Insight into crRNA Processing in Streptococcus mutans P42S and Application of SmutCas9 in Genome Editing
Abstract
1. Introduction
2. Results
2.1. RNA Sequencing
2.2. Gene Editing of Phage p2
2.2.1. Editing orf49 of Phage p2
2.2.2. Editing orf44 of Phage p2
3. Discussion
4. Materials and Methods
4.1. Bacterial Strains, Phages, and Growth Conditions
4.2. RNA Extraction and Sequencing
4.3. Construction of pTRKL-SmutCas9
4.4. Gene Editing of Phage p2
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Makarova, K.S.; Wolf, Y.I.; Iranzo, J.; Shmakov, S.A.; Alkhnbashi, O.S.; Brouns, S.J.J.; Charpentier, E.; Cheng, D.; Haft, D.H.; Horvath, P.; et al. Evolutionary Classification of CRISPR–Cas Systems: A Burst of Class 2 and Derived Variants. Nat. Rev. Microbiol. 2020, 18, 67–83. [Google Scholar] [CrossRef] [PubMed]
- Mojica, F.J.M.; Díez-Villaseñor, C.; García-Martínez, J.; Soria, E. Intervening Sequences of Regularly Spaced Prokaryotic Repeats Derive from Foreign Genetic Elements. J. Mol. Evol. 2005, 60, 174–182. [Google Scholar] [CrossRef] [PubMed]
- Pourcel, C.; Salvignol, G.; Vergnaud, G. CRISPR Elements in Yersinia pestis Acquire New Repeats by Preferential Uptake of Bacteriophage DNA, and Provide Additional Tools for Evolutionary Studies. Microbiology 2005, 151, 653–663. [Google Scholar] [CrossRef] [PubMed]
- Bolotin, A.; Quinquis, B.; Sorokin, A.; Dusko Ehrlich, S. Clustered Regularly Interspaced Short Palindrome Repeats (CRISPRs) Have Spacers of Extrachromosomal Origin. Microbiology 2005, 151, 2551–2561. [Google Scholar] [CrossRef] [PubMed]
- Jansen, R.; Embden, J.D.V.; Gaastra, W.; Schouls, L.M. Identification of Genes That Are Associated with DNA Repeats in Prokaryotes. Mol. Microbiol. 2002, 43, 1565–1575. [Google Scholar] [CrossRef] [PubMed]
- Makarova, K.S.; Grishin, N.V.; Shabalina, S.A.; Wolf, Y.I.; Koonin, E.V. A Putative RNA-Interference-Based Immune System in Prokaryotes: Computational Analysis of the Predicted Enzymatic Machinery, Functional Analogies with Eukaryotic RNAi, and Hypothetical Mechanisms of Action. Biol. Direct 2006, 1, 7. [Google Scholar] [CrossRef]
- Barrangou, R.; Fremaux, C.; Deveau, H.; Richards, M.; Boyaval, P.; Moineau, S.; Romero, D.A.; Horvath, P. CRISPR Provides Acquired Resistance Against Viruses in Prokaryotes. Science 2007, 315, 1709–1712. [Google Scholar] [CrossRef]
- Mosterd, C.; Rousseau, G.M.; Moineau, S. A Short Overview of the CRISPR-Cas Adaptation Stage. Can. J. Microbiol. 2021, 67, 1–12. [Google Scholar] [CrossRef]
- Garneau, J.E.; Dupuis, M.-È.; Villion, M.; Romero, D.A.; Barrangou, R.; Boyaval, P.; Fremaux, C.; Horvath, P.; Magadán, A.H.; Moineau, S. The CRISPR/Cas Bacterial Immune System Cleaves Bacteriophage and Plasmid DNA. Nature 2010, 468, 67–71. [Google Scholar] [CrossRef]
- Brouns, S.J.J.; Jore, M.M.; Lundgren, M.; Westra, E.R.; Slijkhuis, R.J.H.; Snijders, A.P.L.; Dickman, M.J.; Makarova, K.S.; Koonin, E.V.; van der Oost, J. Small CRISPR RNAs Guide Antiviral Defense in Prokaryotes. Science 2008, 321, 960–964. [Google Scholar] [CrossRef]
- Zheng, Y.; Li, J.; Wang, B.; Han, J.; Hao, Y.; Wang, S.; Ma, X.; Yang, S.; Ma, L.; Yi, L.; et al. Endogenous Type I CRISPR-Cas: From Foreign DNA Defense to Prokaryotic Engineering. Front. Bioeng. Biotechnol. 2020, 8, 62. [Google Scholar] [CrossRef] [PubMed]
- Xu, Z.; Chen, S.; Wu, W.; Wen, Y.; Cao, H. Type I CRISPR-Cas-Mediated Microbial Gene Editing and Regulation. AIMS Microbiol. 2023, 9, 780–800. [Google Scholar] [CrossRef]
- Cameron, P.; Coons, M.M.; Klompe, S.E.; Lied, A.M.; Smith, S.C.; Vidal, B.; Donohoue, P.D.; Rotstein, T.; Kohrs, B.W.; Nyer, D.B.; et al. Harnessing Type I CRISPR–Cas Systems for Genome Engineering in Human Cells. Nat. Biotechnol. 2019, 37, 1471–1477. [Google Scholar] [CrossRef] [PubMed]
- Fricke, T.; Smalakyte, D.; Lapinski, M.; Pateria, A.; Weige, C.; Pastor, M.; Kolano, A.; Winata, C.; Siksnys, V.; Tamulaitis, G.; et al. Targeted RNA Knockdown by a Type III CRISPR-Cas Complex in Zebrafish. CRISPR J. 2020, 3, 299–313. [Google Scholar] [CrossRef] [PubMed]
- Hidalgo-Cantabrana, C.; Goh, Y.J.; Pan, M.; Sanozky-Dawes, R.; Barrangou, R. Genome Editing Using the Endogenous Type I CRISPR-Cas System in Lactobacillus crispatus. Proc. Natl. Acad. Sci. USA 2019, 116, 15774–15783. [Google Scholar] [CrossRef] [PubMed]
- Jinek, M.; Chylinski, K.; Fonfara, I.; Hauer, M.; Doudna, J.A.; Charpentier, E. A Programmable Dual-RNA–Guided DNA Endonuclease in Adaptive Bacterial Immunity. Science 2012, 337, 816–821. [Google Scholar] [CrossRef] [PubMed]
- Fonfara, I.; Richter, H.; Bratovič, M.; Le Rhun, A.; Charpentier, E. The CRISPR-Associated DNA-Cleaving Enzyme Cpf1 Also Processes Precursor CRISPR RNA. Nature 2016, 532, 517–521. [Google Scholar] [CrossRef] [PubMed]
- Swarts, D.C.; van der Oost, J.; Jinek, M. Structural Basis for Guide RNA Processing and Seed-Dependent DNA Targeting by CRISPR-Cas12a. Mol. Cell 2017, 66, 221–233.e4. [Google Scholar] [CrossRef] [PubMed]
- Gao, L.; Cox, D.B.T.; Yan, W.X.; Manteiga, J.C.; Schneider, M.W.; Yamano, T.; Nishimasu, H.; Nureki, O.; Crosetto, N.; Zhang, F. Engineered Cpf1 Variants with Altered PAM Specificities. Nat. Biotechnol. 2017, 35, 789–792. [Google Scholar] [CrossRef]
- Tyumentseva, M.; Tyumentsev, A.; Akimkin, V. CRISPR/Cas9 Landscape: Current State and Future Perspectives. Int. J. Mol. Sci. 2023, 24, 16077. [Google Scholar] [CrossRef]
- Pacesa, M.; Pelea, O.; Jinek, M. Past, Present, and Future of CRISPR Genome Editing Technologies. Cell 2024, 187, 1076–1100. [Google Scholar] [CrossRef] [PubMed]
- Anders, C.; Niewoehner, O.; Duerst, A.; Jinek, M. Structural Basis of PAM-Dependent Target DNA Recognition by the Cas9 Endonuclease. Nature 2014, 513, 569–573. [Google Scholar] [CrossRef] [PubMed]
- Zetsche, B.; Gootenberg, J.S.; Abudayyeh, O.O.; Slaymaker, I.M.; Makarova, K.S.; Essletzbichler, P.; Volz, S.E.; Joung, J.; van der Oost, J.; Regev, A.; et al. Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell 2015, 163, 759–771. [Google Scholar] [CrossRef] [PubMed]
- Yuen, C.T.L.; Thean, D.G.L.; Chan, B.K.C.; Zhou, P.; Kwok, C.C.S.; Chu, H.Y.; Cheung, M.S.H.; Wang, B.; Chan, Y.M.; Mak, S.Y.L.; et al. High-Fidelity KKH Variant of Staphylococcus aureus Cas9 Nucleases with Improved Base Mismatch Discrimination. Nucleic Acids Res. 2022, 50, 1650–1660. [Google Scholar] [CrossRef]
- Wei, J.; Hou, L.; Liu, J.; Wang, Z.; Gao, S.; Qi, T.; Gao, S.; Sun, S.; Wang, Y. Closely Related Type II-C Cas9 Orthologs Recognize Diverse PAMs. Elife 2022, 11, e77825. [Google Scholar] [CrossRef]
- Agudelo, D.; Carter, S.; Velimirovic, M.; Duringer, A.; Rivest, J.-F.; Levesque, S.; Loehr, J.; Mouchiroud, M.; Cyr, D.; Waters, P.J.; et al. Versatile and Robust Genome Editing with Streptococcus thermophilus CRISPR1-Cas9. Genome Res. 2020, 30, 107–117. [Google Scholar] [CrossRef]
- Liu, J.; Wang, Y.; Wei, J.; Wang, S.; Li, M.; Huang, Z.; Zhang, S.; Liu, H.; Huang, J.; Wang, Y. Enhanced Genome Editing with a Streptococcus equinus Cas9. Commun. Biol. 2025, 8, 196. [Google Scholar] [CrossRef]
- Hu, J.H.; Miller, S.M.; Geurts, M.H.; Tang, W.; Chen, L.; Sun, N.; Zeina, C.M.; Gao, X.; Rees, H.A.; Lin, Z.; et al. Evolved Cas9 Variants with Broad PAM Compatibility and High DNA Specificity. Nature 2018, 556, 57–63. [Google Scholar] [CrossRef]
- Kim, E.; Koo, T.; Park, S.W.; Kim, D.; Kim, K.; Cho, H.-Y.; Song, D.W.; Lee, K.J.; Jung, M.H.; Kim, S.; et al. In Vivo Genome Editing with a Small Cas9 Orthologue Derived from Campylobacter jejuni. Nat. Commun. 2017, 8, 14500. [Google Scholar] [CrossRef]
- Walton, R.T.; Christie, K.A.; Whittaker, M.N.; Kleinstiver, B.P. Unconstrained Genome Targeting with Near-PAMless Engineered CRISPR-Cas9 Variants. Science 2020, 368, 290–296. [Google Scholar] [CrossRef]
- Kleinstiver, B.P.; Prew, M.S.; Tsai, S.Q.; Topkar, V.V.; Nguyen, N.T.; Zheng, Z.; Gonzales, A.P.W.; Li, Z.; Peterson, R.T.; Yeh, J.-R.J.; et al. Engineered CRISPR-Cas9 Nucleases with Altered PAM Specificities. Nature 2015, 523, 481–485. [Google Scholar] [CrossRef] [PubMed]
- Zhao, L.; Koseki, S.R.T.; Silverstein, R.A.; Amrani, N.; Peng, C.; Kramme, C.; Savic, N.; Pacesa, M.; Rodríguez, T.C.; Stan, T.; et al. PAM-Flexible Genome Editing with an Engineered Chimeric Cas9. Nat. Commun. 2023, 14, 6175. [Google Scholar] [CrossRef] [PubMed]
- Nishimasu, H.; Shi, X.; Ishiguro, S.; Gao, L.; Hirano, S.; Okazaki, S.; Noda, T.; Abudayyeh, O.O.; Gootenberg, J.S.; Mori, H.; et al. Engineered CRISPR-Cas9 Nuclease with Expanded Targeting Space. Science 2018, 361, 1259–1262. [Google Scholar] [CrossRef] [PubMed]
- Tóth, E.; Varga, É.; Kulcsár, P.I.; Kocsis-Jutka, V.; Krausz, S.L.; Nyeste, A.; Welker, Z.; Huszár, K.; Ligeti, Z.; Tálas, A.; et al. Improved LbCas12a Variants with Altered PAM Specificities Further Broaden the Genome Targeting Range of Cas12a Nucleases. Nucleic Acids Res. 2020, 48, 3722–3733. [Google Scholar] [CrossRef] [PubMed]
- Ran, F.A.; Cong, L.; Yan, W.X.; Scott, D.A.; Gootenberg, J.S.; Kriz, A.J.; Zetsche, B.; Shalem, O.; Wu, X.; Makarova, K.S.; et al. In Vivo Genome Editing Using Staphylococcus aureus Cas9. Nature 2015, 520, 186–191. [Google Scholar] [CrossRef]
- Fedorova, I.; Vasileva, A.; Selkova, P.; Abramova, M.; Arseniev, A.; Pobegalov, G.; Kazalov, M.; Musharova, O.; Goryanin, I.; Artamonova, D.; et al. PpCas9 from Pasteurella pneumotropica—A Compact Type II-C Cas9 Ortholog Active in Human Cells. Nucleic Acids Res. 2020, 48, 12297–12309. [Google Scholar] [CrossRef]
- Guo, C.; Ma, X.; Gao, F.; Guo, Y. Off-Target Effects in CRISPR/Cas9 Gene Editing. Front. Bioeng. Biotechnol. 2023, 11, 1143157. [Google Scholar] [CrossRef]
- Zhang, X.-H.; Tee, L.Y.; Wang, X.-G.; Huang, Q.-S.; Yang, S.-H. Off-Target Effects in CRISPR/Cas9-Mediated Genome Engineering. Mol. Ther. Nucleic Acids 2015, 4, e264. [Google Scholar] [CrossRef]
- Mosterd, C.; Moineau, S. Characterization of a Type II-A CRISPR-Cas System in Streptococcus mutans. mSphere 2020, 5, e00235-20. [Google Scholar] [CrossRef]
- Mosterd, C.; Moineau, S. Primed CRISPR-Cas Adaptation and Impaired Phage Adsorption in Streptococcus mutans. mSphere 2021, 6, e00185-21. [Google Scholar] [CrossRef]
- Gong, T.; Tang, B.; Zhou, X.; Zeng, J.; Lu, M.; Guo, X.; Peng, X.; Lei, L.; Gong, B.; Li, Y. Genome Editing in Streptococcus mutans through Self-targeting CRISPR Arrays. Mol. Oral Microbiol. 2018, 33, 440–449. [Google Scholar] [CrossRef] [PubMed]
- Lemay, M.-L.; Tremblay, D.M.; Moineau, S. Genome Engineering of Virulent Lactococcal Phages Using CRISPR-Cas9. ACS Synth. Biol. 2017, 6, 1351–1358. [Google Scholar] [CrossRef] [PubMed]
- Grafakou, A.; Mosterd, C.; de Waal, P.P.; van Rijswijck, I.M.H.; van Peij, N.N.M.E.; Mahony, J.; van Sinderen, D. Functional and Practical Insights into Three Lactococcal Antiphage Systems. Appl. Environ. Microbiol. 2024, 90, e0112024. [Google Scholar] [CrossRef] [PubMed]
- Grafakou, A.; Mosterd, C.; Beck, M.H.; Kelleher, P.; McDonnell, B.; de Waal, P.P.; van Rijswijck, I.M.H.; van Peij, N.N.M.E.; Cambillau, C.; Mahony, J.; et al. Discovery of Antiphage Systems in the Lactococcal Plasmidome. Nucleic Acids Res. 2024, 52, 9760–9776. [Google Scholar] [CrossRef] [PubMed]
- Deveau, H.; Labrie, S.J.; Chopin, M.-C.; Moineau, S. Biodiversity and Classification of Lactococcal Phages. Appl. Environ. Microbiol. 2006, 72, 4338–4346. [Google Scholar] [CrossRef] [PubMed]
- Mahony, J.; Murphy, J.; van Sinderen, D. Lactococcal 936-Type Phages and Dairy Fermentation Problems: From Detection to Evolution and Prevention. Front. Microbiol. 2012, 3, 335. [Google Scholar] [CrossRef]
- Mahony, J.; McDonnell, B.; Casey, E.; van Sinderen, D. Phage-Host Interactions of Cheese-Making Lactic Acid Bacteria. Annu. Rev. Food Sci. Technol. 2016, 7, 267–285. [Google Scholar] [CrossRef]
- Kok, J.; van Gijtenbeek, L.A.; de Jong, A.; van der Meulen, S.B.; Solopova, A.; Kuipers, O.P. The Evolution of Gene Regulation Research in Lactococcus lactis. FEMS Microbiol. Rev. 2017, 41, S220–S243. [Google Scholar] [CrossRef]
- Wegmann, U.; O’Connell-Motherway, M.; Zomer, A.; Buist, G.; Shearman, C.; Canchaya, C.; Ventura, M.; Goesmann, A.; Gasson, M.J.; Kuipers, O.P.; et al. Complete Genome Sequence of the Prototype Lactic Acid Bacterium Lactococcus lactis subsp. cremoris MG1363. J. Bacteriol. 2007, 189, 3256–3270. [Google Scholar] [CrossRef]
- Chylinski, K.; Le Rhun, A.; Charpentier, E. The TracrRNA and Cas9 Families of Type II CRISPR-Cas Immunity Systems. RNA Biol. 2013, 10, 726–737. [Google Scholar] [CrossRef]
- Deltcheva, E.; Chylinski, K.; Sharma, C.M.; Gonzales, K.; Chao, Y.; Pirzada, Z.A.; Eckert, M.R.; Vogel, J.; Charpentier, E. CRISPR RNA Maturation by Trans-Encoded Small RNA and Host Factor RNase III. Nature 2011, 471, 602–607. [Google Scholar] [CrossRef] [PubMed]
- Hynes, A.P.; Rousseau, G.M.; Lemay, M.-L.; Horvath, P.; Romero, D.A.; Fremaux, C.; Moineau, S. An Anti-CRISPR from a Virulent Streptococcal Phage Inhibits Streptococcus pyogenes Cas9. Nat. Microbiol. 2017, 2, 1374–1380. [Google Scholar] [CrossRef] [PubMed]
- Kupczok, A.; Neve, H.; Huang, K.D.; Hoeppner, M.P.; Heller, K.J.; Franz, C.M.A.P.; Dagan, T. Rates of Mutation and Recombination in Siphoviridae Phage Genome Evolution over Three Decades. Mol. Biol. Evol. 2018, 35, 1147–1159. [Google Scholar] [CrossRef] [PubMed]
- Sanjuán, R.; Nebot, M.R.; Chirico, N.; Mansky, L.M.; Belshaw, R. Viral Mutation Rates. J. Virol. 2010, 84, 9733–9748. [Google Scholar] [CrossRef] [PubMed]
- Doan, P.L.; Belanger, K.G.; Kreuzer, K.N. Two Types of Recombination Hotspots in Bacteriophage T4: One Requires DNA Damage and a Replication Origin and the Other Does Not. Genetics 2001, 157, 1077–1087. [Google Scholar] [CrossRef] [PubMed]
- Claisse, O.; Mosterd, C.; Le Marrec, C.; Samot, J. Defense Systems and Prophage Detection in Streptococcus mutans Strains. bioRxiv 2024. [Google Scholar] [CrossRef]
- Gleditzsch, D.; Pausch, P.; Müller-Esparza, H.; Özcan, A.; Guo, X.; Bange, G.; Randau, L. PAM Identification by CRISPR-Cas Effector Complexes: Diversified Mechanisms and Structures. RNA Biol. 2019, 16, 504–517. [Google Scholar] [CrossRef] [PubMed]
- Romiguier, J.; Ranwez, V.; Douzery, E.J.P.; Galtier, N. Contrasting GC-Content Dynamics across 33 Mammalian Genomes: Relationship with Life-History Traits and Chromosome Sizes. Genome Res. 2010, 20, 1001–1009. [Google Scholar] [CrossRef] [PubMed]
- Wong, C. UK First to Approve CRISPR Treatment for Diseases: What You Need to Know. Nature 2023, 623, 676–677. [Google Scholar] [CrossRef] [PubMed]
- O’Sullivan, D.J.; Klaenhammer, T.R. High- and Low-Copy-Number Lactococcus Shuttle Cloning Vectors with Features for Clone Screening. Gene 1993, 137, 227–231. [Google Scholar] [CrossRef] [PubMed]
- Gibson, D.G.; Young, L.; Chuang, R.-Y.; Venter, J.C.; Hutchison, C.A.; Smith, H.O. Enzymatic Assembly of DNA Molecules up to Several Hundred Kilobases. Nat. Methods 2009, 6, 343–345. [Google Scholar] [CrossRef] [PubMed]
- Martel, B.; Moineau, S. CRISPR-Cas: An Efficient Tool for Genome Engineering of Virulent Bacteriophages. Nucleic Acids Res. 2014, 42, 9504–9513. [Google Scholar] [CrossRef] [PubMed]
- Holo, H.; Nes, I.F. High-Frequency Transformation, by Electroporation, of Lactococcus lactis subsp. cremoris Grown with Glycine in Osmotically Stabilized Media. Appl. Environ. Microbiol. 1989, 55, 3119–3123. [Google Scholar] [CrossRef] [PubMed]
RNA ID | Sequence (5′-3′) |
---|---|
crRNA1 | AAUUGUUUUUCACUAGAUAGUUUUAGAGCUGUGUUGUUUCGAA |
crRNA2 | AUUUUCCUUUCUAUUAUCUGUUUUAGAGCUGUGUUGUUUCGAA |
crRNA3 | AUAUCAAGCUCCGCUUGCUGUUUUAGAGCUGUGUUGUUUCGAA |
crRNA5 | CCAUCAAAGACCCUAACCCGUUUUAGAGCUGUGUUGUUU |
tracrRNA | UUGGAACUAUUCGAAACAACACAGCAAGUUAAAAUAAGGUUUAUCCGUAUUCAACUUGAAAAAGUGCGCACCGAUUCGGUGCUUUUUUA |
Strains | Titre (PFUs/mL) | EOP | WT | Deletion Mutant | Mixed Population |
---|---|---|---|---|---|
pTRKL2 | 3.0 ± 0.5 × 108 | N/A | 96 | 0 | 4 |
SmutCas9 | 3.4 ± 0.7 × 108 | N/A | 94 | 0 | 6 |
SmutCas9-49 | 2.9 ± 0.1 × 108 | 0.85 | 0 | 0 | 100 |
pL2Cas9 | 3.9 ± 0.7 × 108 | N/A | 98 | 0 | 2 |
pL2Cas9-49 | 1.9 ± 0.1 × 107 | 0.05 | 0 | 100 | 0 |
Strains | Titre (PFUs/mL) | EOP | WT | Deletion Mutant | Mixed Population |
---|---|---|---|---|---|
pTRKL2 | 2.5 ± 0.1 × 108 | N/A | 0 | 0 | 100 |
SmutCas9 | 2.6 ± 0.7 × 108 | N/A | 0 | 0 | 100 |
SmutCas9-44 | 2.5 ± 0.1 × 108 | 0.96 | 0 | 0 | 100 |
pL2Cas9 | 2.2 ± 1.3 × 108 | N/A | 0 | 0 | 100 |
pL2Cas9-44 | 2.6 ± 0.1 × 104 | 1.2 × 10−4 | 1 | 0 | 99 |
Primer | Sequence (5′-3′) |
---|---|
tracrRNA_F | AACTATTCGAAACAACACAG |
PolyT_R | TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT |
CB13.10 | ACCTCCTGCAAAGTCATCTG |
CB13.42 | GCAAATGACAGAAGAACAGC |
CB14.6 | GCTAAAACCGAACAATAAATGTC |
p2.27 | GCACAACCTATTGTAAAACC |
pTRKL2_F | AAATATAGAAATATTTCTGTATTTTTTGGGCCAGTGAATTCCCGGGGATC |
pTRKL2_R | AAGTGTCTTTTATGGGATTTTCTTTAAATCTTCTATTTAATCACTTTGAC |
SmutCas9_F | GTCAAAGTGATTAAATAGAAGATTTAAAGAAAATCCCATAAAA |
SmutCas9_R | GATCCCCGGGAATTCACTGGCCCAAAAAATACAGAAATATTTC |
spacer44_F | AAACTAGCCATGTTTTTATCTCCTTTCTTGATGAG |
spacer44_R | AAAACTCATCAAGAAAGGAGATAAAAACATGGCTA |
spacer49_F | AAACCATCTATCTTATTGGTAGTGGCTGGAGTATG |
spacer49_R | AAAACATACTCCAGCCACTACCAATAAGATAGATG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mosterd, C.; Moineau, S. Insight into crRNA Processing in Streptococcus mutans P42S and Application of SmutCas9 in Genome Editing. Int. J. Mol. Sci. 2025, 26, 2005. https://doi.org/10.3390/ijms26052005
Mosterd C, Moineau S. Insight into crRNA Processing in Streptococcus mutans P42S and Application of SmutCas9 in Genome Editing. International Journal of Molecular Sciences. 2025; 26(5):2005. https://doi.org/10.3390/ijms26052005
Chicago/Turabian StyleMosterd, Cas, and Sylvain Moineau. 2025. "Insight into crRNA Processing in Streptococcus mutans P42S and Application of SmutCas9 in Genome Editing" International Journal of Molecular Sciences 26, no. 5: 2005. https://doi.org/10.3390/ijms26052005
APA StyleMosterd, C., & Moineau, S. (2025). Insight into crRNA Processing in Streptococcus mutans P42S and Application of SmutCas9 in Genome Editing. International Journal of Molecular Sciences, 26(5), 2005. https://doi.org/10.3390/ijms26052005