. keatleyae n. sp. differs considerably from D. arcticus gartensis n. subsp. in external and internal morphological characters, as well as molecular data (Figure 1 and Figure 5). No other described Dendronotus species (see synopsis in [23]) displays a close similarity to D. arcticus gartensis n. subsp.

3.2. Molecular Phylogeny

The phylogenetic analyses, taken in combination with the dataset used in the recently published synoptic review of the family Dendronotidae and newly obtained data (for Dendronotus frondosus, D. kalikal, and a potential new Dendronotus species), confirmed the species composition of the genus Dendronotus with an additional clade for a potential new species (Supplementary Material S1). Five D. keatleyae n. sp. specimens from Norway, the United Kingdom and the North Sea clustered in a highly supported clade (BS = 100, PP = 1). Newly sequenced specimens of D. frondosus from the United Kingdom (co-occurring with D. keatleyae n. sp. and displaying similar coloration) nested within the highly supported D. frondosus clade (BS = 100, PP = 1). A newly sequenced specimen D. kalikal from Russia (Kuril Islands) nested within the moderately supported D. kalikal clade (BS = 79, PP = 0.97). Two specimens of D. arcticus gartensis n. subsp. that displayed very similar colouration to D. yrjargul, nested within highly supported D. arcticus clade (BS = 100, PP = 1). The species delimitation analysis performed with the ABGD tool from recursive partitions showed more potential species in the D. arcticus and D. keatleyae n. sp. clades compared with results from initial partitions.

As mentioned in the methods section above, detailed analyses based on a consolidation of external and internal morphological, molecular and geographical data were performed for the D. arcticus species complex, D. frondosus, and D. keatleyae n. sp. together with the closely related D. yrjargul and D. kalikal. A phylogenetic analysis was performed using 40 specimens of Dendronotus, plus two outgroup species. Separate analyses were conducted for COI, and 16S gene markers (Figure 5), as well as the concatenated dataset. Bayesian inference (BI) and maximum likelihood (ML) analyses based on the combined dataset yielded similar results (Figure 6). Five Dendronotus keatleyae n. sp. specimens from Norway, the United Kingdom and the North Sea clustered in a well-supported clade (PP = 0.98, BS = 92). The clade comprising specimens of D. keatleyae n. sp. has the closest position to the clades formed from specimens identified as D. yrjargul and D. kalikal. Based on the COI marker, the intragroup distance within D. keatleyae n. sp. ranged from 0–1.52%. The intergroup distances between D. keatleyae n. sp. and D. kalikal ranged from 5.81–7.37%, and that between D. keatleyae n. sp. and D. yrjargul ranged from 5.71–6.67%. The intergroup distances between D. keatleyae n. sp. and D. arcticus arcticus, D. arcticus gartensis n. subsp.and D. frondosus ranged from 9.98–11.0%, 10.6 –11.1%, 11.0–11.9%, respectively. Two specimens of D. arcticus gartensis n. subsp. from Norway nested within a well-supported clade (PP = 1, BS = 96) together with five D. arcticus arcticus from the Laptev and Kara Seas. Based on the COI marker, the intragroup distance within D. arcticus arcticus ranged from 0–1.82%, and two specimens D. arcticus gartensis n. subsp. showed 100% similarity between themselves. The intergroup distances between D. arcticus gartensis n. subsp. and D. arcticus arcticus ranged from 0.3–0.62%. Thus, regarding the COI marker, no significant differences were found between D. arcticus gartensis n. subsp. and D. arcticus arcticus.

Figure 5. Phylogenetic trees based on cytochrome c oxidase subunit I (A) and 16S (B) represented by Bayesian Inference. The results of species delimitation are indicated by vertical bars. The green bars depict species recognised by morphological taxonomy (Table 2). The blue bars depict putative species recognised by the initial (IP) and recursive (RP) partitioning of ABGD, ASAP, single-threshold GMYC model, PTP, and mPTP, respectively.

Two distance-based methods of species delimitation (ABGD, ASAP) and three tree-based methods (GMYC, PTP, and mPTP) were applied. None of these five methods of species delimitation produced congruent results or resolved the same number of partitions (Figure 5). Regarding the COI marker dataset and COI phylogenetic tree, the species number estimated by ABGD tool from recursive partitions, GMYC and PTP were closer to the number of taxa morphologically identified (Table 2) but the ABGD tool from the initial partitions, ASAP (asap-score 1.0) and mPTP, revealed a lower number of lineages than those identified by morphology. ABGD and PTP produced more delimitations, separating the D. arcticus arcticus ZMMU:Op-561. The species number estimated by GMYC was congruent with the number of species morphologically identified. Also, because in nudibranch molluscs the resolution of COI at the intraspecific level is greater than that for the 16S gene marker, different numbers of species were revealed in the COI and 16S gene marker datasets, using different methods. Regarding the 16S marker dataset and 16S phylogenetic tree, the species number estimated by ABGD, ASAP (asap-score 1.0), PTP and mPTP was underestimated compared to the number of species identified by morphology (Table 2), whereas 16S marker analysis with the GMYC tool had a higher estimate.

Dendonotus keatleyae n. sp., D. arcticus and D. frondosus were recognised by all five of these methods. In both the preliminary and detailed phylogenetic analyses, D. arcticus arcticus and D. arcticus gartensis n. subsp. nested together in a highly supported separate clade. Dendronotus arcticus gartensis n. subsp. was not recognised as separate from D. arcticus in the analyses using single gene markers, but nevertheless it has distinctive morphology and a restricted distribution. Dendronotus kalikal and D. yrjargul clustered in separate clades in all analyses. Addtionally, D. kalikal and D. yrjargul were recognised as separate species by the ABGD tool from recursive partitions, GMYC and PTP. Externally, D. yrjargul differs readily from D. kalikal by a combination of off-white semitransparent body with two, thin, dorsal, subparallel, brownish lines and the fact that its dorso-lateral appendages are golden-yellow to yellowish. Considerable differences between these two species exist in the reproductive system and ontogenetic pattern. Individuals of D. yrjargul reach a much larger size (95 mm) when mature, and in specimens of 20–30 mm the reproductive system is still very weakly developed. By contrast, D. kalikal achieves sexual maturity at a considerably smaller size (individuals with lengths of 7–10 mm showed a well-developed reproductive system [23]).

Finally, D. yrjargul ranges from the Norwegian Sea to the Kara Sea, whereas D. kalikal ranges in the northwestern Pacific Ocean from Kamchatka to the northern Kurile Island and the Bering Strait (Figure 6). Thus, D. kalikal and D. yrjargul are identifiable by molecular data (although possibly recently diverged, as indicated by the slight molecular divergence), and are also consistently separated by morphological features as well as geographical distribution.

Based on the combination of morphological, molecular and geographical data, D. frondosus, D. arcticus, D. yrjargul and D. kalikal were confirmed as distinct species. Addtionally, D. keatleyae n. sp. and D. arcticus gartensis n. subsp. were confirmed as a distinct species and distinct subspecies, respectively.

Figure 6. Phylogenetic tree based on concatenated molecular data (cytochrome c oxidase subunit I + 16S) represented by Bayesian inference (BI). Numbers represent posterior probabilities from BI and bootstrap values for maximum likelihood. For each species, colour pattern examples and single low variable radular characteristics are presented. Map showing the distribution of Dendronotus species, used for molecular phylogenetic analysis.

4. Discussion

The broader issue of integrating morphological and molecular data to reach conclusions about species delimitation has a considerable history under two different names—“total evidence” [48,49] or “integrative taxonomy” [50,51,52,53]. The multilevel diversity approach (MOD, see most recent review in [44]) fundamentally differs from “integrative taxonomy” and explicitly emphasises multiple biological levels instead of the contrasting distinction only between morphological and molecular levels, because in spite of the original desire “to integrate” various disciplines [50], in real taxonomic practice an “integration” implies a primacy of molecular data over morphological data [54]. However, an immense amount of recent data clearly highlights that both genetic and epigenetic processes influence the formation of any organism [55,56,57], and therefore genetic data cannot be used as the sole basis of modern taxonomy to “delimit units of life’s diversity”. Thus, any proposals for putative absence of “morphological differences” [58,59,60] in reality implies insufficient fine-scale comparison [16,61,62,63,64,65,66]. Therefore, the naming of ‘morphodiversity’, contrary to the guidelines of the “integrative taxonomy” [50], is among the most crucial of aims of taxonomy, from which we will approach a true understanding of “units of life’s diversity”.

Furthermore, recently doubts have been cast on the standard “barcoding gene” CO1 [67,68]. These doubts have far more serious consequences for the entire phylogenetic field than these practical studies implied. Because either “bin” barcoding distance [69], commonly considered as slightly higher than two percent is indicative as a “species level boundary” regardless of other organism genes and various multilevel, “phenotypic” traits, or we should if not completely abandon the importance of molecular phylogenetic data, at least significantly downgrade their importance for taxonomy.

A highly intricate combination of hidden diversity, introgression and gene flow in various organismal groups [70,71,72,73] also prevent any straightforward demarcation of biodiversity into ‘cryptic’ and ‘non cryptic’ taxa, a topic which is also tightly connected with the putatively strict divisions of any organismal traits into strictly ‘genetic’ and ‘phenotypic’ features. While a detailed discussion on this topic would take several separate papers, it is very important to highlight here that these recent controversies obviously show that instead of common modern practice to use a molecular phylogenetic tree as a backbone for taxonomic decisions and ignore any other evidence as “phenotypic variations” (and continue to call such a genetic-centred approach “integrative ones”), we should gradually change our comprehension of the world’s biodiversity towards its multilevel understanding, in which both genetic and phenotypic differences and similarities will be employed in the resulting taxonomic classification. By this, it is clear that multilevel organismal diversity is a truly whole-encompassing, complex discipline, whereas so-called “integrative taxonomy” is not.

The present example of Dendronotus demonstrates a genuinely multilevel complex of both morphological and molecular similarities and differences (Figure 1, Figure 2, Figure 3, Figure 4, Figure 5 and Figure 6) in two groupings within this genus. On the one hand, there is a set of closely related species that co-occur in the Ørland region of Norway (comprising D. yrjargul, D. arcticus gartensis n. subsp. and D. keatleyae n. sp.) (Figure 1, Figure 2, Figure 3, Figure 4, Figure 5 and Figure 6). On the other hand, there are two subspecies that are apparently allopatric (D. arcticus arcticus and D. arcticus gartensis n. subsp.) (Figure 4 and Figure 6). Our observations of these taxa immediately undermine any straightforward assertion of a ‘cryptic’ species complex, because there is a mosaic of similarities and fine-scale differences among the species studied here. For example, whilst D. yrjargul and D. arcticus gartensis n. subsp. can be superficially described as ‘cryptic’ (compare Figure 3H–K and Figure 4G–I,O), detailed morphological analysis clearly reveals consistent fine-scale differences, including the absence of subparallel brown lines and bright yellow spots on the dorsal side of D. arcticus gartensis n. subsp., as well as differences in relative number of dorso-lateral and oral veil processes (Figure 3 and Figure 4). Dendonotus keatleyae n. sp. (Figure 1), in turn, can be differentiated morphologically from the closely related D. frondosus, D. lacteus and D. europaeus by both external and internal features (see details in [23,25], and present study). Developing such fine-scale differences helps us to better understand biodiversity. Three of the authors of this paper (TB, VVG, KBJ) have taken photographs of specimens for more than two decades from other parts of the Trondheimsfjord now identified as D. arcticus gartensis n. subsp. and D. yrjargul. Previously, they were identified as D. frondosus as that species was considered to possess great intraspecific morphological variation [16]. Additionally, D. yrjargul was photographed recently in the NW Atlantic (Maine, ME, USA; Newfield A., Feick J., personal communication).

The congruence between morphological data and molecular phylogenetic results has long been discussed [74,75]. Nowadays, incongruent delimitation scenarios indicated by different species delimitation methods are actively discussed [43,76,77]. In this study, several commonly used molecular species delimitation methods were applied. Compared with morphological results, different analyses were conducted using two different barcoding fragments potentially over- or underestimating the number of putative species [78], yet here the results estimated by GMYC for the COI tree were congruent with the number of species identified morphologically. One new species was identified and four previously described species (supported by morphological diagnosis) were confirmed based on different species delimitation methods.

Specimens of D. keatleyae n. sp., D. yrjargul and D. arcticus gartensis n. subsp., co-occurring in the Ørland region of Norway, were confirmed as separate taxa by different delimitation methods, as well as specimens of D. keatleyae n. sp. and D. frondosus co-occurring in Northern Ireland (Figure 6). The recently described D. yrjargul demonstrates considerable external and internal morphological differences from D. kalikal, including an up to 10 times larger adult body size, and hence different maturation patterns, very consistent colouration, a larger number of radular teeth and denticles on the central teeth, very different shape of bursa copulatrix, larger number of prostatic alveoles, and it always forms a separate molecular phylogenetic clade despite relatively low genetic differences [23]; present study, Table 2, Figure 3, Figure 5 and Figure 6.

Our study, therefore, reveals the complex combinations of morphological and molecular similarities and differences (Figure 1, Figure 2, Figure 3, Figure 4, Figure 5 and Figure 6), which contradict the simplistic division into ‘cryptic’ or ‘non-cryptic’ species groups, which only superficially appear indistinguishable until detailed integration of niche, molecular data, or other lines of evidence reveal clearly different and distinguishable species lineages [79]. This contrast led to a misleading distinction between ‘cryptic’, ‘pseudocryptic’ and just ‘ordinary’ species [80,81,82,83,84,85,86,87]; see detailed discussion in [16,18,63,88,89]. This consideration is of crucial importance for practical taxonomy. The issue of ‘cryptic’ species would not arise if the MOD approach was used because the ontogenetic properties of any organism imply it is impossible to have an identical, “indistinguishable” morphology [90,91], which is commonly claimed as a basis for the cryptic species concept [92]. “Integrative taxonomy” [50] has not been able to overcome these significant inconsistencies, whereas the multilevel organismal diversity approach [44] is specifically targeted to encompass any potential organismal properties in taxonomic framework and fundamentally avoids the pitfalls of ‘cryptic’ versus ‘non-cryptic’ species. Thus, the present study, apart from providing purely taxonomic information, also provides new data for a broad discussion of global biodiversity patterns.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/d15040504/s1.

Author Contributions

Conceptualization, A.M. and T.K.; formal analysis, T.K., B.E.P. and A.M.; investigation, T.K. and A.M.; resources, V.V.G., K.B.J., B.E.P. and A.M.; data curation, T.B., A.M. and B.E.P.; writing—original draft, A.M. and T.K.; writing—review and editing A.M., T.K., T.B., B.E.P., V.V.G. and K.B.J. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by a research project of MSU Zoological Museum (18-1-21 No. 121032300105-0). The work of TK was conducted under the IDB RAS basic research program in 2021 No. 0088-2021-0019. The research was done using equipment from the Core Centrum of IDB RAS. This study was supported by the project “ReDNAcarnation of the museum collections” from the Vladimir Potanin Philanthropic Foundation (the program “Museum without borders”, “Museum 4.0” contest).

Institutional Review Board Statement

Not applicable.

Data Availability Statement

Data from this study are available in the main text and Supplementary Material.

Acknowledgments

The Ørland community (Norway), the Ørland Froskemannsklubb (Ørland Diveclub), and the Besøkssenter Våtmark, Ørland (Visitor Center Wetland) with Audun Eriksen are warmly thanked for their support for the ongoing nudibranch-related observations and studies in Norway. Special thanks go to the family of Viktor V. Grøtan, Kia Marita and Anita Vasskog Grøtan, for their exceptional hospitality and great organisation of scientific work during the visit of AM to Norway in 2022. Heine Jensen helped by collecting and photographing specimens for us. We are highly grateful to Richard Willan for useful advice. Libby Keatley helped with collection of specimens in Northern Ireland. Christine Morrow documented, subsampled and sent these specimens to us for barcoding. The team at the Gulen Dive Center (Christian Skauge, Ørjan Sandnes, Monica Bakkeli, Guido Schmitz, Marek Machinia and Stefanie Wagner) are thanked for their help during fieldwork in Norway. Thanks to Amy Newfield and Jason Feick for observation of Dendronotus yrjargul in Maine, USA. We are very thankful to the reviewers for the thorough reviews that helped to improve the manuscript.

Conflicts of Interest

The authors declare no conflict of interest.

References

Blaxter, M. Molecular systematics: Counting angels with DNA. Nature 2003, 421, 122–124. [Google Scholar] [CrossRef] [PubMed]
Le Bagousse-Pinguet, Y.; Soliveres, S.; Gross, N.; Torices, R.; Berdugo, M.; Maestre, F.T. Phylogenetic, functional, and taxonomic richness have both positive and negative effects on ecosystem multifunctionality. Proc. Natl. Acad. Sci. USA 2019, 116, 8419–8424. [Google Scholar] [CrossRef] [PubMed]
Pascual, U.; Adams, W.M.; Díaz, S.; Lele, S.; Mace, G.M.; Turnhout, E. Biodiversity and the challenge of pluralism. Nat. Sustain. 2021, 4, 567–572. [Google Scholar] [CrossRef]
Velasco, D.; García-Llorente, M.; Alonsoa, B.; Dolera, A.; Palomo, I.; Iniesta-Arandia, I.; Martín-Lópeza, B. Biodiversity conservation research challenges in the 21st century: A review of publishing trends in 2000 and 2011. Environ. Sci. Policy 2015, 54, 90–96. [Google Scholar] [CrossRef]
Johnson, C.N.; Balmford, A.; Brook, B.W.; Buettel, J.C.; Galetti, M.; Guangchun, L.; Wilmshurst, J.M. Biodiversity losses and conservation responses in the Anthropocene. Science 2017, 356, 270–275. [Google Scholar] [CrossRef]
Proença, V.; Martin, L.J.; Pereira, H.M.; Fernandez, M.; McRae, L.; Belnap, J.; Böhm, M.; Brummitt, N.; García-Moreno, J.; Gregory, R.D.; et al. Global biodiversity monitoring: From data sources to essential biodiversity variables. Biol. Conserv. 2017, 213, 256–263. [Google Scholar] [CrossRef]
Heberling, J.M.; Miller, J.T.; Noesgaard, D.; Weingart, S.B.; Schigel, D. Data integration enables global biodiversity synthesis. Proc. Natl. Acad. Sci. USA 2021, 118, e2018093118. [Google Scholar] [CrossRef]
Alder, J.; Hancock, A. A Monograph of the British Nudibranchiate Mollusca; Parts I–VII; The Ray Society: London, UK, 1845–1855.
Odhner, N. Opisthobranchiate Mollusca from the western and northern coasts of Norway. Det Kong. Nor. Vidensk. Selsk. Skrift. 1939, 1, 1–93. [Google Scholar]
Thompson, T.E.; Brown, G.H. Biology of Opisthobranch Molluscs; The Ray Society Publishing: London, UK, 1984; Volume 2. [Google Scholar]
Picton, B.E.; Morrow, C. A Field Guide to the Nudibranchs of the British Isles; Immel Publishing: London, UK, 1994. [Google Scholar]
Evertsen, J.; Bakken, T. Nudibranch diversity (Heterobranchia, Gastropoda) along the coast of Norway. Fauna Nor. 2005, 25, 1–37. [Google Scholar]
Kienberger, K.; Carmona, L.; Pola, M.; Padula, V.; Gosliner, T.M.; Cervera, J.L. Aeolidia papillosa (Linnaeus, 1761) (Mollusca: Heterobranchia: Nudibranchia), single species or a cryptic species complex? A morphological and molecular study. Zool. J. Linn. Soc. 2016, 177, 481–506. [Google Scholar] [CrossRef]
Korshunova, T.A.; Martynov, A.V.; Bakken, T.; Evertsen, J.; Fletcher, K.; Mudianta, I.W.; Saito, H.; Lundin, K.; Schrödl, M.; Picton, B. Polyphyly of the traditional family Flabellinidae affects a major group of Nudibranchia: Aeolidacean taxonomic reassessment with descriptions of several new families, genera, and species (Mollusca, Gastropoda). ZooKeys 2017, 717, 1–139. [Google Scholar] [CrossRef]
Korshunova, T.A.; Lundin, K.; Malmberg, K.; Picton, B.; Martynov, A.V. First true brackish water nudibranch mollusc provides new insights for phylogeny and biogeography. PLoS ONE 2018, 13, e0192177. [Google Scholar] [CrossRef]
Korshunova, T.; Picton, B.; Furfaro, G.; Mariottini, P.; Pontes, M.; Prkić, J.; Fletcher, K.; Malmberg, K.; Lundin, K.; Martynov, A. Multilevel fine-scale diversity challenges the ‘cryptic species’ concept. Sci. Rep. 2019, 9, 6732. [Google Scholar] [CrossRef] [PubMed]
Korshunova, T.A.; Sanamyan, N.P.; Sanamyan, K.E.; Torkild, B.; Lundin, K.; Fletcher, K.; Martynov, A.V. Biodiversity hotspot in cold waters: A review of the genus Cuthonella with descriptions of seven new species (Mollusca, Nudibranchia). Contrib. Zool. 2021, 90, 216–283. [Google Scholar] [CrossRef]
Korshunova, T.; Driessen, F.; Picton, B.; Martynov, A.V. The multilevel organismal diversity approach deciphers difficult to distinguish nudibranch species complex. Sci. Rep. 2021, 11, 18323. [Google Scholar] [CrossRef] [PubMed]
Thollesson, M. Discrimination of two Dendronotus species by allozyme electrophoresis and the reinstatement of Dendronotus lacteus (Thompson, 1840) (Nudibranchia, Dendronotoidea). Zool. Scr. 1998, 27, 189–195. [Google Scholar] [CrossRef]
Stout, C.; Pola, M.; Valdés, Á. Phylogenetic analysis of Dendronotus nudibranchs with emphasis on northeastern Pacific species. J. Moll. Stud. 2010, 76, 367–375. [Google Scholar] [CrossRef]
Korshunova, T.A.; Sanamyan, N.; Martynov, A.V. Morphological and molecular evidence indicate Dendronotus primorjensis is a valid species that has priority over D. dudkai (Nudibranchia). ZooKeys 2016, 634, 15–28. [Google Scholar]
Korshunova, T.A.; Sanamyan, N.; Zimina, O.; Fletcher, K.; Martynov, A.V. Two new species and a remarkable record of the genus Dendronotus from the North Pacific and Arctic oceans (Nudibranchia). ZooKeys 2016, 630, 19–42. [Google Scholar]
Korshunova, T.A.; Bakken, T.; Grøtan, V.; Johnson, K.; Lundin, K.; Martynov, A.V. A synoptic review of the family Dendronotidae (Mollusca: Nudibranchia): A multilevel organismal diversity approach. Contr. Zool. 2020, 90, 93–153. [Google Scholar] [CrossRef]
Martynov, A.V.; Fujiwara, Y.; Tsuchida, S.; Nakano, R.; Sanamyan, N.; Sanamyan, K.; Fletcher, K.; Korshunova, T.A. Three new species of the genus Dendronotus from Japan and Russia (Mollusca, Nudibranchia). Zootaxa 2020, 4747, 495–513. [Google Scholar] [CrossRef] [PubMed]
Korshunova, T.A.; Martynov, A.V.; Bakken, T.; Picton, B. External diversity is restrained by internal conservatism: New nudibranch mollusc contributes to the cryptic species problem. Zool. Scr. 2017, 46, 683–692. [Google Scholar] [CrossRef]
Chandler, M.; See, L.; Copas, K.; Bonde, A.M.Z.; López, B.C.; Danielsen, F.; Legind, J.K.; Masinde, S.; Miller-Rushing, A.J.; Newman, G.; et al. Contribution of citizen science towards international biodiversity monitoring. Biol. Cons. 2017, 213, 280–294. [Google Scholar] [CrossRef]
Korshunova, T.; Nakano, R.; Fletcher, K.; Sanamyan, N.; Martynov, A. First molecular confirmation of the presence of Dendronotus primorjensis Martynov, Sanamyan & Korshunova, 2015 in Japan and new distributional records of Dendronotus species in the North Pacific (Nudibranchia: Dendronotidae). Venus 2019, 77, 1–14. [Google Scholar]
Díaz, S.; Malhi, Y. Biodiversity: Concepts, patterns, trends, and perspectives. Annu. Rev. Environ. Resour. 2022, 47, 31–63. [Google Scholar] [CrossRef]
Ehrich, S.; Adlerstein, S.; Brockmann, U.; Floeter, J.; Garthe, S.; Hinz, H.; Kröncke, I.; Neumann, H.; Reiss, H.; Sell, A.F.; et al. 20 years of the German small-scale bottom trawl survey (GSBTS): A review. Senckenberg. Marit. 2007, 37, 13–82. [Google Scholar] [CrossRef]
Barco, A.; Raupach, M.J.; Laakmann, S.; Neumann, H.; Knebelsberger, T. Identification of North Sea molluscs with DNA barcoding. Mol. Ecol. Resour. 2016, 16, 288–297. [Google Scholar] [CrossRef]
Bakken, T.; Hårsaker, K.; Daverdin, M. Marine Invertebrate Collection NTNU University Museum; Version 1.574; NTNU University Museum: Trondheim, Norway, 2023. [Google Scholar]
Folmer, O.; Black, M.; Hoeh, W.; Lutz, R.; Vrijenhoek, R. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol. Mar. Biol. Biotech. 1994, 3, 294–299. [Google Scholar]
Palumbi, S.R.; Martin, A.P.; Romano, S.; McMillan, W.O.; Stice, L.; Grabowski, G. The Simple Fool’s Guide to PCR; University of Hawaii: Honolulu, HI, USA, 2002. [Google Scholar]
Puslednik, L.; Serb, J.M. Molecular phylogenetics of the Pectinidae (Mollusca: Bivalvia) and effect of increased taxon sampling and outgroup selection on tree topology. Mol. Phylogenet. Evol. 2008, 48, 1178–1188. [Google Scholar] [CrossRef]
Katoh, K.; Misawa, K.; Kuma, K.; Miyata, T. MAFFT: A novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucl. Acid Res. 2002, 30, 3059–3066. [Google Scholar] [CrossRef]
Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular evolutionary genetics analysis Version 11. Mol. Biol. Evol. 2012, 38, 3022–3027. [Google Scholar] [CrossRef] [PubMed]
Ronquist, F.; Teslenko, M.; van der Mark, P.; Ayres, D.L.; Darling, A.; Höhna, S.; Larget, B.; Liu, L.; Suchard, M.A.; Huelsenbeck, J.P. MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Syst. Biol. 2012, 61, 539–542. [Google Scholar] [CrossRef] [PubMed]
Stamatakis, A.; Hoover, P.; Rougemont, J. A rapid bootstrap algorithm for the RAxML web servers. Syst. Biol. 2008, 57, 758–771. [Google Scholar] [CrossRef]
Puillandre, N.; Lambert, A.; Brouillet, S.; Achaz, G. ABGD, Automatic Barcode Gap Discovery for primary species delimitation. Mol. Ecol. 2011, 21, 1864–1877. [Google Scholar] [CrossRef]
Puillandre, N.; Brouillet, S.; Achaz, G. ASAP: Assemble species by automatic partitioning. Mol. Ecol. Resour. 2021, 21, 609–620. [Google Scholar] [CrossRef]
Pons, J.; Barraclough, T.; Gomez-Zurita, J.; Cardoso, A.; Duran, D.; Hazell, S.; Kamoun, S.; Sumlin, W.D.; Vogler, A.P. Sequence-based species delimitation for the DNA taxonomy of undescribed insects. Syst. Biol. 2006, 55, 595–609. [Google Scholar] [CrossRef] [PubMed]
Zhang, J.; Kapli, P.; Pavlidis, P.; Stamatakis, A. A general species delimitation method with applications to phylogenetic placements. Bioinformatics 2013, 29, 2869–2876. [Google Scholar] [CrossRef] [PubMed]
Kapli, P.; Lutteropp, S.; Zhang, J.; Kobert, K.; Pavlidis, P.; Stamatakis, A.; Flouri, T. Multi-rate Poisson tree processes for single-locus species delimitation under maximum likelihood and Markov chain Monte Carlo. Bioinformatics 2017, 33, 1630–1638. [Google Scholar] [CrossRef] [PubMed]
Martynov, A.V.; Korshunova, T.A. Multilevel organismal diversity in an ontogenetic framework as a solution for the species concept. In Cryptic Species: Morphological Stasis, Circumscription, and Hidden Diversity; Monro, A.K., Mayo, S.J., Eds.; Cambridge University Press: Cambridge, UK, 2022; pp. 78–129. [Google Scholar]
ICZN. International Code of Zoological Nomenclature; The International Trust for Zoological Nomenclature: London, UK, 1999. [Google Scholar]
Martynov, A.V.; Korshunova, T.A.; Savinkin, O.V. Shallow-water opisthobranch molluscs of the Murman coast of the Barents Sea, with new distributional data and remarks on biology. Ruthenica 2006, 16, 59–72. [Google Scholar]
Martynov, A.V.; Korshunova, T.A. Opisthobranch Molluscs of the Seas of Russia. A Colour Guide to Their Taxonomy and Biology; Fiton: Moscow, Russia, 2011. [Google Scholar]
Kluge, A. Total evidence or taxonomic congruence: Cladistics or consensus classification. Cladistics 1998, 14, 151–158. [Google Scholar] [CrossRef]
Gómez Daglio, L.; Dawson, M.N. Integrative taxonomy: Ghosts of past, present and future. J. Mar. Biol. Assoc. UK 2019, 99, 1237–1246. [Google Scholar] [CrossRef]
Dayrat, B. Towards integrative taxonomy. Biol. J. Linn. Soc. 2005, 85, 407–415. [Google Scholar] [CrossRef]
Padial, J.M.; Miralles, A.; De La Riva, I.; Vences, M. The integrative future of taxonomy. Front. Zool. 2010, 7, 16. [Google Scholar] [CrossRef] [PubMed]
Schlick-Steiner, B.C.; Steiner, F.M.; Seifert, B.; Stauffer, C.; Christian, E.; Crozier, R.J. Integrative taxonomy: A multisource approach to exploring biodiversity. Ann. Rev. Entomol. 2010, 55, 421–438. [Google Scholar] [CrossRef]
Heethoff, M.; Laumann, M.; Weigmann, G.; Raspotnig, G. Integrative taxonomy: Combining morphological, molecular and chemical data for species delineation in the parthenogenetic Trhypochthonius tectorum complex (Acari, Oribatida, Trhypochthoniidae). Front. Zool. 2011, 8, 2. [Google Scholar] [CrossRef]
Fritts-Penniman, A.L.; Gosliner, T.M.; Ngurah Mahardika, G.; Barber, P.H. Cryptic ecological and geographic diversification in coral associated nudibranchs. Mol. Phyl. Evol. 2020, 144, 106698. [Google Scholar] [CrossRef]
Mason, N.A.; Taylor, S.A. Differentially expressed genes match bill morphology and plumage despite largely undifferentiated genomes in a holarctic songbird. Mol. Ecol. 2015, 24, 3009–3025. [Google Scholar] [CrossRef]
Perez, M.; Lehner, B. Intergenerational and transgenerational epigenetic inheritance in animals. Nat. Cell Biol. 2019, 21, 143–151. [Google Scholar] [CrossRef]
Danchin, E.; Pocheville, A.; Rey, O.; Pujol, B.; Blanchet, S. Epigenetically facilitated mutational assimilation: Epigenetics as a hub within the inclusive evolutionary synthesis. Biol. Rev. 2019, 94, 259–282. [Google Scholar] [CrossRef]
Cerca, J.; Meyer, C.; Purschke, G.; Struck, T.H. Delimitation of cryptic species drastically reduces the geographical ranges of marine interstitial ghost-worms (Stygocapitella, Annelida, Sedentaria). Mol. Phylogen.Evol. 2020, 143, 106663. [Google Scholar] [CrossRef]
Halasan, L.C.; Lin, H.C. Integrated morphometrics reveals conservatism in the cryptic yellowstripe scad (Perciformes: Carangidae) lineages from the Tropical Western Pacific. Zool. Anz. 2022, 300, 82–91. [Google Scholar] [CrossRef]
Slager, D.L.; Epperly, K.L.; Ha, R.R.; Rohwer, S.; Wood, C.; Van Hemert, C.; Klicka, J. Cryptic and extensive hybridization between ancient lineages of American crows. Mol. Ecol. 2022, 29, 956–969. [Google Scholar] [CrossRef]
Karanovic, T.; Djurakic, M.; Eberhard, S.M. Cryptic species or inadequate taxonomy? Implementation of 2D geometric morphometrics based on integumental organs as landmarks for delimitation and description of copepod taxa. Syst. Biol. 2016, 65, 304–327. [Google Scholar] [CrossRef] [PubMed]
Karanovic, T. Using landmark-based geometric morphometrics for holotype selection in cryptic species: A case study of Western Australian Halicyclops (Copepoda, Cyclopoida). Crustaceana 2022, 95, 631–666. [Google Scholar] [CrossRef]
Horsáková, V.; Nekola, J.C.; Horsák, M. When is a ‘cryptic’ species not a cryptic species: A consideration from the Holarctic micro-land snail genus Euconulus (Gastropoda: Stylommatophora). Mol. Phylogen. Evol. 2019, 132, 307–320. [Google Scholar] [CrossRef]
Chou, M.H.; Chu, I.H.; Lau, D.; Huang, J.P. Integrative species delimitation reveals fine-scale allopatric speciation in a good-flying insect: A case study on Cylindera pseudocylindriformis complex (Coleoptera, Cicindelidae). Invert. Syst. 2022, 36, 910–925. [Google Scholar] [CrossRef]
Gibert, A.; Louty, F.; Buscail, R.; Baguette, M.; Schatz, B.; Bertrand, J.A.M. Extracting quantitative information from images taken in the wild: A case study of two vicariants of the Ophrys aveyronensis species complex. Diversity 2022, 14, 400. [Google Scholar] [CrossRef]
Pyron, R.A.; Beamer, D.A. Nomenclatural solutions for diagnosing ‘cryptic’ species using molecular and morphological data facilitate a taxonomic revision of the black-bellied salamanders (Urodela, Desmognathus ‘quadramaculatus’) from the southern Appalachian Mountains. Bionomina 2022, 27, 1–43. [Google Scholar] [CrossRef]
Jirapatrasilp, P.; Backeljau, T.; Prasankok, P.; Ratmanee, C.; Panhab, S. Untangling a mess of worms: Species delimitations reveal morphological crypsis and variability in Southeast Asian semi-aquatic earthworms. Mol. Phyl. Evol. 2019, 139, 106531. [Google Scholar] [CrossRef]
Hupalo, K.; Copilaș-Ciocianu, D.; Leese, F.; Weiss, M. COI is not always right: Integrative taxonomy reveals striking overestimation of species diversity in a Mediterranean freshwater amphipod. Res. Square 2022, preprint. [Google Scholar] [CrossRef]
Ratnasingham, S.; Hebert, P.D.N. A DNA-based registry for all animal species: The Barcode Index Number (BIN) system. PLoS ONE 2013, 8, e66213. [Google Scholar] [CrossRef] [PubMed]
Kijewski, T.K.; Zbawicka, M.; Väinölä, R.; Wenne, R. Introgression and mitochondrial DNA heteroplasmy in the Baltic populations of mussels Mytilus trossulus and M. edulis. Mar. Biol. 2006, 149, 1371–1385. [Google Scholar] [CrossRef]
Malinsky, M.; Svardal, H.; Tyers, A.; Miska, E.A.; Genner, M.J.; Turner, G.F.; Durbin, R. Whole-genome sequences of Malawi cichlids reveal multiple radiations interconnected by gene flow. Nat. Ecol. Evol. 2018, 2, 1940–1955. [Google Scholar] [CrossRef]
Flury, J.M.; Haas, A.; Brown, R.M.; Das, I.; Pui, Y.M.; Boon-Hee, K.; Scheidt, U.; Iskandar, D.T.; Jankowski, A.; Hertwig, S.T. Unexpectedly high levels of lineage diversity in Sundaland puddle frogs (Dicroglossidae: Occidozyga Kuhl and van Hasselt, 1822). Mol. Phylogenet. Evol. 2021, 163, 107210. [Google Scholar] [CrossRef] [PubMed]
Chan, K.O.; Hutter, C.R.; Perry, L.; Wood, J.R.; Su, Y.C.; Brown, R.M. Gene flow increases phylogenetic structure and inflates cryptic species estimations: A case study on widespread Philippine puddle frogs (Occidozyga laevis). Syst. Biol. 2022, 71, 40–57. [Google Scholar] [CrossRef] [PubMed]
Gilbert, C.C.; Rossie, J.B. Congruence of molecules and morphology using a narrow allometric approach. Proc. Natl. Acad. Sci. USA 2007, 104, 11910–11914. [Google Scholar] [CrossRef]
Phillips, J.D.; Gillis, D.J.; Hanner, R.H. Incomplete estimates of genetic diversity within species: Implications for DNA barcoding. Ecol. Evol. 2019, 9, 2996–3010. [Google Scholar] [CrossRef]
Luo, A.; Ling, C.; Ho, S.Y.W.; Zhu, C. Comparison of methods for molecular species delimitation across a range of speciation scenarios. Syst. Biol. 2018, 67, 830–846. [Google Scholar] [CrossRef]
Hofmann, E.P.; Nicholson, K.E.; Luque-Montes, I.R.; Köhler, G.; Cerrato-Mendoza, C.A.; Medina-Flores, M.; Wilson, L.D.; Townsend, J.H. Cryptic diversity, but to what extent? Discordance between single-locus species delimitation methods within mainland anoles (Squamata: Dactyloidae) of northern Central America. Front. Genet. 2019, 10, 11. [Google Scholar] [CrossRef]
Talavera, G.; Dinca, V.; Vila, R. Factors affecting species delimitations with the GMYC model: Insights from a butterfly survey. Methods Ecol. Evol. 2013, 4, 1101–1110. [Google Scholar] [CrossRef]
Knowlton, N. Sibling species in the sea. Ann. Rev. Ecol. Syst. 1993, 24, 189–216. [Google Scholar] [CrossRef]
Lindsay, T.; Valdés, Á. The model organism Hermissenda crassicornis (Gastropoda: Heterobranchia) is a species complex. PLoS ONE 2016, 11, e0154265. [Google Scholar] [CrossRef] [PubMed]
Matsuda, S.B.; Gosliner, T.M. Glossing over cryptic species: Descriptions of four new species of Glossodoris and three new species of Doriprismatica (Nudibranchia: Chromodorididae). Zootaxa 2018, 4444, 501–529. [Google Scholar] [CrossRef]
Costa-Araújo, R.; Silva-Jr., J.S.; Boubli, J.P.; Rossi, R.V.; Canale, G.R.; Melo, F.R.; Bertuol, F.; Silva, F.E.; Silva, D.A.; Nash, S.D.; et al. An integrative analysis uncovers a new, pseudo-cryptic species of Amazonian marmoset (Primates: Callitrichidae: Mico) from the arc of deforestation. Sci. Rep. 2021, 11, 15665. [Google Scholar] [CrossRef]
Magpali, L.; Machado, D.R.; Araújo, T.Q.; Garraffoni, A.R. Long distance dispersal and pseudo-cryptic species in Gastrotricha: First description of a new species (Chaetonotida, Chaetonotidae, Polymerurus) from an oceanic island with volcanic rocks. Eur. J. Taxon. 2021, 746, 62–93. [Google Scholar] [CrossRef]
Cabezas, M.P.; Lasso-Alcalá, O.M.; Quintero, T.E.; Xavier, R.; Giarrizzo, T.; Nunes, J.L.S.; Machado, F.S.; Gómez, J.; Pedroza, W.S.; Jowers, M.J. Clarifying the taxonomy of some cryptic blennies (Blenniidae) in their native and introduced range. Sci. Rep. 2022, 12, 9514. [Google Scholar] [CrossRef] [PubMed]
Hofman, S.; Cameron, R.A.D.; Proćków, M.; Sîrbu, I.; Osikowski, A.; Jaszczyńska, A.; Sokól, M.; Falniowski, A. Two new pseudocryptic species in the medium-sized common European land snails, Fruticicola Held, 1838; as a result of phylogeographic analysis of Fruticicola fruticum (O. F. Müller, 1774) (Gastropoda: Helicoidea: Camaenidae). Mol. Phyl. Evol. 2022, 168, 107402. [Google Scholar] [CrossRef]
Paz-Sedano, S.; Álvarez, J.F.M.; Gosliner, T.M.; Pola, M. Reassessing North Eastern Atlantic-Mediterranean species of Trapania (Mollusca, Nudibranchia). Zool. Scr. 2022, 51, 447–459. [Google Scholar] [CrossRef]
Smith, S.M.; Urvois, T.; Roques, A.; Cognato, A.I. Recognition of the pseudocryptic species Xylosandrus declivigranulatus (Schedl) as distinct from Xylosandrus crassiusculus (Motschulsky) (Coleoptera: Curculionidae: Scolytinae: Xyleborini). Coleopt. Bull. 2022, 76, 367–374. [Google Scholar] [CrossRef]
Heethoff, M. Cryptic species: Conceptual or terminological chaos? Trends Ecol. Evol. 2018, 33, 310. [Google Scholar] [CrossRef]
Monro, A.K.; Mayo, S.J. (Eds.) Cryptic Species: Morphological Stasis, Circumscription, and Hidden Diversity; Cambridge University Press: Cambridge, UK, 2022. [Google Scholar]
Fraga, M.F.; Ballestar, E.; Paz, M.F.; Ropero, S.; Setien, F.; Ballestar, M.L.; Heine-Suñer, D.; Cigudosa, J.C.; Urioste, M.; Benitez, J.; et al. Epigenetic differences arise during the lifetime of monozygotic twins. Proc. Natl. Acad. Sci. USA 2005, 26, 10604–10609. [Google Scholar] [CrossRef] [PubMed]
Bierbach, D.; Laskowski, K.; Wolf, M. Behavioural individuality in clonal fish arises despite near-identical rearing conditions. Nat. Comm. 2017, 8, 15361. [Google Scholar] [CrossRef] [PubMed]
Sáez, A.G.; Probert, I.; Geisen, M.; Quinn, P.; Young, J.R.; Medlin, L.K. Pseudo-cryptic speciation in coccolithophores. Proc. Natl. Acad. Sci. USA 2003, 100, 7163–7168. [Google Scholar] [CrossRef] [PubMed]

Figure 2. Reproductive systems of Dendronotus keatleyae n. sp. (A) and Dendronotus arcticus gartensis n. subsp. (B); Abbreviations: am, ampulla; bc, bursa copulatrix; fgm, female gland mass; fo, female opening; p, penis (=copulatory organ); pr, prostate; psh, penial sheath; rs, receptaculum seminis; ud, uterine duct; vd, vas deferens; vg, vaginal duct. Scale bars: 1 mm.

Table 1. List of specimens used for molecular analyses.

Species Name	Voucher	Locality	COI	16S
Dendronotus arcticus arcticus	ZMMU: Op-561	Russia: Laptev Sea	KX788140	KX788129
D. arcticus arcticus	ZMMU: Op-562	Russia: Laptev Sea	KX788141	KX788130
D. arcticus arcticus	ZMMU: Op-563	Russia: Laptev Sea	KX788142	KX788131
D. arcticus arcticus	ZMMU: Op-564	Russia: Laptev Sea	OQ588822	OQ594740
D. arcticus arcticus	ZMMU: Op-356 (the correct voucher number)	Russia: Kara Sea	KP984995	KP984989
D. arcticus gartensis n. subsp.	ZMMU: Op-804	Norway	OQ588823	OQ594741
D. arcticus gartensis n. subsp.	ZMMU: Op-802	Norway	OQ588824	OQ594742
D. frondosus	ZMMU: Op-380	Norway: Gulen	KM396976	KM397056
D. frondosus	ZMMU: Op-589	Norway: Gulen	KY391833	KY391853
D. frondosus	ZMMU: Op-591	Norway: Gulen	KY391835	KY391855
D. frondosus	ZMMU: Op-592	Norway: Gulen	KY391836	KY391856
D. frondosus	CCMMO069-21	UK: N. Ireland	OQ588829	-
D. frondosus	CCMMO071-21	UK: N. Ireland	OQ588830	-
D. kalikal	ZMMU: Op-284.1	Russia: Kamchatka	KC660026	KC611285
D. kalikal	ZMMU: Op-284.2	Russia: Kamchatka	KC660025	KC611286
D. kalikal	ZMMU: Op-284.3	Russia: Kamchatka	KM396988	KM397070
D. kalikal	ZMMU: Op-283	Russia: Kamchatka	KC660024	KC611284
D. kalikal	ZMMU: Op-285	Russia: Bering Strait	KC660027	KC611287
D. kalikal	ZMMU: Op-349.1	Russia: Kamchatka	KM396986	KM397068
D. kalikal	ZMMU: Op-349.2	Russia: Kamchatka	KM396987	KM397069
D. kalikal	ZMMU: Op-657	Russia: Kuril Islands	MK302458	MK302453
D. kalikal	WS9131	Russia: Kuril Islands	MN138314	MN138079
D. kalikal	WS9132	Russia: Kuril Islands	MN138315	MN138080
D. kalikal	ZMMU: Op-808	Russia: Kuril Islands	OQ588825	OQ594743
D. yrjargul	ZMMU: Op-718	Norway: Norwegian Sea	MT654641	MT655313
D. yrjargul	NTNU-VM-76302	Norway: Norwegian Sea	MT654642	MT655314
D. yrjargul	NTNU-VM-76306	Norway: Norwegian Sea	MT654643	MT655315
D. yrjargul	NTNU-VM-76308	Norway: Norwegian Sea	MT654644	MT655316
D. yrjargul	NTNU-VM-76305	Norway: Norwegian Sea	MT654645	MT655317
D. yrjargul	WS9116	Russia: Kara Sea	MN138317	MN138082
D. yrjargul	WS9113	Russia: Kara Sea	MN138316	MN138081
D. yrjargul	WS9117	Russia: Kara Sea	MN138318	MN138083
D. yrjargul	WS9103	Russia: White Sea	MN138311	MN138076
D. yrjargul	WS9126	Russia: White Sea	MN138312	MN138077
D. yrjargul	WS9127	Russia: White Sea	MN138313	MN138078
D. keatleyae n. sp.	NTNU-VM-82154	Norway	OQ588826	OQ594744
D. keatleyae n. sp.	NTNU-VM-82155	Norway	OQ588827	OQ594745
D. keatleyae n. sp.	CCMMO067-21	UK: N. Ireland	OQ588828	-
D. keatleyae n. sp.	MT09656	North Sea	KR084744	-
D. keatleyae n. sp.	MT09657	North Sea	KR084934	-
Duvaucelia plebeia	ZMMU: Op-572	Norway	KX788134	KX788122
Duvaucelia odhneri	CASIZ: 176219	South Africa	HM162716	HM162641

Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).

Share and Cite

MDPI and ACS Style

Korshunova, T.; Grøtan, V.V.; Johnson, K.B.; Bakken, T.; Picton, B.E.; Martynov, A. Similar Ones Are Not Related and Vice Versa—New Dendronotus Taxa (Nudibranchia: Dendronotidae) from the North Atlantic Ocean Provide a Platform for Discussion of Global Marine Biodiversity Patterns. Diversity 2023, 15, 504. https://doi.org/10.3390/d15040504

AMA Style

Korshunova T, Grøtan VV, Johnson KB, Bakken T, Picton BE, Martynov A. Similar Ones Are Not Related and Vice Versa—New Dendronotus Taxa (Nudibranchia: Dendronotidae) from the North Atlantic Ocean Provide a Platform for Discussion of Global Marine Biodiversity Patterns. Diversity. 2023; 15(4):504. https://doi.org/10.3390/d15040504

Chicago/Turabian Style

Korshunova, Tatiana, Viktor V. Grøtan, Kjetil B. Johnson, Torkild Bakken, Bernard E. Picton, and Alexander Martynov. 2023. "Similar Ones Are Not Related and Vice Versa—New Dendronotus Taxa (Nudibranchia: Dendronotidae) from the North Atlantic Ocean Provide a Platform for Discussion of Global Marine Biodiversity Patterns" Diversity 15, no. 4: 504. https://doi.org/10.3390/d15040504

APA Style

Korshunova, T., Grøtan, V. V., Johnson, K. B., Bakken, T., Picton, B. E., & Martynov, A. (2023). Similar Ones Are Not Related and Vice Versa—New Dendronotus Taxa (Nudibranchia: Dendronotidae) from the North Atlantic Ocean Provide a Platform for Discussion of Global Marine Biodiversity Patterns. Diversity, 15(4), 504. https://doi.org/10.3390/d15040504

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Menu

Similar Ones Are Not Related and Vice Versa—New Dendronotus Taxa (Nudibranchia: Dendronotidae) from the North Atlantic Ocean Provide a Platform for Discussion of Global Marine Biodiversity Patterns^†

Abstract

1. Introduction