NK Cells Modulate Dendritic Cell (DC) Signaling Pathways and DC Recruitment in Chlamydial Infection
Abstract
1. Introduction
2. Results
2.1. NK Cell Depletion Exacerbates Chlamydial Infection in the Lung
2.2. Transcriptional Alterations in DCs of NK-Depleted Mice During Chlamydial Infection
2.3. NK-Depletion Reduces DC Recruitment and Alters Key Immune Pathways on DCs in Chlamydial Infection
2.4. NK Cells Enhance CCR5 Expression on the Surface of DCs and the DC Migration Depends on CCL3/5-CCR5 Interaction During Chlamydial Infection
2.5. NK Cell-Produced IFN-γ Promotes CCL3/5-CCR5-Dependent DC Recruitment During Chlamydia Lung Infection
3. Discussion
4. Materials and Methods
4.1. Animals
4.2. Chlamydia Infection Mice Model
4.3. NK Depletion Mice Model
4.4. Isolation of Pulmonary Cells
4.5. Chemokine Measurements
4.6. Chemotaxis Assay
4.7. Flow Cytometry
4.8. Microarray
4.9. Quantitative RT-PCR
4.10. Statistica Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Elwell, C.; Mirrashidi, K.; Engel, J. Chlamydia cell biology and pathogenesis. Nat. Rev. Microbiol. 2016, 14, 385–400. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Brunham, R.C.; Rey-Ladino, J. Immunology of Chlamydia infection: Implications for a Chlamydia trachomatis vaccine. Nat. Rev. Immunol. 2005, 5, 149–161. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, D.; Yang, X.; Lu, H.; Zhong, G.; Brunham, R.C. Immunity to Chlamydia trachomatis mouse pneumonitis induced by vaccination with live organisms correlates with early granulocyte-macrophage colony-stimulating factor and interleukin-12 production and with dendritic cell-like maturation. Infect. Immun. 1999, 67, 1606–1613. [Google Scholar] [CrossRef] [PubMed]
- Sherrid, A.M.; Hybiske, K. Chlamydia trachomatis Cellular Exit Alters Interactions with Host Dendritic Cells. Infect. Immun. 2017, 85, e00046-17. [Google Scholar] [CrossRef] [Scilit]
- Zhang, N.; Wang, Z.; Tang, X.; Wang, H.; Li, H.; Huang, H.; Bai, H.; Yang, X. Type 1 T-cell responses in chlamydial lung infections are associated with local MIP-1alpha response. Cell Mol. Immunol. 2010, 7, 355–360. [Google Scholar] [CrossRef] [Scilit]
- Wang, X.; Wu, H.; Fang, C.; Li, Z. Insights into innate immune cell evasion by Chlamydia trachomatis. Front. Immunol. 2024, 15, 1289644. [Google Scholar] [CrossRef] [Scilit]
- Hook, C.E.; Telyatnikova, N.; Goodall, J.C.; Braud, V.M.; Carmichael, A.J.; Wills, M.R.; Gaston, J.S. Effects of Chlamydia trachomatis infection on the expression of natural killer (NK) cell ligands and susceptibility to NK cell lysis. Clin. Exp. Immunol. 2004, 138, 54–60. [Google Scholar] [CrossRef] [Scilit]
- Shekhar, S.; Peng, Y.; Gao, X.; Joyee, A.G.; Wang, S.; Bai, H.; Zhao, L.; Yang, J.; Yang, X. NK cells modulate the lung dendritic cell-mediated Th1/Th17 immunity during intracellular bacterial infection. Eur. J. Immunol. 2015, 45, 2810–2820. [Google Scholar] [CrossRef] [Scilit]
- Wang, H.; Li, J.; Dong, X.; Zhou, X.; Zhao, L.; Wang, X.; Rashu, R.; Zhao, W.; Yang, X. NK Cells Contribute to Protective Memory T Cell Mediated Immunity to Chlamydia muridarum Infection. Front. Cell Infect. Microbiol. 2020, 10, 296. [Google Scholar] [CrossRef] [Scilit]
- Walzer, T.; Dalod, M.; Robbins, S.H.; Zitvogel, L.; Vivier, E. Natural-killer cells and dendritic cells: “l’union fait la force”. Blood 2005, 106, 2252–2258. [Google Scholar] [CrossRef] [Scilit]
- Steinman, R.M.; Hemmi, H. Dendritic cells: Translating innate to adaptive immunity. Curr. Top. Microbiol. Immunol. 2006, 311, 17–58. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cooper, M.A.; Fehniger, T.A.; Fuchs, A.; Colonna, M.; Caligiuri, M.A. NK cell and DC interactions. Trends Immunol. 2004, 25, 47–52. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Thomas, R.; Yang, X. NK-DC Crosstalk in Immunity to Microbial Infection. J. Immunol. Res. 2016, 2016, 6374379. [Google Scholar] [CrossRef] [Scilit]
- Morandi, B.; Mortara, L.; Chiossone, L.; Accolla, R.S.; Mingari, M.C.; Moretta, L.; Moretta, A.; Ferlazzo, G. Dendritic cell editing by activated natural killer cells results in a more protective cancer-specific immune response. PLoS ONE 2012, 7, e39170. [Google Scholar] [CrossRef] [Scilit]
- Chong, W.P.; van Panhuys, N.; Chen, J.; Silver, P.B.; Jittayasothorn, Y.; Mattapallil, M.J.; Germain, R.N.; Caspi, R.R. NK-DC crosstalk controls the autopathogenic Th17 response through an innate IFN-gamma-IL-27 axis. J. Exp. Med. 2015, 212, 1739–1752. [Google Scholar] [CrossRef] [Scilit]
- Mavilio, D.; Lombardo, G.; Kinter, A.; Fogli, M.; La Sala, A.; Ortolano, S.; Farschi, A.; Follmann, D.; Gregg, R.; Kovacs, C.; et al. Characterization of the defective interaction between a subset of natural killer cells and dendritic cells in HIV-1 infection. J. Exp. Med. 2006, 203, 2339–2350. [Google Scholar] [CrossRef] [Scilit]
- Robbins, S.H.; Bessou, G.; Cornillon, A.; Zucchini, N.; Rupp, B.; Ruzsics, Z.; Sacher, T.; Tomasello, E.; Vivier, E.; Koszinowski, U.H.; et al. Natural killer cells promote early CD8 T cell responses against cytomegalovirus. PLoS Pathog. 2007, 3, e123. [Google Scholar] [CrossRef] [Scilit]
- Ing, R.; Stevenson, M.M. Dendritic cell and NK cell reciprocal cross talk promotes gamma interferon-dependent immunity to blood-stage Plasmodium chabaudi AS infection in mice. Infect. Immun. 2009, 77, 770–782. [Google Scholar] [CrossRef] [Scilit]
- Radomski, N.; Karger, A.; Franzke, K.; Liebler-Tenorio, E.; Jahnke, R.; Matthiesen, S.; Knittler, M.R. Chlamydia psittaci-Infected Dendritic Cells Communicate with NK Cells via Exosomes To Activate Antibacterial Immunity. Infect. Immun. 2019, 88, e00541-19. [Google Scholar] [CrossRef] [Scilit]
- Jiao, L.; Gao, X.; Joyee, A.G.; Zhao, L.; Qiu, H.; Yang, M.; Fan, Y.; Wang, S.; Yang, X. NK cells promote type 1 T cell immunity through modulating the function of dendritic cells during intracellular bacterial infection. J. Immunol. 2011, 187, 401–411. [Google Scholar] [CrossRef] [Scilit]
- Gervassi, A.; Alderson, M.R.; Suchland, R.; Maisonneuve, J.F.; Grabstein, K.H.; Probst, P. Differential regulation of inflammatory cytokine secretion by human dendritic cells upon Chlamydia trachomatis infection. Infect. Immun. 2004, 72, 7231–7239. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shekhar, S.; Yang, X. Pulmonary CD103+ dendritic cells: Key regulators of immunity against infection. Cell Mol. Immunol. 2020, 17, 670–671. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Van Elssen, C.H.; Vanderlocht, J.; Frings, P.W.; Senden-Gijsbers, B.L.; Schnijderberg, M.C.; van Gelder, M.; Meek, B.; Libon, C.; Ferlazzo, G.; Germeraad, W.T.; et al. Klebsiella pneumoniae-triggered DC recruit human NK cells in a CCR5-dependent manner leading to increased CCL19-responsiveness and activation of NK cells. Eur. J. Immunol. 2010, 40, 3138–3149. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhao, L.; Wang, H.; Thomas, R.; Gao, X.; Bai, H.; Shekhar, S.; Wang, S.; Yang, J.; Zhao, W.; Yang, X. NK cells modulate T cell responses via interaction with dendritic cells in Chlamydophila pneumoniae infection. Cell Immunol. 2020, 353, 104132. [Google Scholar] [CrossRef] [Scilit]
- Xiang, W.; Yu, N.; Lei, A.; Li, X.; Tan, S.; Huang, L.; Zhou, Z. Insights Into Host Cell Cytokines in Chlamydia Infection. Front. Immunol. 2021, 12, 639834. [Google Scholar] [CrossRef] [Scilit]
- Radomski, N.; Franzke, K.; Matthiesen, S.; Karger, A.; Knittler, M.R. NK Cell-Mediated Processing of Chlamydia psittaci Drives Potent Anti-Bacterial Th1 Immunity. Sci. Rep. 2019, 9, 4799. [Google Scholar] [CrossRef] [Scilit]
- Hariharan, D.; Douglas, S.D.; Lee, B.; Lai, J.P.; Campbell, D.E.; Ho, W.Z. Interferon-gamma upregulates CCR5 expression in cord and adult blood mononuclear phagocytes. Blood 1999, 93, 1137–1144. [Google Scholar] [CrossRef] [Scilit]
- Varani, S.; Frascaroli, G.; Homman-Loudiyi, M.; Feld, S.; Landini, M.P.; Soderberg-Naucler, C. Human cytomegalovirus inhibits the migration of immature dendritic cells by down-regulating cell-surface CCR1 and CCR5. J. Leukoc. Biol. 2005, 77, 219–228. [Google Scholar] [CrossRef] [Scilit]
- Lederman, M.M.; Penn-Nicholson, A.; Cho, M.; Mosier, D. Biology of CCR5 and its role in HIV infection and treatment. JAMA 2006, 296, 815–826. [Google Scholar] [CrossRef] [Scilit]
- Sallusto, F.; Schaerli, P.; Loetscher, P.; Schaniel, C.; Lenig, D.; Mackay, C.R.; Qin, S.; Lanzavecchia, A. Rapid and coordinated switch in chemokine receptor expression during dendritic cell maturation. Eur. J. Immunol. 1998, 28, 2760–2769. [Google Scholar] [CrossRef] [Scilit]
- Sallusto, F.; Lanzavecchia, A. Understanding dendritic cell and T-lymphocyte traffic through the analysis of chemokine receptor expression. Immunol. Rev. 2000, 177, 134–140. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Andrews, D.M.; Andoniou, C.E.; Scalzo, A.A.; van Dommelen, S.L.; Wallace, M.E.; Smyth, M.J.; Degli-Esposti, M.A. Cross-talk between dendritic cells and natural killer cells in viral infection. Mol. Immunol. 2005, 42, 547–555. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Matyszak, M.K.; Young, J.L.; Gaston, J.S. Uptake and processing of Chlamydia trachomatis by human dendritic cells. Eur. J. Immunol. 2002, 32, 742–751. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mailliard, R.B.; Son, Y.I.; Redlinger, R.; Coates, P.T.; Giermasz, A.; Morel, P.A.; Storkus, W.J.; Kalinski, P. Dendritic cells mediate NK cell help for Th1 and CTL responses: Two-signal requirement for the induction of NK cell helper function. J. Immunol. 2003, 171, 2366–2373. [Google Scholar] [CrossRef] [Scilit]
- Perona-Wright, G.; Mohrs, K.; Szaba, F.M.; Kummer, L.W.; Madan, R.; Karp, C.L.; Johnson, L.L.; Smiley, S.T.; Mohrs, M. Systemic but not local infections elicit immunosuppressive IL-10 production by natural killer cells. Cell Host Microbe 2009, 6, 503–512. [Google Scholar] [CrossRef] [Scilit]
- Alter, G.; Kavanagh, D.; Rihn, S.; Luteijn, R.; Brooks, D.; Oldstone, M.; van Lunzen, J.; Altfeld, M. IL-10 induces aberrant deletion of dendritic cells by natural killer cells in the context of HIV infection. J. Clin. Investig. 2010, 120, 1905–1913. [Google Scholar] [CrossRef] [Scilit]
- Deguine, J.; Bousso, P. Dynamics of NK cell interactions in vivo. Immunol. Rev. 2013, 251, 154–159. [Google Scholar] [CrossRef] [Scilit]
- Mellman, I. Dendritic cells: Master regulators of the immune response. Cancer Immunol. Res. 2013, 1, 145–149. [Google Scholar] [CrossRef] [Scilit]
- Artavanis-Tsakonas, K.; Riley, E.M. Innate immune response to malaria: Rapid induction of IFN-gamma from human NK cells by live Plasmodium falciparum-infected erythrocytes. J. Immunol. 2002, 169, 2956–2963. [Google Scholar] [CrossRef] [Scilit]
- Ge, M.Q.; Ho, A.W.; Tang, Y.; Wong, K.H.; Chua, B.Y.; Gasser, S.; Kemeny, D.M. NK cells regulate CD8+ T cell priming and dendritic cell migration during influenza A infection by IFN-gamma and perforin-dependent mechanisms. J. Immunol. 2012, 189, 2099–2109. [Google Scholar] [CrossRef] [Scilit]
- Ferlazzo, G.; Morandi, B. Cross-Talks between Natural Killer Cells and Distinct Subsets of Dendritic Cells. Front. Immunol. 2014, 5, 159. [Google Scholar] [CrossRef] [Scilit]






| Gene | Forward | Reverse |
|---|---|---|
| Ccr7 | TGTACGAGTCGGTGTGTCTTC | GGTAGGTATCCGTCATGGTTTG |
| Ccr2 | ATCCACGGGCATACATACAACATC | CAAGGGCTCACCATCATGTAG |
| Ccr5 | TTTTCAAGGGTCAGTTCCGAC | GGAAAGGACATCATGTTACCCAC |
| Ccl3 | TTCTCTGTACCATGACACTGTGC | CGTGGAATCTTCTTCTCAGTGG |
| Ccl4 | TTCTCGTGTTTTCCTTACACCT | CTGTCTGGCCTTTTTGTGAG |
| Ccl5 | GCTGCTTTGCCTACCTCCTCC | TCGAGTGACAACAACAGGACTGC |
| Ifng | ATGAACGCTACACACTGCATC | CCATCCTTTTGCCAGTTCCTC |
| Stat1 | GGCACTCTGGAAGTTCAGTAT | CCATCCTTGTGTTCATCACTTGC |
| Jak1 | TGTGGAGTGGTGTTTTGCTTT | CTGCGCCCTTTACTCTCCTGTT |
| IL12rb2 | AGAGAATGCTCATTGGCACTTC | AACTGGGAATAATGTGAACAGCC |
| Tbx21 | AGCAAGGACGGGCAAGATGTT | GGGTGGACATATAAGCAGGGTTC |
| 18s | AGTAACGGCGAGTCAACTGCG | CTTTGAGGTGGAAGGACAGGGAG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, X.; Zhang, C.; Zhang, Y.; Wang, S.; Thomas, R.; Yang, X. NK Cells Modulate Dendritic Cell (DC) Signaling Pathways and DC Recruitment in Chlamydial Infection. Int. J. Mol. Sci. 2025, 26, 3769. https://doi.org/10.3390/ijms26083769
Wang X, Zhang C, Zhang Y, Wang S, Thomas R, Yang X. NK Cells Modulate Dendritic Cell (DC) Signaling Pathways and DC Recruitment in Chlamydial Infection. International Journal of Molecular Sciences. 2025; 26(8):3769. https://doi.org/10.3390/ijms26083769
Chicago/Turabian StyleWang, Xinting, Chunyan Zhang, Yongci Zhang, Shuhe Wang, Rony Thomas, and Xi Yang. 2025. "NK Cells Modulate Dendritic Cell (DC) Signaling Pathways and DC Recruitment in Chlamydial Infection" International Journal of Molecular Sciences 26, no. 8: 3769. https://doi.org/10.3390/ijms26083769
APA StyleWang, X., Zhang, C., Zhang, Y., Wang, S., Thomas, R., & Yang, X. (2025). NK Cells Modulate Dendritic Cell (DC) Signaling Pathways and DC Recruitment in Chlamydial Infection. International Journal of Molecular Sciences, 26(8), 3769. https://doi.org/10.3390/ijms26083769

