IL-17 Ligand and Receptor Family Members Are Differentially Expressed by Keratinocyte Subpopulations and Modulate Their Differentiation and Inflammatory Phenotype
Abstract
1. Introduction
2. Results
2.1. Evaluation of IL-17 Ligand and Receptor Family Members’ Expression in Keratinocyte Subpopulations
2.2. Evaluation of the Biological Response to IL-17A, IL-17F and IL-17A/F Treatment in Keratinocyte Sub-Populations
2.3. IL-17A, IL-17F, and IL-17A/F Treatment Differentially Modulates Viability and Cell Cycle in Keratinocyte Subpopulations
2.4. IL-17A and IL-17A/F Treatment Modulates Keratinocyte Subpopulation Proliferation and Differentiation Marker Expression
2.5. IL-17A and IL-17A/F Treatment Modulates the Expression of Psoriasis-Associated Markers in Keratinocyte Subpopulations
2.6. IL-17A and IL-17A/F Treatment Influences Subpopulation-Derived Skin Reconstruct Epidermal Thickness and Proliferation and Differentiation Marker Expression
2.7. Evaluation of the Preliminary Biological Response to IL-17B, IL-17C, IL-17D and IL-17E Treatment in Keratinocyte Subpopulations
3. Discussion
4. Materials and Methods
4.1. Human Keratinocyte Culture
4.2. Keratinocyte Subpopulation Isolation and Skin Equivalents
4.3. RT-PCR
4.4. Immunofluorescence of Isolated Cells
4.5. MTT Assay
4.6. Skin Equivalent Immuno-Histochemistry
4.7. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Bowcock, A.M.; Krueger, J.G. Getting under the skin: The immunogenetics of psoriasis. Nat. Rev. Immunol. 2005, 5, 699–711. [Google Scholar] [CrossRef] [PubMed]
- Lowes, M.A.; Bowcock, A.M.; Krueger, J.G. Pathogenesis and therapy of psoriasis. Nature 2007, 445, 866–873. [Google Scholar] [CrossRef] [PubMed]
- Nwe, S.M.; Champlain, A.H.; Gordon, K.B. Rationale and early clinical data on IL-17 blockade in psoriasis. Expert Rev. Clin. Immunol. 2013, 9, 677–682. [Google Scholar] [CrossRef] [PubMed]
- Mosca, M.; Hong, J.; Hadeler, E.; Hakimi, M.; Liao, W.; Bhutani, T. The Role of IL-17 Cytokines in Psoriasis. ImmunoTargets Ther. 2021, 10, 409–418. [Google Scholar] [CrossRef]
- Martin, D.A.; Towne, J.E.; Kricorian, G.; Klekotka, P.; Gudjonsson, J.E.; Krueger, J.G.; Russell, C.B. The emerging role of IL-17 in the pathogenesis of psoriasis: Preclinical and clinical findings. J. Investig. Dermatol. 2013, 133, 17–26. [Google Scholar] [CrossRef]
- Wrone-Smith, T.; Johnson, T.; Nelson, B.; Boise, L.H.; Thompson, C.B.; Núñez, G.; Nickoloff, B.J. Discordant expression of Bcl-x and Bcl-2 by keratinocytes in vitro and psoriatic keratinocytes in vivo. Am. J. Pathol. 1995, 146, 1079–1088. [Google Scholar]
- Teige, I.; Bäcklund, A.; Svensson, L.; Kvist, P.H.; Petersen, T.K.; Kemp, K. Induced keratinocyte hyper-proliferation in alpha2beta1 integrin transgenic mice results in systemic immune cell activation. Int. Immunopharmacol. 2010, 10, 107–114. [Google Scholar] [CrossRef]
- Castelijns, F.A.; Gerritsen, M.J.; van Erp, P.E.; van de Kerkhof, P.C. Cell-kinetic evidence for increased recruitment of cycling epidermal cells in psoriasis: The ratio of histone and Ki-67 antigen expression is constant. Dermatol. Basel Switz. 2000, 201, 105–110. [Google Scholar] [CrossRef]
- Grabe, N.; Neuber, K. Simulating psoriasis by altering transit amplifying cells. Bioinforma. Oxf. Engl. 2007, 23, 1309–1312. [Google Scholar] [CrossRef]
- Franssen, M.E.J.; Zeeuwen, P.L.J.M.; Vierwinden, G.; van de Kerkhof, P.C.M.; Schalkwijk, J.; van Erp, P.E.J. Phenotypical and functional differences in germinative subpopulations derived from normal and psoriatic epidermis. J. Investig. Dermatol. 2005, 124, 373–383. [Google Scholar] [CrossRef]
- Weatherhead, S.C.; Farr, P.M.; Jamieson, D.; Hallinan, J.S.; Lloyd, J.J.; Wipat, A.; Reynolds, N.J. Keratinocyte apoptosis in epidermal remodeling and clearance of psoriasis induced by UV radiation. J. Investig. Dermatol. 2011, 131, 1916–1926. [Google Scholar] [CrossRef] [PubMed]
- Truzzi, F.; Marconi, A.; Atzei, P.; Panza, M.C.; Lotti, R.; Dallaglio, K.; Tiberio, R.; Palazzo, E.; Vaschieri, C.; Pincelli, C. p75 neurotrophin receptor mediates apoptosis in transit-amplifying cells and its overexpression restores cell death in psoriatic keratinocytes. Cell Death Differ. 2011, 18, 948–958. [Google Scholar] [CrossRef] [PubMed]
- Truzzi, F.; Saltari, A.; Palazzo, E.; Lotti, R.; Petrachi, T.; Dallaglio, K.; Gemelli, C.; Grisendi, G.; Dominici, M.; Pincelli, C.; et al. CD271 mediates stem cells to early progeny transition in human epidermis. J. Investig. Dermatol. 2015, 135, 786–795. [Google Scholar] [CrossRef] [PubMed]
- Lotti, R.; Palazzo, E.; Quadri, M.; Dumas, M.; Schnebert, S.; Biondini, D.; Bianchini, M.A.; Nizard, C.; Pincelli, C.; Marconi, A. Isolation of an “early” transit amplifying keratinocyte population in human epidermis: A role for the low affinity neurotrophin receptor CD271. Stem Cells Dayt. Ohio 2022, 40, sxac060. [Google Scholar] [CrossRef]
- Quadri, M.; Baudouin, C.; Lotti, R.; Palazzo, E.; Campanini, L.; Bernard, F.-X.; Bellemere, G.; Pincelli, C.; Marconi, A. Characterization of Skin Interfollicular Stem Cells and Early Transit Amplifying Cells during the Transition from Infants to Young Children. Int. J. Mol. Sci. 2024, 25, 5635. [Google Scholar] [CrossRef]
- Liang, S.C.; Tan, X.-Y.; Luxenberg, D.P.; Karim, R.; Dunussi-Joannopoulos, K.; Collins, M.; Fouser, L.A. Interleukin (IL)-22 and IL-17 are coexpressed by Th17 cells and cooperatively enhance expression of antimicrobial peptides. J. Exp. Med. 2006, 203, 2271–2279. [Google Scholar] [CrossRef]
- Nograles, K.E.; Zaba, L.C.; Guttman-Yassky, E.; Fuentes-Duculan, J.; Suárez-Fariñas, M.; Cardinale, I.; Khatcherian, A.; Gonzalez, J.; Pierson, K.C.; White, T.R.; et al. Th17 cytokines interleukin (IL)-17 and IL-22 modulate distinct inflammatory and keratinocyte-response pathways. Br. J. Dermatol. 2008, 159, 1092–1102. [Google Scholar] [CrossRef]
- Bernerd, F.; Magnaldo, T.; Darmon, M. Delayed onset of epidermal differentiation in psoriasis. J. Investig. Dermatol. 1992, 98, 902–910. [Google Scholar] [CrossRef]
- Dallaglio, K.; Marconi, A.; Truzzi, F.; Lotti, R.; Palazzo, E.; Petrachi, T.; Saltari, A.; Coppini, M.; Pincelli, C. E-FABP induces differentiation in normal human keratinocytes and modulates the differentiation process in psoriatic keratinocytes in vitro. Exp. Dermatol. 2013, 22, 255–261. [Google Scholar] [CrossRef]
- Ishida-Yamamoto, A.; Iizuka, H. Differences in involucrin immunolabeling within cornified cell envelopes in normal and psoriatic epidermis. J. Investig. Dermatol. 1995, 104, 391–395. [Google Scholar] [CrossRef]
- Bose, A.; Teh, M.-T.; Mackenzie, I.C.; Waseem, A. Keratin k15 as a biomarker of epidermal stem cells. Int. J. Mol. Sci. 2013, 14, 19385–19398. [Google Scholar] [CrossRef] [PubMed]
- Bose, A.; Teh, M.-T.; Hutchison, I.L.; Wan, H.; Leigh, I.M.; Waseem, A. Two mechanisms regulate keratin K15 expression in keratinocytes: Role of PKC/AP-1 and FOXM1 mediated signalling. PLoS ONE 2012, 7, e38599. [Google Scholar] [CrossRef] [PubMed]
- Leigh, I.M.; Navsaria, H.; Purkis, P.E.; McKay, I.A.; Bowden, P.E.; Riddle, P.N. Keratins (K16 and K17) as markers of keratinocyte hyperproliferation in psoriasis in vivo and in vitro. Br. J. Dermatol. 1995, 133, 501–511. [Google Scholar] [CrossRef] [PubMed]
- Romashin, D.D.; Tolstova, T.V.; Varshaver, A.M.; Kozhin, P.M.; Rusanov, A.L.; Luzgina, N.G. Keratins 6, 16, and 17 in Health and Disease: A Summary of Recent Findings. Curr. Issues Mol. Biol. 2024, 46, 8627–8641. [Google Scholar] [CrossRef]
- Bragulla, H.H.; Homberger, D.G. Structure and functions of keratin proteins in simple, stratified, keratinized and cornified epithelia. J. Anat. 2009, 214, 516–559. [Google Scholar] [CrossRef]
- Lessard, J.C.; Piña-Paz, S.; Rotty, J.D.; Hickerson, R.P.; Kaspar, R.L.; Balmain, A.; Coulombe, P.A. Keratin 16 regulates innate immunity in response to epidermal barrier breach. Proc. Natl. Acad. Sci. USA 2013, 110, 19537–19542. [Google Scholar] [CrossRef]
- Ekman, A.-K.; Bivik Eding, C.; Rundquist, I.; Enerbäck, C. IL-17 and IL-22 Promote Keratinocyte Stemness in the Germinative Compartment in Psoriasis. J. Investig. Dermatol. 2019, 139, 1564–1573.e8. [Google Scholar] [CrossRef]
- Sano, S.; Chan, K.S.; Carbajal, S.; Clifford, J.; Peavey, M.; Kiguchi, K.; Itami, S.; Nickoloff, B.J.; DiGiovanni, J. Stat3 links activated keratinocytes and immunocytes required for development of psoriasis in a novel transgenic mouse model. Nat. Med. 2005, 11, 43–49. [Google Scholar] [CrossRef]
- Schröder, J.M.; Harder, J. Antimicrobial skin peptides and proteins. Cell. Mol. Life Sci. 2006, 63, 469–486. [Google Scholar] [CrossRef]
- Broome, A.-M.; Ryan, D.; Eckert, R.L. S100 protein subcellular localization during epidermal differentiation and psoriasis. J. Histochem. Cytochem. Off. J. Histochem. Soc. 2003, 51, 675–685. [Google Scholar] [CrossRef]
- Jinquan, T.; Vorum, H.; Larsen, C.G.; Madsen, P.; Rasmussen, H.H.; Gesser, B.; Etzerodt, M.; Honoré, B.; Celis, J.E.; Thestrup-Pedersen, K. Psoriasin: A novel chemotactic protein. J. Investig. Dermatol. 1996, 107, 5–10. [Google Scholar] [CrossRef] [PubMed]
- Hoffmann, R. The potential role of cytokines and T cells in alopecia areata. J. Investig. Dermatol. Symp. Proc. 1999, 4, 235–238. [Google Scholar] [CrossRef] [PubMed]
- D’Amico, F.; Skarmoutsou, E.; Granata, M.; Trovato, C.; Rossi, G.A.; Mazzarino, M.C. S100A7: A rAMPing up AMP molecule in psoriasis. Cytokine Growth Factor Rev. 2016, 32, 97–104. [Google Scholar] [CrossRef] [PubMed]
- Di Nuzzo, S.; Sylva-Steenland, R.M.; Koomen, C.W.; de Rie, M.A.; Das, P.K.; Bos, J.D.; Teunissen, M.B. Exposure to UVB induces accumulation of LFA-1+ T cells and enhanced expression of the chemokine psoriasin in normal human skin. Photochem. Photobiol. 2000, 72, 374–382. [Google Scholar] [CrossRef]
- Kolbinger, F.; Loesche, C.; Valentin, M.-A.; Jiang, X.; Cheng, Y.; Jarvis, P.; Peters, T.; Calonder, C.; Bruin, G.; Polus, F.; et al. β-Defensin 2 is a responsive biomarker of IL-17A–driven skin pathology in patients with psoriasis. J. Allergy Clin. Immunol. 2017, 139, 923–932.e8. [Google Scholar] [CrossRef]
- Boniface, K.; Bernard, F.-X.; Garcia, M.; Gurney, A.L.; Lecron, J.-C.; Morel, F. IL-22 inhibits epidermal differentiation and induces proinflammatory gene expression and migration of human keratinocytes. J. Immunol. Baltim. Md 1950 2005, 174, 3695–3702. [Google Scholar] [CrossRef]
- Desmet, E.; Ramadhas, A.; Lambert, J.; Van Gele, M. In vitro psoriasis models with focus on reconstructed skin models as promising tools in psoriasis research. Exp. Biol. Med. Maywood NJ 2017, 242, 1158–1169. [Google Scholar] [CrossRef]
- Brembilla, N.C.; Senra, L.; Boehncke, W.-H. The IL-17 Family of Cytokines in Psoriasis: IL-17A and Beyond. Front. Immunol. 2018, 9, 1682. [Google Scholar] [CrossRef]
- Miossec, P.; Kolls, J.K. Targeting IL-17 and TH17 cells in chronic inflammation. Nat. Rev. Drug Discov. 2012, 11, 763–776. [Google Scholar] [CrossRef]
- Kouri, V.-P.; Olkkonen, J.; Ainola, M.; Li, T.-F.; Bjorkman, L.; Konttinen, Y.T.; Mandelin, J. Neutrophils produce interleukin-17B in rheumatoid synovial tissue. Rheumatology 2014, 53, 39–47. [Google Scholar] [CrossRef]
- Ni, X.; Xu, Y.; Wang, W.; Kong, B.; Ouyang, J.; Chen, J.; Yan, M.; Wu, Y.; Chen, Q.; Wang, X.; et al. IL-17D-induced inhibition of DDX5 expression in keratinocytes amplifies IL-36R-mediated skin inflammation. Nat. Immunol. 2022, 23, 1577–1587. [Google Scholar] [CrossRef] [PubMed]
- Ramirez-Carrozzi, V.; Sambandam, A.; Luis, E.; Lin, Z.; Jeet, S.; Lesch, J.; Hackney, J.; Kim, J.; Zhou, M.; Lai, J.; et al. IL-17C regulates the innate immune function of epithelial cells in an autocrine manner. Nat. Immunol. 2011, 12, 1159–1166. [Google Scholar] [CrossRef] [PubMed]
- Bjerke, J.R. In situ characterization and counting of mononuclear cells in lesions of different clinical forms of psoriasis. Acta Derm. Venereol. 1982, 62, 93–100. [Google Scholar] [CrossRef] [PubMed]
- Bjerke, J.R. Subpopulations of mononuclear cells in lesions of psoriasis, lichen planus and discoid lupus erythematosus studied using monoclonal antibodies. Acta Derm. Venereol. 1982, 62, 477–483. [Google Scholar] [CrossRef]
- Hammar, H.; Gu, S.Q.; Johannesson, A.; Sundkvist, K.-G.; Biberfeld, P. Subpopulations of Mononuclear Cells in Microscopic Lesions of Psoriatic Patients. Selective Accumulation of Suppressor/Cytotoxic T Cells in Epidermis During the Evolution of the Lesion. J. Investig. Dermatol. 1984, 83, 416–420. [Google Scholar] [CrossRef]
- Martin, A.; Ibraheim, M.K.; Gupta, R.; Wu, J.J. Innovations in Psoriasis. Dermatol. Clin. 2025, 43, 1–9. [Google Scholar] [CrossRef]
- Bie, Q.; Jin, C.; Zhang, B.; Dong, H. IL-17B: A new area of study in the IL-17 family. Mol. Immunol. 2017, 90, 50–56. [Google Scholar] [CrossRef]
- Chang, S.H.; Reynolds, J.M.; Pappu, B.P.; Chen, G.; Martinez, G.J.; Dong, C. Interleukin-17C promotes Th17 cell responses and autoimmune disease via interleukin-17 receptor E. Immunity 2011, 35, 611–621. [Google Scholar] [CrossRef]
- Liu, X.; Sun, S.; Liu, D. IL-17D: A Less Studied Cytokine of IL-17 Family. Int. Arch. Allergy Immunol. 2020, 181, 618–623. [Google Scholar] [CrossRef]
- Fort, M.M.; Cheung, J.; Yen, D.; Li, J.; Zurawski, S.M.; Lo, S.; Menon, S.; Clifford, T.; Hunte, B.; Lesley, R.; et al. IL-25 induces IL-4, IL-5, and IL-13 and Th2-associated pathologies in vivo. Immunity 2001, 15, 985–995. [Google Scholar] [CrossRef]
- Quadri, M.; Tiso, N.; Musmeci, F.; Morasso, M.I.; Brooks, S.R.; Bonetti, L.R.; Panini, R.; Lotti, R.; Marconi, A.; Pincelli, C.; et al. CD271 activation prevents low to high-risk progression of cutaneous squamous cell carcinoma and improves therapy outcomes. J. Exp. Clin. Cancer Res. CR 2023, 42, 167. [Google Scholar] [CrossRef]






| Gene Symbol | Sequences (5′ > 3′) | Primer (bp) | Amplicon (bp) | |
|---|---|---|---|---|
| IL-17A | FP | CTCATTGGTGTCACTGCTACTG | 22 | 78 |
| RP | CCTGGATTTCGTGGGATTGTG | 21 | ||
| IL-17B | FP | GAGCCCCAAAAGCAAGAGGAA | 21 | 107 |
| RP | TGCGGGCATACGGTTTCATC | 20 | ||
| IL-17C | FP | CCCTGGAGATACCGTGTGGA | 20 | 236 |
| RP | GGGACGTGGATGAACTCGG | 19 | ||
| IL-17D | FP | GGGCCAATTTGTGGTTAAGA | 20 | 170 |
| RP | GCCTCCAGATTGATCTCTGC | 20 | ||
| IL-17E (IL25) | FP | CAGGTGGTTGCATTCTTGGC | 20 | 249 |
| RP | GAGCCGGTTCAAGTCTCTGT | 20 | ||
| IL-17F | FP | CTGGAATTACACTGTCACTTGG | 22 | 108 |
| RP | GAGATGTCTTCCTTTCCTTGAG | 22 | ||
| CXCL1 | FP | AGGGAATTCACCCCAAGAAC | 20 | 130 |
| RP | ACTATGGGGGATGCAGGATT | 20 | ||
| CXCL8 (IL8) | FP | GAATGGGTTTGCTAGAATGTGATA | 24 | 129 |
| RP | CAGACTAGGGTTGCCAGATTTAAC | 24 | ||
| DEFB4 | FP | TTGATGTCCTCCCCAGACTC | 20 | 215 |
| RP | GAGACCACAGGTGCCAATTT | 20 | ||
| CAMP | FP | GCAGTCACCAGAGGATTGTGAC | 22 | 51 |
| RP | TCAGGCAGCAAATCAAAGGAG | 21 | ||
| ACTB | FP | AAACTGGAACGGTGAAGGTG | 20 | 171 |
| RP | AGAGAAGTGGGGTGGCTTTT | 20 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Palazzo, E.; Lotti, R.; Quadri, M.; Pincelli, C.; Marconi, A. IL-17 Ligand and Receptor Family Members Are Differentially Expressed by Keratinocyte Subpopulations and Modulate Their Differentiation and Inflammatory Phenotype. Int. J. Mol. Sci. 2025, 26, 2989. https://doi.org/10.3390/ijms26072989
Palazzo E, Lotti R, Quadri M, Pincelli C, Marconi A. IL-17 Ligand and Receptor Family Members Are Differentially Expressed by Keratinocyte Subpopulations and Modulate Their Differentiation and Inflammatory Phenotype. International Journal of Molecular Sciences. 2025; 26(7):2989. https://doi.org/10.3390/ijms26072989
Chicago/Turabian StylePalazzo, Elisabetta, Roberta Lotti, Marika Quadri, Carlo Pincelli, and Alessandra Marconi. 2025. "IL-17 Ligand and Receptor Family Members Are Differentially Expressed by Keratinocyte Subpopulations and Modulate Their Differentiation and Inflammatory Phenotype" International Journal of Molecular Sciences 26, no. 7: 2989. https://doi.org/10.3390/ijms26072989
APA StylePalazzo, E., Lotti, R., Quadri, M., Pincelli, C., & Marconi, A. (2025). IL-17 Ligand and Receptor Family Members Are Differentially Expressed by Keratinocyte Subpopulations and Modulate Their Differentiation and Inflammatory Phenotype. International Journal of Molecular Sciences, 26(7), 2989. https://doi.org/10.3390/ijms26072989

