Loss of TDP-43 Drives Innate Immune Activation Through Relish in Drosophila
Abstract
1. Introduction
2. Results
2.1. Differential Gene Expression Analysis Identifies a Common Mutant Core and a Transcriptional Rescue Signature
2.2. Functional Characterization of the Common Mutant Transcriptional Core
2.3. Rescue Selectively Normalizes Toll/Imd–Relish Signaling
2.4. relish and Downstream AMPs Are Induced in tbph Mutants and Reverted upon TBPH Re-Expression
2.5. Genetic and Biochemical Evidence Linking TBPH Dysfunction to Relish-Dependent Immune Activation and Locomotor Impairment
3. Discussion
3.1. TBPH Restrains Relish-Dependent Innate Immune Signaling
3.2. TDP-43, NF-κB, and Innate Immunity in Neurodegeneration
4. Materials and Methods
4.1. Microarray Processing and Normalization
4.2. Probe Annotation and Gene-Level Summarization
4.3. Differential Expression Analysis
4.4. Definition of Shared and Rescued Gene Sets
4.5. Functional Enrichment Analysis
4.6. Pathway Visualization
4.7. Heatmap Visualization
4.8. Statistical Environment
4.9. Fly Strains and Maintenance
4.10. Feeding of Adult Flies with RU486
4.11. Climbing Assay
4.12. RNA Extraction and cDNA Synthesis
4.13. Quantitative Real-Time PCR (qRT-PCR)
| TARGET | SPECIES | FORWARD (5′–3′) | REVERSE (5′–3′) | TMEL AMPLICON |
| relish | D. mel | GGCATCATACACACCGCCAAGAAG | GTAGCTGTTTGTGGGACAACTCGC | 83 °C |
| syx1a | D. mel | TGTTCACGCAGGGCATCATC | GCCGTCTGCACATAGTCCATAG | 87 °C |
| rpl11 | D. mel | CCATCGGTATCTATGGTCTGGA | CATCGTATTTCTGCTGGAACCA | 86 °C |
| metchnikowin | D. mel | CATCAATCAATTCCCGCCACCGAG | AAATGGGTCCCTGGTGACGATGAG | 82 °C |
| attacin c | D. mel | CTGCACTGGACTACTCCCACATCA | CGATCCTGCGACTGCCAAAGATTG | 83 °C |
| drosomycin | D. mel | AGTACTTGTTCGCCCTCTTCGCTG | CCTTGTATCTTCCGGACAGGCAGT | 82 °C |
| rpl32 | D. mel | AAGCGGCGACGCACTCTGTT | GCCCAGCATACAGGCCCAAG | 84.5 °C |
4.14. RNA Immunoprecipitation
4.15. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Hardiman, O.; Al-Chalabi, A.; Chio, A.; Corr, E.M.; Logroscino, G.; Robberecht, W.; Shaw, P.J.; Simmons, Z.; van den Berg, L.H. Amyotrophic Lateral Sclerosis. Nat. Rev. Dis. Primers 2017, 3, 17071, Erratum in Nat. Rev. Dis. Primers 2017, 3, 17085. https://doi.org/10.1038/nrdp.2017.85. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Taylor, J.P.; Brown, R.H.; Cleveland, D.W. Decoding ALS: From Genes to Mechanism. Nature 2016, 539, 197–206. [Google Scholar] [CrossRef] [Scilit]
- Arai, T.; Hasegawa, M.; Akiyama, H.; Ikeda, K.; Nonaka, T.; Mori, H.; Mann, D.; Tsuchiya, K.; Yoshida, M.; Hashizume, Y.; et al. TDP-43 Is a Component of Ubiquitin-Positive Tau-Negative Inclusions in Frontotemporal Lobar Degeneration and Amyotrophic Lateral Sclerosis. Biochem. Biophys. Res. Commun. 2006, 351, 602–611. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Neumann, M.; Sampathu, D.M.; Kwong, L.K.; Truax, A.C.; Micsenyi, M.C.; Chou, T.T.; Bruce, J.; Schuck, T.; Grossman, M.; Clark, C.M.; et al. Ubiquitinated TDP-43 in Frontotemporal Lobar Degeneration and Amyotrophic Lateral Sclerosis. Science 2006, 314, 130–133. [Google Scholar] [CrossRef] [Scilit]
- Sreedharan, J.; Blair, I.P.; Tripathi, V.B.; Hu, X.; Vance, C.; Rogelj, B.; Ackerley, S.; Durnall, J.C.; Williams, K.L.; Buratti, E.; et al. TDP-43 Mutations in Familial and Sporadic Amyotrophic Lateral Sclerosis. Science 2008, 319, 1668–1672. [Google Scholar] [CrossRef] [Scilit]
- Ling, S.-C.; Polymenidou, M.; Cleveland, D.W. Converging Mechanisms in ALS and FTD: Disrupted RNA and Protein Homeostasis. Neuron 2013, 79, 416–438. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tollervey, J.R.; Curk, T.; Rogelj, B.; Briese, M.; Cereda, M.; Kayikci, M.; König, J.; Hortobágyi, T.; Nishimura, A.L.; Zupunski, V.; et al. Characterizing the RNA Targets and Position-Dependent Splicing Regulation by TDP-43. Nat. Neurosci. 2011, 14, 452–458. [Google Scholar] [CrossRef] [Scilit]
- Brown, A.-L.; Wilkins, O.G.; Keuss, M.J.; Kargbo-Hill, S.E.; Zanovello, M.; Lee, W.C.; Bampton, A.; Lee, F.C.Y.; Masino, L.; Qi, Y.A.; et al. TDP-43 Loss and ALS-Risk SNPs Drive Mis-Splicing and Depletion of UNC13A. Nature 2022, 603, 131–137, Erratum in Nature 2024, 631, E7. [Google Scholar] [CrossRef] [Scilit]
- Klim, J.R.; Williams, L.A.; Limone, F.; Guerra San Juan, I.; Davis-Dusenbery, B.N.; Mordes, D.A.; Burberry, A.; Steinbaugh, M.J.; Gamage, K.K.; Kirchner, R.; et al. ALS-Implicated Protein TDP-43 Sustains Levels of STMN2, a Mediator of Motor Neuron Growth and Repair. Nat. Neurosci. 2019, 22, 167–179. [Google Scholar] [CrossRef] [Scilit]
- Ma, X.R.; Prudencio, M.; Koike, Y.; Vatsavayai, S.C.; Kim, G.; Harbinski, F.; Briner, A.; Rodriguez, C.M.; Guo, C.; Akiyama, T.; et al. TDP-43 Represses Cryptic Exon Inclusion in the FTD–ALS Gene UNC13A. Nature 2022, 603, 124–130. [Google Scholar] [CrossRef] [Scilit]
- Philips, T.; Rothstein, J.D. Glial Cells in Amyotrophic Lateral Sclerosis. Exp. Neurol. 2014, 262, 111–120. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Thonhoff, J.R.; Simpson, E.P.; Appel, S.H. Neuroinflammatory Mechanisms in Amyotrophic Lateral Sclerosis Pathogenesis. Curr. Opin. Neurol. 2018, 31, 635–639. [Google Scholar] [CrossRef] [Scilit]
- Yu, C.-H.; Davidson, S.; Harapas, C.R.; Hilton, J.B.; Mlodzianoski, M.J.; Laohamonthonkul, P.; Louis, C.; Low, R.R.J.; Moecking, J.; De Nardo, D.; et al. TDP-43 Triggers Mitochondrial DNA Release via mPTP to Activate cGAS/STING in ALS. Cell 2020, 183, 636–649.e18. [Google Scholar] [CrossRef] [Scilit]
- LaRocca, T.J.; Mariani, A.; Watkins, L.R.; Link, C.D. TDP-43 Knockdown Causes Innate Immune Activation via Protein Kinase R in Astrocytes. Neurobiol. Dis. 2019, 132, 104514. [Google Scholar] [CrossRef] [Scilit]
- Zhao, W.; Beers, D.R.; Bell, S.; Wang, J.; Wen, S.; Baloh, R.H.; Appel, S.H. TDP-43 Activates Microglia through NF-κB and NLRP3 Inflammasome. Exp. Neurol. 2015, 273, 24–35. [Google Scholar] [CrossRef] [Scilit]
- Frakes, A.E.; Ferraiuolo, L.; Haidet-Phillips, A.M.; Schmelzer, L.; Braun, L.; Miranda, C.J.; Ladner, K.J.; Bevan, A.K.; Foust, K.D.; Godbout, J.P.; et al. Microglia Induce Motor Neuron Death via the Classical NF-κB Pathway in Amyotrophic Lateral Sclerosis. Neuron 2014, 81, 1009–1023. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Heneka, M.T.; Carson, M.J.; El Khoury, J.; Landreth, G.E.; Brosseron, F.; Feinstein, D.L.; Jacobs, A.H.; Wyss-Coray, T.; Vitorica, J.; Ransohoff, R.M.; et al. Neuroinflammation in Alzheimer’s Disease. Lancet Neurol. 2015, 14, 388–405. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cragnaz, L.; Klima, R.; De Conti, L.; Romano, G.; Feiguin, F.; Buratti, E.; Baralle, M.; Baralle, F.E. An Age-Related Reduction of Brain TBPH/TDP-43 Levels Precedes the Onset of Locomotion Defects in a Drosophila ALS Model. Neuroscience 2015, 311, 415–421. [Google Scholar] [CrossRef] [Scilit]
- Langellotti, S.; Romano, V.; Romano, G.; Klima, R.; Feiguin, F.; Cragnaz, L.; Romano, M.; Baralle, F.E. A Novel Drosophila Model of TDP-43 Proteinopathies: N-Terminal Sequences Combined with the Q/N Domain Induce Protein Functional Loss and Locomotion Defects. Dis. Model. Mech. 2016, 9, 659–669. [Google Scholar] [CrossRef] [Scilit]
- Lemaitre, B.; Hoffmann, J. The Host Defense of Drosophila Melanogaster. Annu. Rev. Immunol. 2007, 25, 697–743. [Google Scholar] [CrossRef] [Scilit]
- Myllymäki, H.; Valanne, S.; Rämet, M. The Drosophila Imd Signaling Pathway. J. Immunol. 2014, 192, 3455–3462. [Google Scholar] [CrossRef] [Scilit]
- Zhan, L.; Xie, Q.; Tibbetts, R.S. Opposing Roles of P38 and JNK in a Drosophila Model of TDP-43 Proteinopathy Reveal Oxidative Stress and Innate Immunity as Pathogenic Components of Neurodegeneration. Hum. Mol. Genet. 2015, 24, 757–772. [Google Scholar] [CrossRef] [Scilit]
- Yue, W.; Deng, X.; Wang, Z.; Jiang, M.; Hu, R.; Duan, Y.; Wang, Q.; Cui, J.; Fang, Y. Inhibition of the MEK/ERK Pathway Suppresses Immune Overactivation and Mitigates TDP-43 Toxicity in a Drosophila Model of ALS. Immun. Ageing A 2023, 20, 27. [Google Scholar] [CrossRef] [Scilit]
- Feiguin, F.; Godena, V.K.; Romano, G.; D’Ambrogio, A.; Klima, R.; Baralle, F.E. Depletion of TDP-43 Affects Drosophila Motoneurons Terminal Synapsis and Locomotive Behavior. FEBS Lett. 2009, 583, 1586–1592. [Google Scholar] [CrossRef] [Scilit]
- Gbadamosi, M.; Romano, G.; Simbula, M.; Canarutto, G.; Ottoboni, L.; Corti, S.; Feiguin, F. TDP-43 Regulates Rab4 Levels to Support Synaptic Vesicle Recycling and Neuromuscular Connectivity in Drosophila and Human ALS Models. Int. J. Mol. Sci. 2025, 26, 11030. [Google Scholar] [CrossRef] [Scilit]
- Godena, V.K.; Romano, G.; Romano, M.; Appocher, C.; Klima, R.; Buratti, E.; Baralle, F.E.; Feiguin, F. TDP-43 Regulates Drosophila Neuromuscular Junctions Growth by Modulating Futsch/MAP1B Levels and Synaptic Microtubules Organization. PLoS ONE 2011, 6, e17808. [Google Scholar] [CrossRef] [Scilit]
- Marzullo, M.; Romano, G.; Pellacani, C.; Riccardi, F.; Ciapponi, L.; Feiguin, F. Su(Var)3-9 Mediates Age-Dependent Increase in H3K9 Methylation on TDP-43 Promoter Triggering Neurodegeneration. Cell Death Discov. 2023, 9, 357. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Romano, G.; Holodkov, N.; Klima, R.; Feiguin, F. TDP-43 Regulates GAD1 mRNA Splicing and GABA Signaling in Drosophila CNS. Sci. Rep. 2021, 11, 18761. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Romano, G.; Klima, R.; Feiguin, F. TDP-43 Prevents Retrotransposon Activation in the Drosophila Motor System through Regulation of Dicer-2 Activity. BMC Biol. 2020, 18, 82. [Google Scholar] [CrossRef] [Scilit]
- Romano, G.; Holodkov, N.; Klima, R.; Grilli, F.; Guarnaccia, C.; Nizzardo, M.; Rizzo, F.; Garcia, R.; Feiguin, F. Downregulation of Glutamic Acid Decarboxylase in Drosophila TDP-43-Null Brains Provokes Paralysis by Affecting the Organization of the Neuromuscular Synapses. Sci. Rep. 2018, 8, 1809. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Romano, G.; Appocher, C.; Scorzeto, M.; Klima, R.; Baralle, F.E.; Megighian, A.; Feiguin, F. Glial TDP-43 Regulates Axon Wrapping, GluRIIA Clustering and Fly Motility by Autonomous and Non-Autonomous Mechanisms. Hum. Mol. Genet. 2015, 24, 6134–6145. [Google Scholar] [CrossRef] [Scilit]
- Romano, G.; Klima, R.; Buratti, E.; Verstreken, P.; Baralle, F.E.; Feiguin, F. Chronological Requirements of TDP-43 Function in Synaptic Organization and Locomotive Control. Neurobiol. Dis. 2014, 71, 95–109. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Strah, N.; Romano, G.; Introna, C.; Klima, R.; Marzullo, M.; Ciapponi, L.; Megighian, A.; Nizzardo, M.; Feiguin, F. TDP-43 Promotes the Formation of Neuromuscular Synapses through the Regulation of Disc-Large Expression in Drosophila Skeletal Muscles. BMC Biol. 2020, 18, 34. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- McGuire, S.E.; Mao, Z.; Davis, R.L. Spatiotemporal Gene Expression Targeting with the TARGET and Gene-Switch Systems in Drosophila. Sci. STKE Signal Transduct. Knowl. Environ. 2004, 2004, pl6. [Google Scholar] [CrossRef] [Scilit]
- Nicholson, L.; Singh, G.K.; Osterwalder, T.; Roman, G.W.; Davis, R.L.; Keshishian, H. Spatial and Temporal Control of Gene Expression in Drosophila Using the Inducible GeneSwitch GAL4 System. I. Screen for Larval Nervous System Drivers. Genetics 2008, 178, 215–234. [Google Scholar] [CrossRef] [Scilit]
- Hedengren, M.; BengtÅsling; Dushay, M.S.; Ando, I.; Ekengren, S.; Wihlborg, M.; Hultmark, D. Relish, a Central Factor in the Control of Humoral but Not Cellular Immunity in Drosophila. Mol. Cell 1999, 4, 827–837. [Google Scholar] [CrossRef] [Scilit]
- Fedele, G.; Loh, S.H.Y.; Celardo, I.; Leal, N.S.; Lehmann, S.; Costa, A.C.; Martins, L.M. Suppression of Intestinal Dysfunction in a Drosophila Model of Parkinson’s Disease Is Neuroprotective. Nat. Aging 2022, 2, 317–331. [Google Scholar] [CrossRef] [Scilit]
- Diaper, D.C.; Adachi, Y.; Sutcliffe, B.; Humphrey, D.M.; Elliott, C.J.H.; Stepto, A.; Ludlow, Z.N.; Vanden Broeck, L.; Callaerts, P.; Dermaut, B.; et al. Loss and Gain of Drosophila TDP-43 Impair Synaptic Efficacy and Motor Control Leading to Age-Related Neurodegeneration by Loss-of-Function Phenotypes. Hum. Mol. Genet. 2013, 22, 1539–1557. [Google Scholar] [CrossRef] [Scilit]
- Kabashi, E.; Lin, L.; Tradewell, M.L.; Dion, P.A.; Bercier, V.; Bourgouin, P.; Rochefort, D.; Bel Hadj, S.; Durham, H.D.; Vande Velde, C.; et al. Gain and Loss of Function of ALS-Related Mutations of TARDBP (TDP-43) Cause Motor Deficits in Vivo. Hum. Mol. Genet. 2010, 19, 671–683. [Google Scholar] [CrossRef] [Scilit]
- Kraemer, B.C.; Schuck, T.; Wheeler, J.M.; Robinson, L.C.; Trojanowski, J.Q.; Lee, V.M.Y.; Schellenberg, G.D. Loss of Murine TDP-43 Disrupts Motor Function and Plays an Essential Role in Embryogenesis. Acta Neuropathol. 2010, 119, 409–419. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pacetti, M.; De Conti, L.; Marasco, L.E.; Romano, M.; Rashid, M.M.; Nubiè, M.; Baralle, F.E.; Baralle, M. Physiological Tissue-Specific and Age-Related Reduction of Mouse TDP-43 Levels Is Regulated by Epigenetic Modifications. Dis. Model. Mech. 2022, 15, dmm049032. [Google Scholar] [CrossRef] [Scilit]
- Vaccaro, A.; Tauffenberger, A.; Ash, P.E.A.; Carlomagno, Y.; Petrucelli, L.; Parker, J.A. TDP-1/TDP-43 Regulates Stress Signaling and Age-Dependent Proteotoxicity in Caenorhabditis Elegans. PLoS Genet. 2012, 8, e1002806. [Google Scholar] [CrossRef] [Scilit]
- Wu, L.-S.; Cheng, W.-C.; Hou, S.-C.; Yan, Y.-T.; Jiang, S.-T.; Shen, C.-K.J. TDP-43, a Neuro-Pathosignature Factor, Is Essential for Early Mouse Embryogenesis. Genesis 2010, 48, 56–62. [Google Scholar] [CrossRef] [Scilit]
- Källstig, E.; McCabe, B.D.; Schneider, B.L. The Links between ALS and NF-κB. Int. J. Mol. Sci. 2021, 22, 3875. [Google Scholar] [CrossRef] [Scilit]
- Ealy, A.; Serapiglia, A.M.; Panicker, N. Sterile Innate Immune Mechanisms in Neurodegenerative Diseases. J. Biol. Chem. 2025, 302, 111039. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Krupp, S.; Hubbard, I.; Tam, O.; Hammell, G.M.; Dubnau, J. TDP-43 Pathology in Drosophila Induces Glial-Cell Type Specific Toxicity That Can Be Ameliorated by Knock-down of SF2/SRSF1. PLoS Genet. 2023, 19, e1010973. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, S.; Kim, S.; Kang, H.-Y.; Lim, H.R.; Kwon, Y.; Jo, M.; Jeon, Y.-M.; Kim, S.R.; Kim, K.; Ha, C.M.; et al. The Overexpression of TDP-43 in Astrocytes Causes Neurodegeneration via a PTP1B-Mediated Inflammatory Response. J. Neuroinflamm. 2020, 17, 299. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cao, M.; Yi, L.; Xu, Y.; Tian, Y.; Li, Z.; Bi, Y.; Guo, M.; Li, Y.; Liu, Y.; Xu, X.; et al. Inhibiting NF-κB Inducing Kinase Improved the Motor Performance of ALS Animal Model. Brain Res. 2024, 1843, 149124. [Google Scholar] [CrossRef] [Scilit]
- Dutta, K.; Thammisetty, S.S.; Boutej, H.; Bareil, C.; Julien, J.-P. Mitigation of ALS Pathology by Neuron-Specific Inhibition of Nuclear Factor Kappa B Signaling. J. Neurosci. 2020, 40, 5137–5154. [Google Scholar] [CrossRef] [Scilit]
- Mishra, P.S.; Phaneuf, D.; Boutej, H.; Picher-Martel, V.; Dupre, N.; Kriz, J.; Julien, J.-P. Inhibition of NF-κB with an Analog of Withaferin-A Restores TDP-43 Homeostasis and Proteome Profiles in a Model of Sporadic ALS. Biomedicines 2024, 12, 1017. [Google Scholar] [CrossRef] [Scilit]
- Huber, W.; Carey, V.J.; Gentleman, R.; Anders, S.; Carlson, M.; Carvalho, B.S.; Bravo, H.C.; Davis, S.; Gatto, L.; Girke, T.; et al. Orchestrating High-Throughput Genomic Analysis with Bioconductor. Nat. Methods 2015, 12, 115–121. [Google Scholar] [CrossRef] [Scilit]
- Irizarry, R.A.; Hobbs, B.; Collin, F.; Beazer-Barclay, Y.D.; Antonellis, K.J.; Scherf, U.; Speed, T.P. Exploration, Normalization, and Summaries of High Density Oligonucleotide Array Probe Level Data. Biostatistics 2003, 4, 249–264. [Google Scholar] [CrossRef] [Scilit]
- Ritchie, M.E.; Phipson, B.; Wu, D.; Hu, Y.; Law, C.W.; Shi, W.; Smyth, G.K. Limma Powers Differential Expression Analyses for RNA-Sequencing and Microarray Studies. Nucleic Acids Res. 2015, 43, e47. [Google Scholar] [CrossRef] [Scilit]
- Wu, T.; Hu, E.; Xu, S.; Chen, M.; Guo, P.; Dai, Z.; Feng, T.; Zhou, L.; Tang, W.; Zhan, L.; et al. clusterProfiler 4.0: A Universal Enrichment Tool for Interpreting Omics Data. Innovation 2021, 2, 100141. [Google Scholar] [CrossRef] [Scilit]
- Yu, G.; Wang, L.-G.; Han, Y.; He, Q.-Y. clusterProfiler: An R Package for Comparing Biological Themes among Gene Clusters. Omics J. Integr. Biol. 2012, 16, 284–287. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kanehisa, M.; Goto, S. KEGG: Kyoto Encyclopedia of Genes and Genomes. Nucleic Acids Res. 2000, 28, 27–30. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Luo, W.; Brouwer, C. Pathview: An R/Bioconductor Package for Pathway-Based Data Integration and Visualization. Bioinformatics 2013, 29, 1830–1831. [Google Scholar] [CrossRef] [Scilit]
- Petersen, A.J.; Rimkus, S.A.; Wassarman, D.A. ATM Kinase Inhibition in Glial Cells Activates the Innate Immune Response and Causes Neurodegeneration in Drosophila. Proc. Natl. Acad. Sci. USA 2012, 109, E656–E664. [Google Scholar] [CrossRef] [Scilit]
- Ling, D.; Salvaterra, P.M. Robust RT-qPCR Data Normalization: Validation and Selection of Internal Reference Genes during Post-Experimental Data Analysis. PLoS ONE 2011, 6, e17762. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Romano, G.; Klima, R.; Feiguin, F. Immunoprecipitation for Protein-Protein Interactions and for RNA Enrichment in Drosophila Melanogaster. BIO-Protocol 2021, 11, e4250. [Google Scholar] [CrossRef] [Scilit]






Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Romano, G.; Klima, R.; Feiguin, F. Loss of TDP-43 Drives Innate Immune Activation Through Relish in Drosophila. Int. J. Mol. Sci. 2026, 27, 5359. https://doi.org/10.3390/ijms27125359
Romano G, Klima R, Feiguin F. Loss of TDP-43 Drives Innate Immune Activation Through Relish in Drosophila. International Journal of Molecular Sciences. 2026; 27(12):5359. https://doi.org/10.3390/ijms27125359
Chicago/Turabian StyleRomano, Giulia, Raffaella Klima, and Fabian Feiguin. 2026. "Loss of TDP-43 Drives Innate Immune Activation Through Relish in Drosophila" International Journal of Molecular Sciences 27, no. 12: 5359. https://doi.org/10.3390/ijms27125359
APA StyleRomano, G., Klima, R., & Feiguin, F. (2026). Loss of TDP-43 Drives Innate Immune Activation Through Relish in Drosophila. International Journal of Molecular Sciences, 27(12), 5359. https://doi.org/10.3390/ijms27125359

