Synthesis and Characterization of Mg-Doped CuO Nanoparticles and Their Enhanced Anticancer Efficacy Against HepG2 Liver Cancer Cells

Abstract

The rising global incidence of hepatocellular carcinoma demands innovative therapeutic strategies. This study explores the enhanced anticancer potential of magnesium-doped copper oxide (Mg-doped CuO) nanoparticles, which were synthesized to improve upon the properties of undoped CuO nanoparticles. Mg-doped CuO nanoparticles with doping concentrations ranging from 1% to 5% were prepared using the co-precipitation method and thoroughly characterized by SEM, EDS, and FTIR. Their biological activity was evaluated against HepG2 liver cancer cells and normal human fibroblast cells. The MTT assay demonstrated a significant, concentration-dependent increase in cytotoxicity for Mg-doped CuO nanoparticles compared to undoped CuO, with the 3% Mg-doped CuO formulation showing the greatest potency (IC₅₀ = 21.99 µg/mL at 48 h). Cell cycle analysis revealed that treatment with Mg-doped CuO nanoparticles, particularly at 3% and 5% doping concentrations, induced a substantial G2/M phase arrest, indicating a mechanism of action involving the disruption of cell division. Furthermore, all Mg-doped CuO nanoparticles exhibited markedly higher IC₅₀ values in normal fibroblasts, confirming a favorable selective toxicity towards cancer cells. Apoptosis was identified as a key cell death pathway through acridine orange/propidium iodide staining. These results conclusively show that magnesium doping significantly augments the selective anticancer efficacy of CuO nanoparticles via cell cycle arrest and apoptosis induction, presenting a highly promising nanomaterial targeted liver cancer therapy.

1. Introduction

Liver cancer, particularly hepatocellular carcinoma (HCC), remains a leading cause of cancer-related mortality worldwide, characterized by a poor prognosis and limited treatment efficacy in advanced stages [1]. The persistent challenges associated with conventional therapies, including systemic toxicity and the development of drug resistance, have underscored the critical need for novel therapeutic strategies [2]. In recent years, nanotechnology has offered transformative potential in oncology, providing innovative platforms for developing targeted and efficient cancer treatments [3,4].

Among various nanomaterials, copper oxide nanoparticles (CuO NPs) have emerged as a promising class of anticancer agents due to their unique physicochemical properties and demonstrated bioactivity [5]. Notably, recent investigations into composite systems highlight their potential; for instance, zinc oxide and copper oxide (ZnO-CuO) nanocomposites have demonstrated potent activity against HCC cell lines by inducing multiple modes of cell death and cell cycle arrest, showcasing the promise of engineered metal oxide systems [6]. The anticancer mechanism of CuO NPs is primarily attributed to their ability to induce oxidative stress via reactive oxygen species (ROS) generation, leading to apoptotic cell death [6,7,8]. However, the clinical translation of undoped CuO NPs is often hampered by potential off-target toxicity and a relatively narrow therapeutic window [9]. To address these limitations, elemental doping has been employed as an effective strategy to modulate the structural and functional properties of metal oxide nanoparticles [1,4]. Introducing foreign atoms into the host lattice can alter characteristics such as particle size, surface chemistry, and electronic structure, thereby tuning their biological interactions and therapeutic efficacy [10].

Magnesium (Mg), an essential biometal involved in numerous cellular processes, presents a compelling dopant for enhancing the biocompatibility and selectivity of CuO NPs [10]. Their mechanism of action is believed to involve the generation of reactive oxygen species (ROS) and the induction of apoptosis, making them promising candidates for anticancer therapy [7,8]. Previous studies have indicated that Mg doping can influence the morphological and optical properties of metal oxides, potentially leading to improved bioactivity [11]. For instance, Mg doping has been reported to influence the particle size and morphology of CuO nanoparticles, potentially affecting their bioavailability and therapeutic effectiveness [9]. Modulating these properties through controlled doping concentrations could lead to an optimized formulation that maximizes anticancer activity while minimizing toxicity to normal cells.

Recent studies have demonstrated that Mg-doped CuO nanoparticles exhibit cytotoxic effects against various cancer cell lines, including hepatocellular carcinoma, represented by the HepG2 cell line [2,3,5,12]. However, a significant research gap remains. A systematic investigation into the concentration-dependent effects of Mg doping (specifically within the 1–5% range) on the anticancer properties of CuO NPs, particularly against HCC, is lacking. While research on composite systems (e.g., ZnO-CuO) is advancing [6], the precise tuning of CuO properties through controlled Mg doping for optimal selectivity and efficacy against HCC is underexplored. Crucially, the relationship between specific Mg doping levels, the resulting nanoparticle characteristics, the elicited anticancer efficacy, and—most importantly—the selective toxicity between cancerous and normal cells has not been comprehensively elucidated for this material system.

Therefore, this study was designed to fill this gap. We aimed to synthesize a series of Mg-doped CuO nanoparticles with precise doping concentrations (1, 3, and 5%) and systematically evaluate their anticancer potential against human HepG2 hepatocellular carcinoma cells. Our objectives were threefold: (1) to determine the optimal Mg doping concentration for maximum cytotoxicity against HepG2 cells, (2) to rigorously assess the selectivity of this optimal formulation by comparing its toxicity against normal human fibroblast cells, and (3) to investigate the underlying mechanisms of action, focusing on cell cycle modulation and apoptosis induction. Our findings demonstrate that 3% Mg-doping represents an optimal concentration, conferring enhanced structural properties, the highest potency, and favorable selectivity against liver cancer cells through the induction of G2/M phase arrest and apoptosis, as supported by morphological, gene expression, and cell cycle data. This work provides a refined strategy for engineering targeted CuO-based nanotherapeutics.

2. Results

2.1. Characterization of Undoped and Mg-Doped CuO Nanoparticles

2.1.1. SEM and EDX Analysis

The SEM images of the undoped and Mg-doped CuO nanoparticles revealed noticeable changes in surface morphology with increasing Mg content (Figure 1). The undoped CuO sample (Figure 1A) displayed densely packed, irregularly shaped particles, while the 1% Mg-doped sample (Figure 1B) exhibited a slightly more porous and loosely arranged structure. With 3% Mg doping (Figure 1C), the particles appeared more fragmented and interconnected, suggesting that Mg incorporation influenced the growth and aggregation behavior. At 5% Mg doping (1D), the morphology became even more dispersed, indicating significant modification of the CuO microstructure. The accompanying EDX spectra confirmed the elemental composition of each sample, displayed in Figure 1. Undoped CuO showed only Cu and O signals, verifying its purity. In the Mg-doped samples (1%, 3%, and 5%), distinct Mg peaks appeared alongside Cu and O, confirming successful incorporation of Mg into the CuO matrix. The gradual increase in Mg signal intensity with higher doping levels further supported the controlled substitution of Mg in the lattice. Moreover, elemental mapping analysis of the 1%, 3%, and 5% Mg-doped CuO₂ nanoparticles (Figure 2) confirmed the presence of Mg, Cu, and O elements in the Mg-doped CuO₂ nanoparticles. Overall, the SEM, EDX and elemental analyses demonstrated that Mg doping not only altered the morphology of CuO nanoparticles but was also successfully incorporated into the structure as intended.

2.1.2. TEM Analysis

The TEM analysis revealed a clear reduction in particle size with increasing Mg doping concentration in CuO₂ nanoparticles. As shown in Figure 3a,d,g, the average particle sizes were estimated to be approximately 28 nm, 18 nm, and 12 nm for 1%, 3%, and 5% Mg-doped CuO₂ nanoparticles, respectively, indicating that Mg incorporation effectively suppresses particle growth. The corresponding HR-TEM images (Figure 3b,e,h) displayed well-resolved lattice fringes with interplanar spacings of 0.233 nm, 0.249 nm, and 0.246 nm for 1%, 3%, and 5% Mg-doped samples, respectively, confirming the crystalline nature of the nanoparticles and slight lattice distortion induced by Mg doping. Furthermore, the SAED patterns shown in Figure 3c,f,i exhibited distinct concentric diffraction rings composed of bright spots, which can be indexed to the crystalline planes of CuO₂, demonstrating the polycrystalline nature of all Mg-doped samples and confirming that the crystal structure is well preserved even at higher Mg doping levels.

2.1.3. XRD Analysis

The XRD patterns of the undoped and Mg-doped CuO NPs (Cu_1−xMg_xO NPs) are presented in Figure 4. The undoped CuO NPs displayed diffraction peaks corresponding to the monoclinic CuO planes, including (110), (002), (111), (−112), (−202), (112), (020), (202), (113), (022), (311), (−113), (−311), and (004). No additional peaks associated with impurities or the Cu₂O phase were observed. Furthermore, the incorporation of Mg into the CuO lattice did not alter the original diffraction peak positions. All the samples remained well-matched with the undoped CuO phase, with no detectable MgO peaks. The obtained diffraction profiles for both undoped and Mg-doped CuO NPs agreed with the previously reported literature. All doping levels (1%, 3%, and 5% Mg) retained the pure monoclinic CuO structure consistent with standard JCPDS files (e.g., JCPDS 48-1548) [13]. The absence of MgO or other impurity peaks suggested that Mg ions were successfully incorporated into the CuO lattice, most likely substituting for Cu²⁺ due to their similar ionic sizes. The preservation of the monoclinic structure across all doping concentrations provided strong evidence for effective Mg doping without the formation of secondary phases.

2.1.4. FT-IR Spectra

The FT-IR spectra of the undoped and Mg-doped CuO nanoparticles (Cu_1−xMg_xO NPs) showed the characteristic vibrational features confirming CuO formation and the effect of Mg incorporation (Figure 5A,B). A broad band around 3438 cm⁻¹ was assigned to O–H stretching of physisorbed water, while the absorption at 1632 cm⁻¹ corresponded to H–O–H bending vibrations [14]. The peaks at 1442 cm⁻¹ and 1041 cm⁻¹ indicated the presence of residual nitrate or organic species from the precursors. In the lower wavenumber region, strong metal–oxygen vibrations were evident, with Cu–O stretching modes appearing at 595–605 cm⁻¹ and 516–535 cm⁻¹, typical of monoclinic CuO [15]. The slight band shifts observed with increasing Mg doping (1%, 3% and 5%) reflected the successful substitution of Mg²⁺ into the CuO lattice and the resulting local structural distortions. Overall, the FT-IR analysis confirmed that the fundamental CuO lattice was retained, with minor modifications induced by Mg incorporation.

2.2. In Vitro Anticancer Activity and Selectivity

The anticancer potential and selectivity profile of the synthesized Mg-doped CuO nanoparticles were systematically evaluated against human hepatocellular carcinoma (HepG2) cells and compared to normal human dermal fibroblasts (PCS-201-010) (Figure 6). A comprehensive time-course analysis (24, 48, and 72 h) was conducted for all formulations using the MTT assay, with undoped CuO NPs serving as the reference (Figure 6B). The results demonstrated a potent concentration- and time-dependent cytotoxic effect on HepG2 cells for all Mg-doped CuO formulations (Figure 6A and Supplementary Figures S1–S3). The calculated half-maximal inhibitory concentration (IC₅₀) values are summarized in

Table 1. IC₂₀ and IC₅₀ values (µg/mL) of Mg-doped CuO NPs and undoped CuO NPs on HepG2 cell lines.

Time/Treatment	IC20 Values (µg/mL)			IC50 Values (µg/mL)
	24 h	48 h	72 h	24 h	48 h	72 h
Undoped CuO	98.23	41.14	53.98	>500.00	168.31	121.52
1% Mg-doped CuO	18.44	16.13	14.23	81.21	50.70	27.81
3% Mg-doped CuO	11.29	2.78	21.65	124.01	21.99	46.53
5% Mg-doped CuO	23.37	11.87	28.09	122.99	44.41	56.36

. Notably, the 3% Mg-doped CuO formulation exhibited the highest potency, achieving the lowest IC₅₀ value of 21.99 µg/mL after 48 h of exposure.

A critical finding was the consistent and significant selective toxicity of the Mg-doped nanoparticles. Across all tested time points (24, 48, and 72 h), every Mg-doped formulation showed markedly higher IC₅₀ values (indicating lower toxicity) in normal fibroblasts compared to HepG2 cells. This differential sensitivity is visualized in the concentration-response curves for each formulation (Figure 6 and Supplementary Figures S4–S7).

The 3% Mg-doped CuO NPs demonstrated the most favorable selective window. For instance, its cytotoxicity in fibroblasts remained substantially lower across the time course, underscoring its ability to preferentially target cancer cells while minimizing harm to normal cells. Statistical analysis (one-way ANOVA followed by DMRT, performed independently for each cell type) confirmed that the reduction in viability caused by the Mg-doped NPs, particularly the 3% formulation, was significantly more pronounced in HepG2 cells than in fibroblasts at corresponding concentrations and time points (p < 0.05).

This comprehensive multi-time-point analysis confirms that magnesium doping not only enhances the absolute anticancer potency of CuO nanoparticles but, more importantly, confers a robust and consistent selective toxicity profile against hepatocellular carcinoma cells.

2.3. Analysis of Cell Death Mechanisms

To elucidate the mechanism behind the observed cytotoxicity, we investigated the induction of apoptosis and alterations in the cell cycle. The mode of cell death was analyzed using Acridine Orange/Propidium Iodide (AO/PI) double staining (Figure 7). Fluorescence microscopy images of HepG2 cells treated with the IC₅₀ concentration of 3% Mg-doped CuO nanoparticles for 48 h (Figure 7D) revealed a significant increase in the number of cells exhibiting morphological features of apoptosis, such as chromatin condensation and nuclear fragmentation, compared to untreated controls. This was in stark contrast to the uniform green fluorescence of viable cells in the control group, clearly demonstrating that apoptosis is a primary pathway of cell death induced by Mg-doped CuO nanoparticles.

Furthermore, cell cycle analysis via flow cytometry was performed to determine if the nanoparticles affected cell proliferation. The results indicated that treatment with the most effective formulations, 3% and 5% Mg-doped CuO, induced a significant disturbance in the cell cycle progression. A substantial accumulation of cells in the G2/M phase was observed compared to the untreated control, which displayed a more distributed cell population across G0/G1, S, and G2/M phases (Figure 8). This specific arrest at the G2/M checkpoint suggests that the Mg-doped CuO nanoparticles inhibit cellular proliferation by preventing the entry of cells into mitosis, ultimately leading to cell death.

2.4. Mg-Doped CuO Nanoparticles Modulate Apoptosis-Related Gene Expression

To further elucidate the molecular basis of apoptosis induced by Mg-doped CuO nanoparticles, the expression levels of key apoptosis-related genes (Caspase-7, Caspase-9, Bax, and p53) were analyzed by quantitative real-time PCR (qRT-PCR) in HepG2 cells after 48 h treatment with the IC₂₀ concentration of each formulation (Figure 9).

The results revealed a striking, doping-concentration-dependent upregulation of Caspase-7 (Cas7) mRNA (Figure 9A). Treatment with 3% Mg-doped CuO NPs induced the most potent effect, increasing Cas7 expression nearly 99-fold compared to the untreated control. This massive induction was significantly higher than that caused by undoped CuO NPs (~33-fold) and suggests the activation of a robust effector caspase pathway.

In contrast, the expression of Caspase-9 (Cas9), an initiator caspase for the intrinsic mitochondrial pathway, showed a more modest increase, with only the 3% Mg-doped sample showing a notable upregulation (~4.6-fold) (Figure 7B). The expression of the pro-apoptotic protein Bax and the tumor suppressor p53 was also examined. While both genes showed a slight upregulation in cells treated with 3% Mg-doped CuO NPs (Figure 7C,D), the magnitude of change was less pronounced than that of Cas7.

These gene expression profiles provide molecular evidence that Mg-doped CuO nanoparticles, particularly the 3% formulation, potently activate apoptotic machinery in HepG2 cells. The dominant upregulation of Caspase-7 points towards the strong execution of the apoptosis program, consistent with the morphological features observed in AO/PI staining.

3. Discussion

The development of effective nanomaterial-based therapies for hepatocellular carcinoma (HCC) is an active area of research, with current strategies exploring diverse approaches. These include composite systems, such as ZnO-CuO nanocomposites that induce multimodal cell death [6], and elemental doping to precisely modify the properties of single-phase nanoparticles. Within this framework, our study establishes that the anticancer efficacy of this approach is critically dependent on the specific formulation, namely, the doping concentration of magnesium (Mg) in CuO nanoparticles.

3.1. Correlation Between Mg Doping, Structural Properties, and Enhanced Bioactivity

The development of nanotherapeutic agents that selectively target cancer cells while sparing healthy tissues remains a central goal in oncology [6,16]. This study demonstrates that the strategic doping of magnesium into copper oxide nanoparticles significantly enhances their structural properties, anticancer efficacy, and selectivity against human hepatocellular carcinoma (HepG2) cells, primarily through the induction of cell cycle arrest and apoptosis.

Our successful synthesis of Mg-doped CuO nanoparticles via co-precipitation was unequivocally confirmed by comprehensive characterization. The XRD analysis confirmed the monoclinic CuO structure without secondary phases, while the observed peak shifts and changes in crystallite size provide strong evidence for the successful incorporation of Mg²⁺ ions into the CuO lattice, consistent with previous reports on metal-doped oxides [13]. Critically, TEM analysis (Figure 3) revealed a clear reduction in primary particle size with increasing Mg doping concentration, from approximately 28 nm for 1% doping to 12 nm for 5% doping. The reduction in particle agglomeration and the more uniform morphology observed in SEM micrographs upon Mg doping are particularly significant. It is well-established in nanotoxicology that smaller, less agglomerated nanoparticles possess a higher surface-area-to-volume ratio, which facilitates increased cellular interaction and uptake [1,17]. This direct modification in physical morphology, induced by Mg doping, serves as a foundational factor for the enhanced biological activity observed, providing a greater reactive surface area for interaction with cellular components. Furthermore, the homogeneous distribution of Mg within the CuO matrix, as confirmed by elemental mapping (Figure 2), verifies the successful and uniform doping rather than surface adsorption or phase segregation. The controlled substitution of Mg²⁺ for Cu²⁺, facilitated by their similar ionic radii, modifies the electronic structure and surface chemistry of the nanoparticles. These tailored structural properties—reduced size, inhibited agglomeration, and altered surface energetics—are directly correlated with the dramatic enhancement in bioactivity. The profound biological consequence of this structural tuning is evidenced at the molecular level by our qRT-PCR results, which show a massive, doping-concentration-dependent upregulation of pro-apoptotic genes, most notably Caspase-7. This direct link confirms that the Mg-induced structural optimizations translate efficiently into a potent cytotoxic response, enabling more efficient cellular uptake and subsequent activation of programmed cell death pathways in cancer cells.

The synergy between these two mechanisms is a powerful combination: the NPs first induce DNA damage (leading to G2/M arrest), and the unresolved cellular stress then activates the mitochondrial apoptotic pathway, efficiently eliminating the compromised cancer cells. This cascade—from ROS generation to cell cycle arrest, culminating in apoptosis—is supported by studies on other therapeutic agents beyond metal oxides. For instance, bioactive anticancer peptides derived from Cordyceps militaris have also been shown to induce significant apoptosis in colorectal cancer cells, as evidenced by morphological features like chromatin condensation and membrane blebbing [18]. This convergence on apoptotic cell death—observed across diverse therapeutic platforms from natural peptides to engineered nanomaterials—underscores apoptosis as a critical and effective endpoint for novel anticancer strategies. Our study reinforces this paradigm by providing both morphological and direct molecular evidence (via qRT-PCR) for the potent activation of the apoptotic execution pathway by Mg-doped CuO NPs.

3.2. Enhanced Anticancer Efficacy and the Concept of Selective Cytotoxicity

The most striking finding of this work is the profound enhancement of cytotoxicity and the clear selective toxicity exhibited by the Mg-doped CuO nanoparticles. The IC₅₀ value of the optimal 3% Mg-doped CuO formulation (21.99 µg/mL at 48 h) was an order of magnitude lower than that of undoped CuO NPs (168.31 µg/mL), underscoring that Mg doping is not a mere structural alteration but a functional enhancement that drastically boosts anticancer potency. This aligns with the working hypothesis that doping can tune the therapeutic properties of metal oxides [10]. The optimized 3% Mg-doped CuO NPs (IC₅₀ = 21.99 µg/mL at 48 h) exhibit cytotoxicity against HepG2 cells comparable to other advanced, green-synthesized, copper-based nanomaterials, such as Cu/Cu₂O yolk-shell structures (IC₅₀ ≈ 25 µg/mL) [19].

The interaction of Mg-doped CuO nanoparticles with cells likely involves a dual mechanism, consistent with the established behavior of metal oxide nanoparticles. Based on the extensive literature, the probable sequence of events begins with the cellular internalization of intact nanoparticles via endocytic pathways [17]. Following uptake, the nanoparticles are trafficked to lysosomes, where the acidic and enzymatic environment promotes their partial dissolution. This process releases Cu²⁺ ions (and potentially Mg²⁺ ions) into the cytosol [20]. These free ions can participate in cellular redox cycling, catalyzing Fenton-like reactions that lead to a surge in reactive oxygen species (ROS) generation [21]. The observed biological effects—potent cytotoxicity, induction of G2/M phase arrest (indicative of DNA damage), and morphological signs of apoptosis—are all hallmarks of this ROS-mediated cascade. Furthermore, the enhanced efficacy imparted by Mg doping can be rationalized by its role in modifying the nanoparticle’s surface chemistry and electronic structure, potentially creating more active sites for catalytic ROS generation or influencing dissolution kinetics [22].

More importantly, the consistently and significantly higher IC₅₀ values in normal human fibroblasts across all Mg-doped CuO formulations compared to HepG2 cells represent a critical outcome. This selective cytotoxicity is the cornerstone of modern cancer therapy, aiming to minimize off-target effects. The broad implication of this finding is that Mg-doped CuO NPs possess an inherent ability to distinguish between cancerous and non-cancerous cells. This selectivity can be attributed, in part, to the well-documented “Warburg effect” in cancer cells [23]. Their heightened glycolytic metabolism creates a more acidic tumor microenvironment, which may accelerate the dissolution of internalized NPs and thus amplify ion release and ROS generation within cancer cells [7]. Additionally, cancer cells often exhibit upregulated endocytic activity to meet increased nutrient demands, potentially leading to greater nanoparticle uptake compared to quiescent normal fibroblasts [17]. The non-linear relationship between doping concentration and efficacy, with 3% being optimal, further suggests a complex interplay where excessive doping may alter surface chemistry or aggregation state in a way that diminishes biological interaction.

More importantly, the consistently and significantly higher IC₅₀ values in normal human fibroblasts across all Mg-doped CuO formulations compared to HepG2 cells represent a critical outcome. This selective cytotoxicity is the cornerstone of modern cancer therapy, aiming to minimize off-target effects. The broad implication of this finding is that Mg-doped CuO NPs possess an inherent ability to distinguish between cancerous and non-cancerous cells. This selectivity could be attributed to the well-documented “Warburg effect” in cancer cells, where their heightened metabolic activity and more acidic microenvironment may accelerate the dissolution of NPs and the generation of reactive oxygen species (ROS) [7,24]. The non-linear relationship between doping concentration and efficacy, with 3% being optimal, further suggests a complex interplay where excessive doping may alter surface chemistry or aggregation state in a way that diminishes biological interaction, as hinted at by the crystallite size changes in our XRD data.

The findings of this study demonstrate that Mg-doped CuO nanoparticles exhibit a significant and selective cytotoxic effect against human hepatocellular carcinoma (HepG2) cells compared to normal fibroblast cells. This preferential anticancer activity can be attributed to a combination of fundamental physiological differences between cancer and normal cells, often referred to as the “Achilles’ heel” of malignancies, which are exacerbated by the biochemical actions of the nanoparticles.

The primary mechanism underlying the cytotoxicity of metal oxide nanoparticles like CuO is the induction of oxidative stress within cells [25]. Upon cellular uptake, these NPs can catalytically generate reactive oxygen species (ROS), such as superoxide anions (O₂•⁻), hydrogen peroxide (H₂O₂), and the highly reactive hydroxyl radicals (•OH), through Fenton-like and Haber-Weiss reactions [21]. Concurrently, the slightly acidic and enzymatic environment of the cellular lysosomes can lead to the dissolution of the NPs, releasing Cu²⁺ ions. These free ions can further participate in cellular redox cycling, amplifying ROS production and binding to biomolecules, thereby disrupting essential cellular functions [20].

The critical question, however, is not why these NPs are toxic, but why their toxicity is markedly more pronounced in cancer cells. The explanation lies in the distinct biochemical landscape of malignant cells. HepG2 cells, like most cancer cells, exhibit a hyperactive metabolism, particularly a high rate of glycolysis, even under normal oxygen conditions (the Warburg effect), to fuel their rapid proliferation [23]. This metabolic state results in an inherently elevated baseline level of mitochondrial ROS. When Mg-doped CuO NPs enter these cells and generate an additional, massive burst of ROS, they overwhelm the already strained antioxidant defense systems (e.g., glutathione, superoxide dismutase, catalase). This leads to a catastrophic oxidative stress condition, causing irreversible damage to lipids (lipid peroxidation), proteins, and DNA, ultimately triggering apoptotic or necrotic cell death [3,26,27]. The role of Mg-doping is pivotal here; it is known to enhance the catalytic and electronic properties of CuO, potentially by creating crystal defects that act as active sites for ROS generation, thereby making the NPs more potent [22].

In contrast, normal fibroblasts possess a robust and well-balanced antioxidant defense system capable of effectively neutralizing the moderate increase in ROS induced by the NPs. Furthermore, their lower metabolic rate and proliferation status mean they have a much lower basal level of ROS, providing a greater buffer capacity to cope with exogenous oxidative insults without reaching a lethal threshold [28].

Another significant factor contributing to the selectivity is the differential uptake of nanoparticles. Cancer cells often exhibit enhanced endocytic activity due to their increased nutrient demands for growth and division. It is highly plausible that HepG2 cells internalize a substantially larger quantity of Mg-doped CuO NPs compared to the quiescent fibroblasts [17]. A higher intracellular NP concentration directly translates to greater ROS production and ion release within the cancer cells, leading to a more severe cytotoxic outcome.

Moreover, the phenomenon of “metal addiction” in cancer cells might also play a role. Some tumors show an increased demand for certain metals, such as copper, to support the activity of key enzymes involved in angiogenesis and metastasis [29]. This might make them more susceptible to the toxic effects of copper-ion release from the dissolving NPs, whereas normal cells regulate copper homeostasis more effectively.

3.3. Time-Dependent Potency Shift: Rapid Initial Cytotoxicity and Diminished Effect over Extended Exposure

A pivotal finding in our dose-response analysis of Mg-doped CuO nanoparticles (NPs) against HepG2 cells is the time-dependent shift in cytotoxic potency, evidenced by a lower IC₅₀ value at 48 h compared to 72 h. This counterintuitive observation, where a longer exposure time does not correlate with increased potency, can be explained by the dynamic interplay between the NPs’ rapid mechanism of action and the subsequent biological responses of the surviving cell population.

The primary mechanism of Mg-doped CuO NP cytotoxicity is the rapid induction of intense oxidative stress through the generation of reactive oxygen species (ROS) and the release of Cu²⁺ ions [20,21]. We postulate that this initial insult is both acute and potent. Within the first 48 h, the NPs are internalized efficiently, leading to a swift accumulation of ROS that overwhelms the cellular antioxidant defenses, causing extensive damage to lipids, proteins, and DNA, and triggering apoptotic pathways [26]. This rapid and massive damage results in a significant cell death within a short timeframe, yielding a low IC₅₀ value that reflects high potency. Our molecular data supports this, showing that the most dramatic pro-apoptotic transcriptional response (e.g., the peak ~99-fold upregulation of Caspase-7) aligns with this window of peak cytotoxic potency at 48 h. The subsequent increase in IC₅₀ at 72 h suggests a diminution of effective cytotoxicity, which can be attributed to several interconnected factors rather than a single cause. Essentially, the NPs deliver their most lethal blow early in the exposure period.

The increase in IC₅₀ observed at the 72 h mark suggests a diminution of effective cytotoxicity over an extended time. This can be attributed to several factors:

First, the phenomenon of “effect saturation” likely occurs. The most vulnerable cells succumb to the initial oxidative burst by 48 h. This is consistent with our observation that the transcriptional surge in apoptosis execution genes (like Caspase-7) was captured at this 48 h peak. The remaining cell population represents a more resilient subclone that may have inherent resistance or activated adaptive survival responses [30]. These cells might upregulate antioxidant defenses (e.g., glutathione synthesis, increased catalase, and superoxide dismutase activity) or enhance DNA repair mechanisms to counteract the ongoing oxidative stress, thereby reducing the efficacy of the same NP concentration over time [31].

Second, the stability and bioavailability of the NPs themselves must be considered. Over 72 h in a complex biological milieu, the NPs may undergo physicochemical transformations that reduce their potency. Agglomeration or sedimentation could decrease the effective surface area available for cellular interaction and ROS generation [32,33]. Furthermore, the NPs might be sequestered or degraded by cellular clearance mechanisms, and the released Cu²⁺ ions could be chelated by cellular proteins like metallothioneins, effectively detoxifying them [16,34]. Consequently, the effective dose the cells experience between 48 and 72 h may be lower than the administered dose.

Finally, the repopulation dynamics of the surviving cells play a role. While the cytotoxic effect plateaus or declines due to the reasons above, the small fraction of resistant cells that survive the initial 48 h assault may begin to proliferate at a low rate, despite the continued presence of the NPs [35]. This slow repopulation would lead to a higher number of viable cells at 72 h compared to the scenario if the death rate had remained constant, thereby increasing the calculated IC₅₀.

In conclusion, the time-dependent decrease in the potency of Mg-doped CuO NPs, as indicated by the higher IC₅₀ at 72 h, is not an indicator of poor efficacy but rather a reflection of the complex and dynamic nature of nanomaterial-cell interactions. It underscores a rapid and potent initial cytotoxic action, followed by a phase dominated by cellular adaptation, NP transformation, and population dynamics. This insight is crucial for therapeutic applications, suggesting that the timing and frequency of NP administration might be optimized to maintain effective cytotoxicity, for instance, through repeated dosing to target the adapted cell population before it can recover and proliferate.

3.4. Elucidating the Molecular Mechanisms: Synergy of Cell Cycle Arrest and Apoptosis

Metal oxide-based nanomaterials, including nanocomposites, can induce diverse cell death pathways such as apoptosis, necrosis, and autophagy in HCC cells [6,16]. Our findings provide deep mechanistic support for the apoptotic pathway as a primary and potent mechanism for Mg-doped CuO NPs. Delving into the molecular mechanisms, our results provide a compelling two-pronged mechanism for the anticancer action of Mg-doped CuO NPs, now strongly supported by quantitative gene expression data.

First, the cell cycle analysis revealed a substantial arrest in the G2/M phase. The G2/M checkpoint is a critical control point that prevents cells with damaged DNA from proceeding to mitosis. The accumulation of HepG2 cells in this phase strongly implies that our nanoparticles induce genotoxic stress. While direct ROS measurement was not performed in this study, such DNA damage is a well-documented consequence of oxidative stress induced by metal oxide nanoparticles like CuO, often via ROS-mediated pathways [7,8,21]. This arrest halts proliferation and can act as a trigger for cell death pathways. Our observation of apoptotic morphology and gene expression aligns with reports on other cytotoxic copper nanosystems. For example, Cu/Cu₂O yolk-shell nanostructures also induced characteristic apoptotic features like chromatin condensation and nuclear fragmentation in HepG2 cells [19]. This consistency across differently designed copper oxide materials suggests that induction of apoptosis may be a common and potent endpoint for their anticancer activity, despite potential differences in initial interaction or uptake mechanisms.

Second, and more conclusively, our qRT-PCR analysis provides direct molecular evidence for the potent induction of apoptosis. The most striking finding was the dramatic, doping-concentration-dependent upregulation of the executioner Caspase-7 (Cas7) gene, which increased nearly 99-fold after treatment with the optimal 3% Mg-doped formulation (Figure 7). This massive transcriptional activation of a key effector caspase offers unambiguous proof that the nanoparticle treatment robustly engages the final execution phase of programmed cell death. It quantitatively validates the apoptotic morphology (chromatin condensation, nuclear fragmentation) observed via AO/PI staining. The more modulated responses in Caspase-9, Bax, and p53 expression provide a fuller molecular context, suggesting a potent apoptotic signal that may amplify through downstream caspase cascades.

The synergy between these two mechanisms is a powerful combination: the NPs likely cause DNA damage (leading to G2/M arrest), and the unresolved cellular stress subsequently activates the apoptotic machinery, as definitively shown by the Caspase-7 surge, to efficiently eliminate the compromised cancer cells. This cascade—from proposed initial stress (e.g., oxidative insult) to cell cycle arrest and culminating in the transcriptional and morphological hallmarks of apoptosis—confirms that the enhanced cytotoxicity of Mg-doped CuO NPs is not a result of general toxicity but a targeted disruption of key cellular proliferation and death pathways.

Our qRT-PCR analysis provides a crucial molecular layer to the mechanistic understanding. The dramatic, concentration-dependent upregulation of Caspase-7 (effector caspase) mRNA, peaking with the 3% Mg-doped formulation, offers direct transcriptional evidence for the activation of the final execution phase of apoptosis. This aligns perfectly with the observed cellular morphology of chromatin condensation and nuclear fragmentation. The comparatively weaker induction of *Caspase-9* suggests that the intrinsic (mitochondrial) apoptotic pathway might be initiated but is rapidly amplified through a powerful effector caspase cascade. The modest changes in Bax and p53 indicate that while the classical p53-Bax axis may be involved, the apoptotic signal induced by Mg-doped CuO NPs is potent enough to trigger massive caspase activation, potentially through alternative or amplified downstream signaling. This gene expression signature solidifies the conclusion that the enhanced cytotoxicity of Mg-doped CuO NPs is mediated through the potent induction of programmed cell death.

3.5. The Pivotal Role of Magnesium: From Structural Dopant to Translational Potential

While the structural role of Mg in modifying the CuO lattice is clear, its biological contribution within the cytotoxic mechanism presents an intriguing avenue for further exploration. As a vital cofactor for enzymes involved in DNA repair and energy metabolism, the localized release of Mg²⁺ ions from the degrading nanoparticle surface could potentially disrupt these essential cellular processes in cancer cells, thereby synergizing with Cu²⁺-induced oxidative stress and apoptosis. This perspective elevates Mg from a passive structural modifier to an active participant in the therapeutic mechanism.

While our in vitro findings establish a compelling proof-of-concept for the enhanced selectivity and potency of Mg-doped CuO NPs, we acknowledge an important limitation of the current study. Our characterization focused on the dry-state properties of the nanoparticles. Key physicochemical parameters in biologically relevant media—specifically, hydrodynamic size and zeta potential—which critically govern colloidal stability, aggregation behavior, and cellular interactions in physiological environments, were not measured due to instrumental constraints. Determining these properties is a crucial next step to fully understand the nano-bio interface and correlate dispersion stability with biological activity.

This consideration is directly relevant to the translational pathway. The aggregation tendency noted in dry-state SEM images underscores the need for dedicated formulation science to realize the in vivo potential of this promising nanomaterial. Future work must therefore focus on engineering the nanoparticle’s surface and delivery system. Strategies will include surface functionalization with biocompatible polymers (e.g., polyethylene glycol, PEG) to enhance colloidal stability in biological fluids and reduce rapid clearance. Furthermore, conjugating tumor-targeting ligands could promote active accumulation within tumor tissue. These advanced formulations will aim to preserve the core Mg-doped CuO chemistry responsible for the observed cytotoxic mechanism while imparting the necessary “stealth” and targeting properties for systemic delivery.

In conclusion, magnesium doping is established as a powerful strategy for creating a more potent and selective CuO-based nanotherapeutic core. The demonstrated in vitro efficacy and mechanistic insight justify the next critical phase: embedding this optimized nanomaterial into stable, well-characterized drug delivery platforms to evaluate its therapeutic potential in preclinical models of hepatocellular carcinoma.

4. Materials and Methods

4.1. Chemicals and Reagents

All chemicals used in this study were of analytical grade and used without further purification. Copper nitrate trihydrate (Cu(NO₃)₂·3H₂O, >99.0%), magnesium nitrate hexahydrate (Mg(NO₃)₂·6H₂O, >99.0%), sodium hydroxide (NaOH), and hydrochloric acid (HCl) were obtained from EMSURE^® (Darmstadt, Germany). Ethylenediamine tetra-acetic acid (EDTA) was purchased from Fisher Scientific (Hampton, NH, USA), and absolute ethanol was obtained from VWR Chemicals (Radnor, PA, USA). De-ionized (DI) water was used throughout the synthesis process.

For cell culture and biological assays, Dulbecco’s Modified Eagle Medium (DMEM), Fetal Bovine Serum (FBS), penicillin-streptomycin, amphotericin B, and trypsin-EDTA were procured from Gibco (Thermo Fisher Scientific, Waltham, MA, USA). The MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay kit, Acridine Orange (AO), and Propidium Iodide (PI) were purchased from Sigma-Aldrich (St. Louis, MO, USA).

4.2. Synthesis of Undoped and Mg-Doped CuO Nanoparticles

Undoped CuO₂ nanoparticles were synthesized through co-precipitation techniques. Generally, 0.10 mol of copper(II) nitrate trihydrate, designated as Cu(NO₃)₂·3H₂O, was dissolved in deionized water through vigorous magnetic stirring to produce a homogeneous solution. A solution of sodium hydroxide, designated as NaOH, was added dropwise to the solution of copper precursor, and the system was stirred for several hours. Consequently, the solution changed to pH 10, and a dark precipitate was formed. The precipitate obtained was filtered and washed repeatedly with deionized water and ethanol to remove ions and impurities. The supernatant obtained was dried at 80 °C and then calcined at an optimum point to produce pure CuO₂ nanoparticles [2,12].

Briefly, Magnesium-doped copper oxide (Mg-doped CuO₂) nanoparticles with doping concentrations of 1%, 3%, and 5% were successfully prepared through a carefully controlled co-precipitation method with accurate calculations of the molar ratios. In a general procedure, a constant total concentration of metal ions of 0.10 mol was used for all samples. For the undoped CuO₂ samples, 0.10 mol of Cu²⁺ precursor solution (e.g., Cu(NO₃)₂·3H₂O) was dissolved in deionized water under vigorous stirring. For the Mg-doped samples, Cu²⁺ ions were replaced by Mg²⁺ ions in fixed proportions depending on the doping concentration while maintaining a constant total concentration of metal ions. For 1% Mg-doped CuO₂, for example, 0.099 mol of Cu²⁺ ions and 0.001 mol of Mg²⁺ ions (from Mg(NO₃)₂·6H₂O) were used; for 3% Mg-doped CuO₂, 0.097 mol of Cu²⁺ ions and 0.003 mol of Mg²⁺ ions were used; and for 5% Mg-doped CuO₂, 0.095 mol of Cu²⁺ ions and 0.005 mol of Mg²⁺ ions were used. The corresponding precursor salts were separately dissolved in water and then mixed together to form a uniform solution, followed by the addition of a precipitating agent (such as NaOH) dropwise until the solution pH was adjusted to about 10, resulting in the formation of a dark precipitate. The mixture was stirred and aged to ensure the uniform distribution of the Mg²⁺ ions in the CuO₂ lattice. The precipitate was then filtered, washed with deionized water and ethanol to remove any ion residues, and dried at 80 °C, followed by calcination at an optimized temperature to produce phase-pure 1%, 3%, and 5% Mg-doped CuO₂ nanoparticles that were suitable for analysis.

4.3. Characterization of Nanoparticles

The crystalline structure and phase purity of the synthesized nanoparticles were determined using X-ray Diffraction (XRD) on a Bruker D8 Advance diffractometer (Bruker AXS, Karlsruhe, Germany) with Cu-Kα radiation (λ = 1.5418 Å), operating at 40 kV and 30 mA. Data were collected in the 2θ range of 5° to 90° with a scanning rate of 0.5°/min.

The surface morphology and elemental composition were analyzed using Field Emission Scanning Electron Microscopy (FE-SEM) on a Quanta 450 microscope (FEI, Hillsboro, OR, USA) coupled with an Energy Dispersive X-ray Spectroscopy (EDS) detector for elemental analysis and mapping. Further morphological analysis was performed using Transmission Electron Microscopy (TEM).

Fourier Transform Infrared (FTIR) spectroscopy was performed using a Bruker TENSOR 27 spectrometer (Bruker, Billerica, MA, USA) to identify the functional groups and chemical bonds present on the nanoparticle surface. Spectra were recorded in the range of 4000–400 cm⁻¹.

4.4. Cell Culture

The human hepatocellular carcinoma cell line (HepG2) and the human dermal fibroblast cell line (PCS-201-010) used in this study were kindly provided by Dr. Mattaka Khongkaw, senior researcher at the National Nanotechnology Center (NANOTEC), Thailand. Both cell lines were cultured in DMEM supplemented with 10% (v/v) FBS and 1% (v/v) penicillin-streptomycin. Cells were maintained in a humidified incubator at 37 °C with 5% CO₂. The culture medium was refreshed every 2–3 days, and cells were subcultured using trypsin-EDTA upon reaching 80–90% confluence.

4.5. Assessment of Cell Viability (MTT Assay)

The cytotoxic effects of the synthesized nanoparticles on HepG2 and fibroblast cells were evaluated using the MTT assay. Cells were seeded in 96-well plates at a density of 5 × 10⁴ cells/mL and allowed to adhere for 24 h. Subsequently, the cells were treated with a wide range of concentrations (0–500 µg/mL for Mg-doped CuO NPs; 0–500 µg/mL for undoped CuO NPs) of the nanoparticles and incubated for 24, 48, and 72 h. Untreated cells served as the negative control, and CuO NPs were used as a reference control.

After the incubation period, the MTT solution (5 mg/mL in PBS) was added to each well and incubated for 3 h at 37 °C. The formed formazan crystals were dissolved by adding 100 µL of dimethyl sulfoxide (DMSO) to each well. The absorbance was measured at a wavelength of 570 nm using a microplate reader (BioTek, Winooski, VT, USA). The percentage of cell viability was calculated as follows:

% Cell Viability = (Absorbance of Sample/Absorbance of Control) × 100

The half-maximal inhibitory concentration (IC₅₀) and the inhibitory concentration at 20% (IC₂₀) were determined from the dose-response curves. The data were analyzed by non-linear regression using GraphPad Prism software (version 10.2.0). The dose-response curves were fitted using a four-parameter logistic model (log(inhibitor) vs. response-variable slope). The IC₂₀ values were subsequently used to determine appropriate sub-lethal treatment concentrations for mechanistic studies, including apoptosis analysis, cell cycle analysis, and qRT-PCR. For conditions where the calculated IC₅₀ value exceeded the maximum tested concentration (500 µg/mL), the IC₅₀ is reported as “>500 µg/mL” (see Table 1).

4.6. Analysis of Apoptosis by Acridine Orange/Propidium Iodide (AO/PI) Staining

Apoptotic cell death was detected using a dual fluorescent staining method with Acridine Orange (AO) and Propidium Iodide (PI) [3]. HepG2 cells were seeded in 6-well plates at a density of 1 × 10⁵ cells/well and allowed to adhere for 24 h. Subsequently, the cells were treated for 48 h with the predetermined IC₂₀ concentration of each nanoparticle formulation, corresponding to a sub-lethal dose that induces a measurable biological response while maintaining sufficient cell viability for morphological assessment. The specific concentrations used were as follows: 41.14 µg/mL for undoped CuO NPs, 16.13 µg/mL for 1% Mg-doped CuO NPs, 2.78 µg/mL for 3% Mg-doped CuO NPs, and 11.87 µg/mL for 5% Mg-doped CuO NPs. Untreated cells served as the negative control, while cells treated with the IC₂₀ of undoped CuO NPs served as the reference control.

After treatment, cells were detached using trypsin-EDTA, collected by centrifugation at 1500 rpm for 5 min, and washed twice with phosphate-buffered saline (PBS). The cell pellet was resuspended in 100 µL of PBS. A dual-staining dye working solution was prepared by mixing 10 µL of AO (10 mg/mL) and 10 µL of PI (1 mg/mL). A 10 µL aliquot of the cell suspension was mixed with the dye solution, and the mixture was immediately placed on a glass slide. Fluorescent images were captured using a fluorescence microscope (Nikon, Tokyo, Japan) within 30 min of staining. Viable cells (green nuclei), early apoptotic cells (bright green condensed chromatin), late apoptotic cells (orange-red nuclei with chromatin condensation), and necrotic cells (uniformly red nuclei) were distinguished based on their fluorescence.

4.7. Cell Cycle Analysis by Flow Cytometry

Cell cycle distribution was analyzed using flow cytometry. HepG2 cells were seeded and treated for 48 h with the IC₂₀ concentration of the respective Mg-doped CuO NPs or Undoped CuO NPs (as specified in Table 1). The use of the IC₂₀ concentration enables the detection of cell cycle perturbations within a treatment-surviving population. After treatment, cells were harvested, washed with PBS, and fixed in 70% ice-cold ethanol for 3 h at −20 °C. The fixed cells were then washed with PBS. Finally, the cells were stained with propidium iodide (50 µg/mL) for 30 min in the dark. The DNA content of the cells was analyzed using a flow cytometer (BD Biosciences, Franklin Lakes, NJ, USA). A minimum of 5000 events were acquired per sample, and the cell cycle phase distribution (G0/G1, S, and G2/M) was determined using FlowJo software (version 10.7.2, BD Biosciences).

4.8. Statistical Analysis

All experiments were performed in at least three independent biological replicates (n = 3), defined as experiments conducted on separate days with freshly prepared nanoparticles and new cell passages. Data are presented as the mean ± standard deviation (SD).

For all analyses involving comparisons across more than two experimental groups, statistical significance was assessed using one-way Analysis of Variance (ANOVA). Upon obtaining a significant ANOVA result, differences between individual group means were further analyzed using Duncan’s Multiple Range Test (DMRT) as a post hoc test.

All statistical comparisons were performed independently for each cell type (i.e., HepG2 cells and normal fibroblasts were analyzed separately). A p-value of less than 0.05 was considered statistically significant. In graphical representations of data involving multiple treatments, different lowercase letters above bars indicate statistically significant differences between groups within the same cell type (p < 0.05), as determined by ANOVA followed by DMRT. All statistical analyses were performed using the agricolae package in R software (version 2026.01.0; RStudio, Boston, MA, USA).

4.9. Quantitative Real-Time PCR (qRT-PCR) Analysis

Total RNA was isolated from HepG2 cells using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. Cells were treated for 48 h with the same IC₂₀ concentrations used for mechanistic studies (as detailed in Table 1): 41.14 µg/mL for undoped CuO NPs, 16.13 µg/mL for 1% Mg-doped CuO NPs, 2.78 µg/mL for 3% Mg-doped CuO NPs, and 11.87 µg/mL for 5% Mg-doped CuO NPs. Untreated cells served as the control. Genomic DNA contamination was removed using the ReverTra Ace qPCR RT Master Mix with gDNA Remover (TOYOBO, Osaka, Japan). Complementary DNA (cDNA) synthesis was performed using the ReverTra Ace qPCR RT Master Mix in a total reaction volume of 10 µL.

The resulting cDNA was used as a template for quantitative real-time PCR (RT-qPCR) analysis. RT-qPCR was carried out using iTaq™ Universal SYBR^® Green Supermix (Bio-Rad Laboratories, Hercules, CA, USA) on a QuantStudio 5 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). The expression of target genes (Bax, p53, Caspase-7, and Caspase-9) was quantified using specific primer pairs, with GAPDH serving as the internal reference gene for normalization (primer sequences listed in

Table 2. Specific primer sequences used for the qRT-PCR analysis of 4 apoptosis-related genes.

Primer Name	Sequence (5′ → 3′)
P53 Forward	CTTGCAATAGGTGTGCGTCAGA
P53 Reverse	GGAGCCCCGGGACAAA
Caspase7 Forward	CCAATAAAGGATTTGACAGCC
Caspase7 Reverse	GCATCTGTGTCATTGATGGG
Caspase9 Forward	CGAACTAACAGGCAAGCAGC
Caspase9 Reverse	ACCTCACCAAATCCTCCAGAAC
Bax Forward	CCTGTGCACCAAGGTGCCGGAACT
Bax Reverse	CCACCCTGGTCTTGGATCCAGCCC

). Amplification was performed under the following conditions: initial denaturation at 95 °C for 30 s, followed by 40 cycles of denaturation at 95 °C for 5 s and annealing/extension at 60 °C for 30 s, with fluorescence acquisition at the end of each cycle. Any undetermined quantification cycle (Cq) values were assigned a Cq value of 40 for calculation purposes. Relative gene expression levels were calculated using the 2^−ΔΔCq method. Data are presented as mean fold change relative to the untreated control, derived from three independent biological replicates (n = 3).

5. Conclusions

In conclusion, this study establishes Mg doping as a highly effective strategy for engineering advanced CuO-based nanotherapeutics against liver cancer. Comprehensive characterization, including TEM analysis and elemental mapping, confirmed successful Mg incorporation into the CuO lattice and a doping-concentration-dependent reduction in particle size. The 3% Mg-doped CuO formulation emerges as the lead candidate due to these optimal structural properties, its potent and selective cytotoxicity—robustly validated across 24, 48, and 72 h exposures—and its dual mechanistic action. It halts cancer proliferation by inducing G2/M phase arrest and triggers programmed cell death via apoptosis, a conclusion strongly supported by new qRT-PCR evidence showing a dramatic ~99-fold upregulation of the executioner caspase-7. This selective cytotoxicity stems from a confluence of factors where the inherent metabolic vulnerabilities of cancer cells are exploited; Mg-doping enhances the pro-oxidant efficacy of CuO, while differential cellular uptake likely delivers the lethal payload more efficiently to malignant cells. Notably, the time-dependent cytotoxicity profile, indicated by a lower IC₅₀ at 48 h compared to 72 h, underscores an acute initial action followed by adaptive cellular responses. These integrated findings highlight the promise of 3% Mg-doped CuO NPs as a targeted, efficient, and mechanistically defined nanomaterial for cancer therapy.