Bone Morphogenetic Protein 7 Improves Wound Healing in Diabetes by Decreasing Inflammation and Promoting M2 Macrophage Polarization
Abstract
1. Introduction
2. Results
2.1. BMP7 Treatment Accelerates Wound Healing in Diabetic Mice
2.2. BMP7 Treatment Promotes More Mature Wound Healing
2.3. BMP7 Treatment Decreases Inflammatory Markers and MMP-9 in Wounds of Diabetic Mice
2.4. BMP7 Treatment Decreases Inflammatory Cells at the Wound Site
2.5. BMP7 Treatment Decreases Oxidative Stress and Promotes Cell Proliferation and Angiogenesis
2.6. BMP7 Decreases the p38 Pathway and Activates the ERK and AKT Pathways
3. Discussion
4. Materials and Methods
4.1. Animals
4.2. Diabetic Animal Model of Wound Healing
4.3. Histological Analysis
4.4. Quantitative Real-Time PCR
4.5. Immunohistochemistry
4.6. Western Blot Analysis
4.7. Dihydroethidium Assay
4.8. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Magliano, D.J.; Boyko, E.J. IDF DIABETES ATLAS, 10th ed.; International Diabetes Federation: Brussels, Belgium, 2021. [Google Scholar]
- Armstrong, D.G.; Tan, T.W.; Boulton, A.J.M.; Bus, S.A. Diabetic Foot Ulcers: A Review. JAMA 2023, 330, 62–75. [Google Scholar] [CrossRef] [PubMed]
- Armstrong, D.G.; Boulton, A.J.M.; Bus, S.A. Diabetic Foot Ulcers and Their Recurrence. N. Engl. J. Med. 2017, 376, 2367–2375. [Google Scholar] [CrossRef] [PubMed]
- Falanga, V. Wound healing and its impairment in the diabetic foot. Lancet 2005, 366, 1736–1743. [Google Scholar] [CrossRef] [PubMed]
- Da Silva, J.; Leal, E.C.; Carvalho, E. Bioactive Antimicrobial Peptides as Therapeutic Agents for Infected Diabetic Foot Ulcers. Biomolecules 2021, 11, 1894. [Google Scholar] [CrossRef] [PubMed]
- Rodrigues, M.; Kosaric, N.; Bonham, C.A.; Gurtner, G.C. Wound Healing: A Cellular Perspective. Physiol. Rev. 2019, 99, 665–706. [Google Scholar] [CrossRef]
- Zlobina, K.; Malekos, E.; Chen, H.; Gomez, M. Robust classification of wound healing stages in both mice and humans for acute and burn wounds based on transcriptomic data. BMC Bioinform. 2023, 24, 166. [Google Scholar] [CrossRef]
- Figueiredo, A.; Leal, E.C.; Carvalho, E. Protein tyrosine phosphatase 1B inhibition as a potential therapeutic target for chronic wounds in diabetes. Pharmacol. Res. 2020, 159, 104977. [Google Scholar] [CrossRef]
- Leal, E.C.; Emanuelli, T.; Santos, D.; Moura, J.; Catarina Rg Fonseca, A.; Burgeiro, A.; Carvalho, E. Dysregulation of endoplasmic reticulum stress response in skin wounds in a streptozotocin-induced diabetes mouse model. J. Mol. Endocrinol. 2023, 70, e220122. [Google Scholar] [CrossRef]
- Leal, E.C.; Carvalho, E.; Tellechea, A.; Kafanas, A.; Tecilazich, F.; Kearney, C.; Kuchibhotla, S.; Auster, M.E.; Kokkotou, E.; Mooney, D.J.; et al. Substance P promotes wound healing in diabetes by modulating inflammation and macrophage phenotype. Am. J. Pathol. 2015, 185, 1638–1648. [Google Scholar] [CrossRef]
- Moura, J.; Madureira, P.; Leal, E.C.; Fonseca, A.C.; Carvalho, E. Immune aging in diabetes and its implications in wound healing. Clin. Immunol. 2019, 200, 43–54. [Google Scholar] [CrossRef]
- Leal, E.C.; Carvalho, E. Heme Oxygenase-1 as Therapeutic Target for Diabetic Foot Ulcers. Int. J. Mol. Sci. 2022, 23, 12043. [Google Scholar] [CrossRef] [PubMed]
- Louiselle, A.E.; Niemiec, S.M.; Zgheib, C.; Liechty, K.W. Macrophage polarization and diabetic wound healing. Transl. Res. 2021, 236, 109–116. [Google Scholar] [CrossRef] [PubMed]
- Aitcheson, S.M.; Frentiu, F.D.; Hurn, S.E.; Edwards, K.; Murray, R.Z. Skin Wound Healing: Normal Macrophage Function and Macrophage Dysfunction in Diabetic Wounds. Molecules 2021, 26, 4917. [Google Scholar] [CrossRef] [PubMed]
- Dasari, N.; Jiang, A.; Skochdopole, A.; Chung, J.; Reece, E.M.; Vorstenbosch, J.; Winocour, S. Updates in Diabetic Wound Healing, Inflammation, and Scarring. Semin. Plast. Surg. 2021, 35, 153–158. [Google Scholar] [CrossRef]
- Smoljan, I.; Detel, D.; Buljevic, S.; Erjavec, I.; Maric, I. Therapeutic Potential of BMP7 in the Treatment of Osteoporosis Caused by the Interaction between Inflammation and Corticosteroids in Inflammatory Bowel Disease. Biomedicines 2023, 11, 2161. [Google Scholar] [CrossRef]
- Herrera, B.; Addante, A.; Sanchez, A. BMP Signalling at the Crossroad of Liver Fibrosis and Regeneration. Int. J. Mol. Sci. 2017, 19, 39. [Google Scholar] [CrossRef]
- Yuan, T.L.; Chen, J.; Tong, Y.L.; Zhang, Y.; Liu, Y.Y.; Wei, J.C.; Liu, Y.; Zhao, Y.; Herrmann, M. Serum Heme Oxygenase-1 and BMP-7 Are Potential Biomarkers for Bone Metabolism in Patients with Rheumatoid Arthritis and Ankylosing Spondylitis. Biomed. Res. Int. 2016, 2016, 7870925. [Google Scholar] [CrossRef]
- Shoulders, H.; Garner, K.H.; Singla, D.K. Macrophage depletion by clodronate attenuates bone morphogenetic protein-7 induced M2 macrophage differentiation and improved systolic blood velocity in atherosclerosis. Transl. Res. 2019, 203, 1–14. [Google Scholar] [CrossRef]
- Zou, G.L.; Zuo, S.; Lu, S.; Hu, R.H.; Lu, Y.Y.; Yang, J.; Deng, K.S.; Wu, Y.T.; Mu, M.; Zhu, J.J.; et al. Bone morphogenetic protein-7 represses hepatic stellate cell activation and liver fibrosis via regulation of TGF-beta/Smad signaling pathway. World J. Gastroenterol. 2019, 25, 4222–4234. [Google Scholar] [CrossRef]
- Tate, M.; Perera, N.; Prakoso, D.; Willis, A.M.; Deo, M.; Oseghale, O.; Qian, H.; Donner, D.G.; Kiriazis, H.; De Blasio, M.J.; et al. Bone Morphogenetic Protein 7 Gene Delivery Improves Cardiac Structure and Function in a Murine Model of Diabetic Cardiomyopathy. Front. Pharmacol. 2021, 12, 719290. [Google Scholar] [CrossRef]
- Guo, J.; Lin, Q.; Shao, Y.; Rong, L.; Zhang, D. BMP-7 suppresses excessive scar formation by activating the BMP-7/Smad1/5/8 signaling pathway. Mol. Med. Rep. 2017, 16, 1957–1963. [Google Scholar] [CrossRef] [PubMed]
- Aluganti Narasimhulu, C.; Singla, D.K. The Role of Bone Morphogenetic Protein 7 (BMP-7) in Inflammation in Heart Diseases. Cells 2020, 9, 280. [Google Scholar] [CrossRef] [PubMed]
- Vaccaro, A.R.; Whang, P.G.; Patel, T.; Phillips, F.M.; Anderson, D.G.; Albert, T.J.; Hilibrand, A.S.; Brower, R.S.; Kurd, M.F.; Appannagari, A.; et al. The safety and efficacy of OP-1 (rhBMP-7) as a replacement for iliac crest autograft for posterolateral lumbar arthrodesis: Minimum 4-year follow-up of a pilot study. Spine J. 2008, 8, 457–465. [Google Scholar] [CrossRef]
- Boon, M.R.; van der Horst, G.; van der Pluijm, G.; Tamsma, J.T.; Smit, J.W.; Rensen, P.C. Bone morphogenetic protein 7: A broad-spectrum growth factor with multiple target therapeutic potency. Cytokine Growth Factor. Rev. 2011, 22, 221–229. [Google Scholar] [CrossRef] [PubMed]
- Carreira, A.C.; Lojudice, F.H.; Halcsik, E.; Navarro, R.D.; Sogayar, M.C.; Granjeiro, J.M. Bone morphogenetic proteins: Facts, challenges, and future perspectives. J. Dent. Res. 2014, 93, 335–345. [Google Scholar] [CrossRef]
- Rocher, C.; Singla, R.; Singal, P.K.; Parthasarathy, S.; Singla, D.K. Bone morphogenetic protein 7 polarizes THP-1 cells into M2 macrophages. Can. J. Physiol. Pharmacol. 2012, 90, 947–951. [Google Scholar] [CrossRef]
- Singla, D.K.; Singla, R.; Wang, J. BMP-7 Treatment Increases M2 Macrophage Differentiation and Reduces Inflammation and Plaque Formation in Apo E-/- Mice. PLoS ONE 2016, 11, e0147897. [Google Scholar] [CrossRef]
- van de Vyver, M.; Boodhoo, K.; Frazier, T.; Hamel, K.; Kopcewicz, M.; Levi, B.; Maartens, M.; Machcinska, S.; Nunez, J.; Pagani, C.; et al. Histology Scoring System for Murine Cutaneous Wounds. Stem Cells Dev. 2021, 30, 1141–1152. [Google Scholar] [CrossRef]
- Kowtharapu, B.S.; Prakasam, R.K.; Murin, R.; Koczan, D.; Stahnke, T.; Wree, A.; Junemann, A.G.M.; Stachs, O. Role of Bone Morphogenetic Protein 7 (BMP7) in the Modulation of Corneal Stromal and Epithelial Cell Functions. Int. J. Mol. Sci. 2018, 19, 1415. [Google Scholar] [CrossRef]
- Huang, Y.; Kyriakides, T.R. The role of extracellular matrix in the pathophysiology of diabetic wounds. Matrix Biol. Plus 2020, 6–7, 100037. [Google Scholar] [CrossRef]
- Weiskirchen, R.; Meurer, S.K.; Gressner, O.A.; Herrmann, J.; Borkham-Kamphorst, E.; Gressner, A.M. BMP-7 as antagonist of organ fibrosis. Front. Biosci. (Landmark Ed.) 2009, 14, 4992–5012. [Google Scholar] [CrossRef] [PubMed]
- Murray, L.A.; Hackett, T.L.; Warner, S.M.; Shaheen, F.; Argentieri, R.L.; Dudas, P.; Farrell, F.X.; Knight, D.A. BMP-7 does not protect against bleomycin-induced lung or skin fibrosis. PLoS ONE 2008, 3, e4039. [Google Scholar] [CrossRef] [PubMed]
- Ljubimov, A.V.; Saghizadeh, M. Progress in corneal wound healing. Prog. Retin. Eye Res. 2015, 49, 17–45. [Google Scholar] [CrossRef]
- Moura, L.I.; Dias, A.M.; Leal, E.C.; Carvalho, L.; de Sousa, H.C.; Carvalho, E. Chitosan-based dressings loaded with neurotensin--an efficient strategy to improve early diabetic wound healing. Acta Biomater. 2014, 10, 843–857. [Google Scholar] [CrossRef] [PubMed]
- Mouritzen, M.V.; Petkovic, M.; Qvist, K.; Poulsen, S.S.; Alarico, S.; Leal, E.C.; Dalgaard, L.T.; Empadinhas, N.; Carvalho, E.; Jenssen, H. Improved diabetic wound healing by LFcinB is associated with relevant changes in the skin immune response and microbiota. Mol. Ther. Methods Clin. Dev. 2021, 20, 726–739. [Google Scholar] [CrossRef] [PubMed]
- Wetzler, C.; Kampfer, H.; Stallmeyer, B.; Pfeilschifter, J.; Frank, S. Large and sustained induction of chemokines during impaired wound healing in the genetically diabetic mouse: Prolonged persistence of neutrophils and macrophages during the late phase of repair. J. Investig. Dermatol. 2000, 115, 245–253. [Google Scholar] [CrossRef]
- Pierce, G.F. Inflammation in nonhealing diabetic wounds: The space-time continuum does matter. Am. J. Pathol. 2001, 159, 399–403. [Google Scholar] [CrossRef]
- Dinh, T.; Tecilazich, F.; Kafanas, A.; Doupis, J.; Gnardellis, C.; Leal, E.; Tellechea, A.; Pradhan, L.; Lyons, T.E.; Giurini, J.M.; et al. Mechanisms involved in the development and healing of diabetic foot ulceration. Diabetes 2012, 61, 2937–2947. [Google Scholar] [CrossRef]
- Tellechea, A.; Kafanas, A.; Leal, E.C.; Tecilazich, F.; Kuchibhotla, S.; Auster, M.E.; Kontoes, I.; Paolino, J.; Carvalho, E.; Nabzdyk, L.P.; et al. Increased skin inflammation and blood vessel density in human and experimental diabetes. Int. J. Low. Extrem. Wounds 2013, 12, 4–11. [Google Scholar] [CrossRef]
- Sindrilaru, A.; Peters, T.; Wieschalka, S.; Baican, C.; Baican, A.; Peter, H.; Hainzl, A.; Schatz, S.; Qi, Y.; Schlecht, A.; et al. An unrestrained proinflammatory M1 macrophage population induced by iron impairs wound healing in humans and mice. J. Clin. Investig. 2011, 121, 985–997. [Google Scholar] [CrossRef]
- Wu, X.; He, W.; Mu, X.; Liu, Y.; Deng, J.; Liu, Y.; Nie, X. Macrophage polarization in diabetic wound healing. Burns Trauma. 2022, 10, tkac051. [Google Scholar] [CrossRef] [PubMed]
- Serban, D.; Papanas, N.; Dascalu, A.M.; Kempler, P.; Raz, I.; Rizvi, A.A.; Rizzo, M.; Tudor, C.; Silviu Tudosie, M.; Tanasescu, D.; et al. Significance of Neutrophil to Lymphocyte Ratio (NLR) and Platelet Lymphocyte Ratio (PLR) in Diabetic Foot Ulcer and Potential New Therapeutic Targets. Int. J. Low. Extrem. Wounds 2024, 23, 205–216. [Google Scholar] [CrossRef]
- Geng, K.; Ma, X.; Jiang, Z.; Huang, W.; Gao, C.; Pu, Y.; Luo, L.; Xu, Y.; Xu, Y. Innate Immunity in Diabetic Wound Healing: Focus on the Mastermind Hidden in Chronic Inflammatory. Front. Pharmacol. 2021, 12, 653940. [Google Scholar] [CrossRef] [PubMed]
- Deng, L.; Wang, G.; Ju, S. Correlation between inflammatory factors, autophagy protein levels, and infection in granulation tissue of diabetic foot ulcer. Immun. Inflamm. Dis. 2024, 12, e1233. [Google Scholar] [CrossRef] [PubMed]
- Khanna, S.; Biswas, S.; Shang, Y.; Collard, E.; Azad, A.; Kauh, C.; Bhasker, V.; Gordillo, G.M.; Sen, C.K.; Roy, S. Macrophage dysfunction impairs resolution of inflammation in the wounds of diabetic mice. PLoS ONE 2010, 5, e9539. [Google Scholar] [CrossRef] [PubMed]
- Muller, M.; Trocme, C.; Lardy, B.; Morel, F.; Halimi, S.; Benhamou, P.Y. Matrix metalloproteinases and diabetic foot ulcers: The ratio of MMP-1 to TIMP-1 is a predictor of wound healing. Diabet. Med. 2008, 25, 419–426. [Google Scholar] [CrossRef]
- Rayment, E.A.; Upton, Z.; Shooter, G.K. Increased matrix metalloproteinase-9 (MMP-9) activity observed in chronic wound fluid is related to the clinical severity of the ulcer. Br. J. Dermatol. 2008, 158, 951–961. [Google Scholar] [CrossRef]
- Fu, K.; Zheng, X.; Chen, Y.; Wu, L.; Yang, Z.; Chen, X.; Song, W. Role of matrix metalloproteinases in diabetic foot ulcers: Potential therapeutic targets. Front. Pharmacol. 2022, 13, 1050630. [Google Scholar] [CrossRef]
- Seraphim, P.M.; Leal, E.C.; Moura, J.; Goncalves, P.; Goncalves, J.P.; Carvalho, E. Lack of lymphocytes impairs macrophage polarization and angiogenesis in diabetic wound healing. Life Sci. 2020, 254, 117813. [Google Scholar] [CrossRef]
- Rocher, C.; Singla, D.K. SMAD-PI3K-Akt-mTOR pathway mediates BMP-7 polarization of monocytes into M2 macrophages. PLoS ONE 2013, 8, e84009. [Google Scholar] [CrossRef]
- Higgins, D.F.; Ewart, L.M.; Masterson, E.; Tennant, S.; Grebnev, G.; Prunotto, M.; Pomposiello, S.; Conde-Knape, K.; Martin, F.M.; Godson, C. BMP7-induced-Pten inhibits Akt and prevents renal fibrosis. Biochim. Biophys. Acta Mol. Basis Dis. 2017, 1863, 3095–3104. [Google Scholar] [CrossRef] [PubMed]
- Dhall, S.; Do, D.C.; Garcia, M.; Kim, J.; Mirebrahim, S.H.; Lyubovitsky, J.; Lonardi, S.; Nothnagel, E.A.; Schiller, N.; Martins-Green, M. Generating and reversing chronic wounds in diabetic mice by manipulating wound redox parameters. J. Diabetes Res. 2014, 2014, 562625. [Google Scholar] [CrossRef] [PubMed]
- Nouvong, A.; Ambrus, A.M.; Zhang, E.R.; Hultman, L.; Coller, H.A. Reactive oxygen species and bacterial biofilms in diabetic wound healing. Physiol. Genomics 2016, 48, 889–896. [Google Scholar] [CrossRef] [PubMed]
- Loo, A.E.; Wong, Y.T.; Ho, R.; Wasser, M.; Du, T.; Ng, W.T.; Halliwell, B. Effects of hydrogen peroxide on wound healing in mice in relation to oxidative damage. PLoS ONE 2012, 7, e49215. [Google Scholar] [CrossRef] [PubMed]
- Cavalla, F.; Osorio, C.; Paredes, R.; Valenzuela, M.A.; Garcia-Sesnich, J.; Sorsa, T.; Tervahartiala, T.; Hernandez, M. Matrix metalloproteinases regulate extracellular levels of SDF-1/CXCL12, IL-6 and VEGF in hydrogen peroxide-stimulated human periodontal ligament fibroblasts. Cytokine 2015, 73, 114–121. [Google Scholar] [CrossRef]
- Deng, L.; Du, C.; Song, P.; Chen, T.; Rui, S.; Armstrong, D.G.; Deng, W. The Role of Oxidative Stress and Antioxidants in Diabetic Wound Healing. Oxid. Med. Cell Longev. 2021, 2021, 8852759. [Google Scholar] [CrossRef]
- Kunkemoeller, B.; Kyriakides, T.R. Redox Signaling in Diabetic Wound Healing Regulates Extracellular Matrix Deposition. Antioxid. Redox Signal 2017, 27, 823–838. [Google Scholar] [CrossRef]
- Sun, L.; Guo, C.; Liu, D.; Zhao, Y.; Zhang, Y.; Song, Z.; Han, H.; Chen, D.; Zhao, Y. Protective effects of bone morphogenetic protein 7 against amyloid-beta induced neurotoxicity in PC12 cells. Neuroscience 2011, 184, 151–163. [Google Scholar] [CrossRef]
- Li, R.X.; Yiu, W.H.; Wu, H.J.; Wong, D.W.; Chan, L.Y.; Lin, M.; Leung, J.C.; Lai, K.N.; Tang, S.C. BMP7 reduces inflammation and oxidative stress in diabetic tubulopathy. Clin. Sci. (Lond.) 2015, 128, 269–280. [Google Scholar] [CrossRef]
- Burgess, J.L.; Wyant, W.A.; Abdo Abujamra, B.; Kirsner, R.S.; Jozic, I. Diabetic Wound-Healing Science. Medicina 2021, 57, 1072. [Google Scholar] [CrossRef]
- Liang, C.; Liang, Q.; Xu, X.; Liu, X.; Gao, X.; Li, M.; Yang, J.; Xing, X.; Huang, H.; Tang, Q.; et al. Bone morphogenetic protein 7 mediates stem cells migration and angiogenesis: Therapeutic potential for endogenous pulp regeneration. Int. J. Oral. Sci. 2022, 14, 38. [Google Scholar] [CrossRef] [PubMed]
- Chen, F.; Bi, D.; Cheng, C.; Ma, S.; Liu, Y.; Cheng, K. Bone morphogenetic protein 7 enhances the osteogenic differentiation of human dermal-derived CD105+ fibroblast cells through the Smad and MAPK pathways. Int. J. Mol. Med. 2019, 43, 37–46. [Google Scholar] [CrossRef] [PubMed]
- Townsend, K.L.; An, D.; Lynes, M.D.; Huang, T.L.; Zhang, H.; Goodyear, L.J.; Tseng, Y.H. Increased mitochondrial activity in BMP7-treated brown adipocytes, due to increased CPT1- and CD36-mediated fatty acid uptake. Antioxid. Redox Signal 2013, 19, 243–257. [Google Scholar] [CrossRef] [PubMed]
- Leal, E.C.; Moura, L.I.F.; Pirzgalska, R.M.; Marques-da-Silva, D.; Ledent, C.; Kofalvi, A.; Carvalho, E. Diabetes and Cannabinoid CB1 receptor deficiency promote similar early onset aging-like changes in the skin. Exp. Gerontol. 2021, 154, 111528. [Google Scholar] [CrossRef]





| Mouse Group | Body Weight (g) | Glycaemia (mg/dL) | n |
|---|---|---|---|
| Control | 25.7 ± 1.3 | 445.3 ± 58.1 | 4 |
| BMP7 | 25.8 ± 1.6 | 463.5 ± 55.6 | 4 |
| Accession No. | Name | Sequence (5′-3′) | Ta (°C) |
|---|---|---|---|
| NM_013684 | Tbp | Forward: ACCCTTCACCAATGA CTCCTATG Reverse: TGACTGCAGCAAATCGCTTGG | 58 |
| NM_001314054 | Il6 | Forward: TGGCTAAGGACCAAGACCATCCAA Reverse: AACGCACTAGGTTTGCCGAGTAGA | 60 |
| NM_013693 | Tnf | Forward: TCCGAATTCAGTGGAGCCTCGAA Reverse: TGCACCTCAGGGAAGAATCTGGAA | 60 |
| NM_013599 | Mmp9 | Forward: CATAGAGGAAGCCCATTACAG Reverse: GATCCACCTTCTGAGACTTCA | 58 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Da Silva, J.; Figueiredo, A.; Tseng, Y.-H.; Carvalho, E.; Leal, E.C. Bone Morphogenetic Protein 7 Improves Wound Healing in Diabetes by Decreasing Inflammation and Promoting M2 Macrophage Polarization. Int. J. Mol. Sci. 2025, 26, 2036. https://doi.org/10.3390/ijms26052036
Da Silva J, Figueiredo A, Tseng Y-H, Carvalho E, Leal EC. Bone Morphogenetic Protein 7 Improves Wound Healing in Diabetes by Decreasing Inflammation and Promoting M2 Macrophage Polarization. International Journal of Molecular Sciences. 2025; 26(5):2036. https://doi.org/10.3390/ijms26052036
Chicago/Turabian StyleDa Silva, Jessica, Ana Figueiredo, Yu-Hua Tseng, Eugenia Carvalho, and Ermelindo C. Leal. 2025. "Bone Morphogenetic Protein 7 Improves Wound Healing in Diabetes by Decreasing Inflammation and Promoting M2 Macrophage Polarization" International Journal of Molecular Sciences 26, no. 5: 2036. https://doi.org/10.3390/ijms26052036
APA StyleDa Silva, J., Figueiredo, A., Tseng, Y.-H., Carvalho, E., & Leal, E. C. (2025). Bone Morphogenetic Protein 7 Improves Wound Healing in Diabetes by Decreasing Inflammation and Promoting M2 Macrophage Polarization. International Journal of Molecular Sciences, 26(5), 2036. https://doi.org/10.3390/ijms26052036

