Temporal Transcriptomic Analysis of Periodontal Disease Progression and Its Molecular Links to Systemic Diseases
Abstract
1. Introduction
2. Results
2.1. Temporal Transcriptomic Data from Healthy and Periodontitis-Induced Gingival Tissues
2.2. Differentially Expressed Genes (DEGs) Between Healthy and Periodontitis-Induced Gingival Tissues at Each Time Point
2.3. Gene Functions in Each Cluster During the Pathogenesis of Periodontitis
2.4. Transcription Factor (TF) Enrichment Across Gene Clusters
3. Discussion
3.1. Dynamic Gene Expression in Periodontitis Progression
3.2. Cluster-Specific Insights into Periodontitis Pathogenesis
3.3. Implications in Systemic Conditions
3.3.1. Diabetes Mellitus (DM) and Metabolic Disorders
3.3.2. Cardiovascular Diseases (CVDs)
3.3.3. Rheumatoid Arthritis (RA)
3.3.4. Neurodegenerative Diseases
3.4. Potential Biomarkers and Therapeutic Targets for Disease Management
3.5. Limitations and Future Directions
4. Materials and Methods
4.1. Mice
4.2. Developing a Mouse Ligature-Induced Periodontitis Model
4.3. Quantitative Assessment of Alveolar Bone Loss
4.4. RNA-seq Analysis
4.5. Quantitative Reverse Transcription PCR (qPCR)
4.6. Transcription Factor (TF) Enrichment Analysis
4.7. Statistical Analyses
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A
| Gene | Sequence |
|---|---|
| Saa3 | F: AGCAGAGGACTCAAGAGCTG |
| R: TAGTTGCTCCTCTTCTCGGG | |
| Sele | F: CTGCTGGAGTCATGAATGCC |
| R: ACCAGATGTGTGTAGTCCCG | |
| Col18a1 | F: CCTCTAGGCTGCAGGATCTC |
| R: AGGACATCTCTGCCGTCAAA | |
| Lyz2 | F: TACTGCAGCTCATTCGGTCT |
| R: GCTGACTGACAAGGGAGACT | |
| Cxcl5 | F: TGGGAACTCAAACCTTGGTC |
| R: ATCGTTGTTCCCATCCACAT | |
| Ctsk | F: CAGCAGAACGGAGGCATTGA |
| R: CTTTGCCGTGGCGTTATACATACA | |
| Tbp | F: GAGTTGCTTGCTCTGTGCTG |
| R: CTGGCTTGTGTGGGAAAGAT |
References
- Hajishengallis, G. Periodontitis: From microbial immune subversion to systemic inflammation. Nat. Rev. Immunol. 2015, 15, 30–44. [Google Scholar] [CrossRef] [PubMed]
- Cekici, A.; Kantarci, A.; Hasturk, H.; Van Dyke, T.E. Inflammatory and immune pathways in the pathogenesis of periodontal disease. Periodontol. 2000 2014, 64, 57–80. [Google Scholar] [CrossRef] [PubMed]
- Avula, H.; Chakravarthy, Y. Models of periodontal disease pathogenesis: A journey through time. J. Indian Soc. Periodontol. 2022, 26, 204–212. [Google Scholar] [CrossRef] [PubMed]
- Isola, G.; Santonocito, S.; Lupi, S.M.; Polizzi, A.; Sclafani, R.; Patini, R.; Marchetti, E. Periodontal Health and Disease in the Context of Systemic Diseases. Mediat. Inflamm. 2023, 2023, 9720947. [Google Scholar] [CrossRef]
- Villoria, G.E.M.; Fischer, R.G.; Tinoco, E.M.B.; Meyle, J.; Loos, B.G. Periodontal disease: A systemic condition. Periodontol. 2000 2024, 96, 7–19. [Google Scholar] [CrossRef]
- Martinez-Garcia, M.; Hernandez-Lemus, E. Periodontal Inflammation and Systemic Diseases: An Overview. Front. Physiol. 2021, 12, 709438. [Google Scholar] [CrossRef]
- Maekawa, T.; Krauss, J.L.; Abe, T.; Jotwani, R.; Triantafilou, M.; Triantafilou, K.; Hashim, A.; Hoch, S.; Curtis, M.A.; Nussbaum, G.; et al. Porphyromonas gingivalis manipulates complement and TLR signaling to uncouple bacterial clearance from inflammation and promote dysbiosis. Cell Host Microbe 2014, 15, 768–778. [Google Scholar] [CrossRef]
- Cichonska, D.; Mazus, M.; Kusiak, A. Recent Aspects of Periodontitis and Alzheimer’s Disease-A Narrative Review. Int. J. Mol. Sci. 2024, 25, 2612. [Google Scholar] [CrossRef]
- Chen, C.; Wang, J.; Pan, D.; Wang, X.; Xu, Y.; Yan, J.; Wang, L.; Yang, X.; Yang, M.; Liu, G.P. Applications of multi-omics analysis in human diseases. MedComm 2023, 4, e315. [Google Scholar] [CrossRef]
- Lundmark, A.; Gerasimcik, N.; Bage, T.; Jemt, A.; Mollbrink, A.; Salmen, F.; Lundeberg, J.; Yucel-Lindberg, T. Gene expression profiling of periodontitis-affected gingival tissue by spatial transcriptomics. Sci. Rep. 2018, 8, 9370. [Google Scholar] [CrossRef]
- Maekawa, S.; Onizuka, S.; Katagiri, S.; Hatasa, M.; Ohsugi, Y.; Sasaki, N.; Watanabe, K.; Ohtsu, A.; Komazaki, R.; Ogura, K.; et al. RNA sequencing for ligature induced periodontitis in mice revealed important role of S100A8 and S100A9 for periodontal destruction. Sci. Rep. 2019, 9, 14663. [Google Scholar] [CrossRef] [PubMed]
- Lambert, S.A.; Jolma, A.; Campitelli, L.F.; Das, P.K.; Yin, Y.; Albu, M.; Chen, X.; Taipale, J.; Hughes, T.R.; Weirauch, M.T. The Human Transcription Factors. Cell 2018, 172, 650–665. [Google Scholar] [CrossRef] [PubMed]
- Lee, T.I.; Young, R.A. Transcriptional regulation and its misregulation in disease. Cell 2013, 152, 1237–1251. [Google Scholar] [CrossRef]
- Vicencio, E.; Nunez-Belmar, J.; Cardenas, J.P.; Cortes, B.I.; Martin, A.J.M.; Maracaja-Coutinho, V.; Rojas, A.; Cafferata, E.A.; Gonzalez-Osuna, L.; Vernal, R.; et al. Transcriptional Signatures and Network-Based Approaches Identified Master Regulators Transcription Factors Involved in Experimental Periodontitis Pathogenesis. Int. J. Mol. Sci. 2023, 24, 14835. [Google Scholar] [CrossRef] [PubMed]
- Kondo, T.; Gleason, A.; Okawa, H.; Hokugo, A.; Nishimura, I. Mouse gingival single-cell transcriptomic atlas identified a novel fibroblast subpopulation activated to guide oral barrier immunity in periodontitis. eLife 2023, 12, RP88183. [Google Scholar] [CrossRef] [PubMed]
- Kitamoto, S.; Nagao-Kitamoto, H.; Jiao, Y.; Gillilland, M.G., 3rd; Hayashi, A.; Imai, J.; Sugihara, K.; Miyoshi, M.; Brazil, J.C.; Kuffa, P.; et al. The Intermucosal Connection between the Mouth and Gut in Commensal Pathobiont-Driven Colitis. Cell 2020, 182, 447–462.e14. [Google Scholar] [CrossRef]
- Pulendran, B.; Davis, M.M. The science and medicine of human immunology. Science 2020, 369, eaay4014. [Google Scholar] [CrossRef]
- Williams, D.W.; Greenwell-Wild, T.; Brenchley, L.; Dutzan, N.; Overmiller, A.; Sawaya, A.P.; Webb, S.; Martin, D.; Hajishengallis, G.; Divaris, K.; et al. Human oral mucosa cell atlas reveals a stromal-neutrophil axis regulating tissue immunity. Cell 2021, 184, 4090–4104.e15. [Google Scholar] [CrossRef]
- Caetano, A.J.; Redhead, Y.; Karim, F.; Dhami, P.; Kannambath, S.; Nuamah, R.; Volponi, A.A.; Nibali, L.; Booth, V.; D’Agostino, E.M.; et al. Spatially resolved transcriptomics reveals pro-inflammatory fibroblast involved in lymphocyte recruitment through CXCL8 and CXCL10. eLife 2023, 12, e81525. [Google Scholar] [CrossRef]
- Qian, S.J.; Huang, Q.R.; Chen, R.Y.; Mo, J.J.; Zhou, L.Y.; Zhao, Y.; Li, B.; Lai, H.C. Single-Cell RNA Sequencing Identifies New Inflammation-Promoting Cell Subsets in Asian Patients With Chronic Periodontitis. Front. Immunol. 2021, 12, 711337. [Google Scholar] [CrossRef]
- Carow, B.; Rottenberg, M.E. SOCS3, a Major Regulator of Infection and Inflammation. Front. Immunol. 2014, 5, 58. [Google Scholar] [CrossRef] [PubMed]
- Meixner, A.; Karreth, F.; Kenner, L.; Penninger, J.M.; Wagner, E.F. Jun and JunD-dependent functions in cell proliferation and stress response. Cell Death Differ. 2010, 17, 1409–1419. [Google Scholar] [CrossRef] [PubMed]
- Takahashi, N.; Sulijaya, B.; Yamada-Hara, M.; Tsuzuno, T.; Tabeta, K.; Yamazaki, K. Gingival epithelial barrier: Regulation by beneficial and harmful microbes. Tissue Barriers 2019, 7, e1651158. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Xu, P.; Wang, L.; Feng, M.; Chen, D.; Yu, X.; Lu, Y. Molecular biology of BPIFB1 and its advances in disease. Ann. Transl. Med. 2020, 8, 651. [Google Scholar] [CrossRef]
- Li, W.; Zhang, Z.; Wang, Z.M. Differential immune cell infiltrations between healthy periodontal and chronic periodontitis tissues. BMC Oral Health 2020, 20, 293. [Google Scholar] [CrossRef]
- Trindade, B.C.; Chen, G.Y. NOD1 and NOD2 in inflammatory and infectious diseases. Immunol. Rev. 2020, 297, 139–161. [Google Scholar] [CrossRef]
- Zhang, J.; Huang, S.; Zhu, Z.; Gatt, A.; Liu, J. E-selectin in vascular pathophysiology. Front. Immunol. 2024, 15, 1401399. [Google Scholar] [CrossRef]
- Sharma, R.; Kalot, R.; Levin, Y.; Babayeva, S.; Kachurina, N.; Chung, C.F.; Liu, K.J.; Bouchard, M.; Torban, E. The CPLANE protein Fuzzy regulates ciliogenesis by suppressing actin polymerization at the base of the primary cilium via p190A RhoGAP. Development 2024, 151, dev202322. [Google Scholar] [CrossRef]
- Bassani, B.; Cucchiara, M.; Butera, A.; Kayali, O.; Chiesa, A.; Palano, M.T.; Olmeo, F.; Gallazzi, M.; Dellavia, C.P.B.; Mortara, L.; et al. Neutrophils’ Contribution to Periodontitis and Periodontitis-Associated Cardiovascular Diseases. Int. J. Mol. Sci. 2023, 24, 15370. [Google Scholar] [CrossRef]
- Smeitink, J.A.; Zeviani, M.; Turnbull, D.M.; Jacobs, H.T. Mitochondrial medicine: A metabolic perspective on the pathology of oxidative phosphorylation disorders. Cell Metab. 2006, 3, 9–13. [Google Scholar] [CrossRef]
- Nantakeeratipat, T.; Fujihara, C.; Nogimori, T.; Matsumoto, M.; Yamamoto, T.; Murakami, S. Lysosomal acid lipase regulates bioenergetic process during the cytodifferentiation of human periodontal ligament cells. Biochem. Biophys. Res. Commun. 2023, 662, 84–92. [Google Scholar] [CrossRef] [PubMed]
- Liang, Y.; Zhao, J.; Dai, T.; Li, X.; Chen, L.; He, Z.; Guo, M.; Zhao, J.; Xu, L. A review of KLF4 and inflammatory disease: Current status and future perspective. Pharmacol. Res. 2024, 207, 107345. [Google Scholar] [CrossRef]
- Jiao, L.; Liu, Y.; Yu, X.Y.; Pan, X.; Zhang, Y.; Tu, J.; Song, Y.H.; Li, Y. Ribosome biogenesis in disease: New players and therapeutic targets. Signal Transduct. Target. Ther. 2023, 8, 15. [Google Scholar] [CrossRef] [PubMed]
- Rahl, P.B.; Young, R.A. MYC and transcription elongation. Cold Spring Harb. Perspect. Med. 2014, 4, a020990. [Google Scholar] [CrossRef] [PubMed]
- Komori, T. Roles of Runx2 in Skeletal Development. Adv. Exp. Med. Biol. 2017, 962, 83–93. [Google Scholar]
- Cao, M.; Wang, L.; Xu, D.; Bi, X.; Guo, S.; Xu, Z.; Chen, L.; Zheng, D.; Li, P.; Xu, J.; et al. The synergistic interaction landscape of chromatin regulators reveals their epigenetic regulation mechanisms across five cancer cell lines. Comput. Struct. Biotechnol. J. 2022, 20, 5028–5039. [Google Scholar] [CrossRef]
- Kanungo, S.; Wells, K.; Tribett, T.; El-Gharbawy, A. Glycogen metabolism and glycogen storage disorders. Ann. Transl. Med. 2018, 6, 474. [Google Scholar] [CrossRef]
- She, H.; Yang, Q.; Shepherd, K.; Smith, Y.; Miller, G.; Testa, C.; Mao, Z. Direct regulation of complex I by mitochondrial MEF2D is disrupted in a mouse model of Parkinson disease and in human patients. J. Clin. Investig. 2011, 121, 930–940. [Google Scholar] [CrossRef]
- Zammit, P.S. Function of the myogenic regulatory factors Myf5, MyoD, Myogenin and MRF4 in skeletal muscle, satellite cells and regenerative myogenesis. Semin. Cell Dev. Biol. 2017, 72, 19–32. [Google Scholar] [CrossRef]
- Faralli, H.; Dilworth, F.J. Turning on myogenin in muscle: A paradigm for understanding mechanisms of tissue-specific gene expression. Int. J. Genom. 2012, 2012, 836374. [Google Scholar] [CrossRef]
- Zhang, G.; Ma, Z.; Ma, Z.; Liu, P.; Zhang, L.; Lian, Z.; Guo, C. SUZ12-Increased NRF2 Alleviates Cardiac Ischemia/Reperfusion Injury by Regulating Apoptosis, Inflammation, and Ferroptosis. Cardiovasc. Toxicol. 2024, 25, 97–109. [Google Scholar] [CrossRef] [PubMed]
- Giridharan, S.; Srinivasan, M. Mechanisms of NF-kappaB p65 and strategies for therapeutic manipulation. J. Inflamm. Res. 2018, 11, 407–419. [Google Scholar] [CrossRef] [PubMed]
- Paranjapye, A.; Mutolo, M.J.; Ebron, J.S.; Leir, S.H.; Harris, A. The FOXA1 transcriptional network coordinates key functions of primary human airway epithelial cells. Am. J. Physiol.-Lung Cell. Mol. Physiol. 2020, 319, L126–L136. [Google Scholar] [CrossRef] [PubMed]
- Smirnov, A.; Lena, A.M.; Cappello, A.; Panatta, E.; Anemona, L.; Bischetti, S.; Annicchiarico-Petruzzelli, M.; Mauriello, A.; Melino, G.; Candi, E. ZNF185 is a p63 target gene critical for epidermal differentiation and squamous cell carcinoma development. Oncogene 2019, 38, 1625–1638. [Google Scholar] [CrossRef]
- Blackledge, N.P.; Klose, R.J. The molecular principles of gene regulation by Polycomb repressive complexes. Nat. Rev. Mol. Cell Biol. 2021, 22, 815–833. [Google Scholar] [CrossRef]
- Yap, K.L.; Li, S.; Munoz-Cabello, A.M.; Raguz, S.; Zeng, L.; Mujtaba, S.; Gil, J.; Walsh, M.J.; Zhou, M.M. Molecular interplay of the noncoding RNA ANRIL and methylated histone H3 lysine 27 by polycomb CBX7 in transcriptional silencing of INK4a. Mol. Cell 2010, 38, 662–674. [Google Scholar] [CrossRef]
- Reddy, M.A.; Tanwar, V.S.; Zhang, L.; Lanting, L.L.; Wang, M.; Pandey, P.; Chen, Z.; Wu, X.; Natarajan, R. 453-P: Role of JARID2 in Regulating Inflammatory Genes via Epigenetic Mechanisms in Monocyte/Macrophages in Type 2 Diabetes. Diabetes 2022, 71 (Suppl. 1), 453-P. [Google Scholar] [CrossRef]
- Wang, C.H.; Wang, C.C.; Huang, H.C.; Wei, Y.H. Mitochondrial dysfunction leads to impairment of insulin sensitivity and adiponectin secretion in adipocytes. FEBS J. 2013, 280, 1039–1050. [Google Scholar] [CrossRef]
- Ashcroft, F.M.; Rohm, M.; Clark, A.; Brereton, M.F. Is Type 2 Diabetes a Glycogen Storage Disease of Pancreatic beta Cells? Cell Metab. 2017, 26, 17–23. [Google Scholar] [CrossRef]
- Guerrero-Hernandez, A.; Verkhratsky, A. Calcium signalling in diabetes. Cell Calcium 2014, 56, 297–301. [Google Scholar] [CrossRef]
- Agrafioti, P.; Morin-Baxter, J.; Tanagala, K.K.K.; Dubey, S.; Sims, P.; Lalla, E.; Momen-Heravi, F. Decoding the role of macrophages in periodontitis and type 2 diabetes using single-cell RNA-sequencing. FASEB J. 2022, 36, e22136. [Google Scholar] [CrossRef] [PubMed]
- Su, W.Y.; Tian, L.Y.; Guo, L.P.; Huang, L.Q.; Gao, W.Y. PI3K signaling-regulated metabolic reprogramming: From mechanism to application. Biochim. Biophys. Acta Rev. Cancer 2023, 1878, 188952. [Google Scholar] [CrossRef] [PubMed]
- Ding, Q.; Gao, Z.; Chen, K.; Zhang, Q.; Hu, S.; Zhao, L. Inflammation-Related Epigenetic Modification: The Bridge Between Immune and Metabolism in Type 2 Diabetes. Front. Immunol. 2022, 13, 883410. [Google Scholar] [CrossRef] [PubMed]
- Sanz, M.; Marco Del Castillo, A.; Jepsen, S.; Gonzalez-Juanatey, J.R.; D’Aiuto, F.; Bouchard, P.; Chapple, I.; Dietrich, T.; Gotsman, I.; Graziani, F.; et al. Periodontitis and cardiovascular diseases: Consensus report. J. Clin. Periodontol. 2020, 47, 268–288. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Y.; Qian, Y.; Sun, Z.; Shen, X.; Cai, Y.; Li, L.; Wang, Z. Role of PI3K in the Progression and Regression of Atherosclerosis. Front. Pharmacol. 2021, 12, 632378. [Google Scholar] [CrossRef]
- Kim, Y.; Phan, D.; van Rooij, E.; Wang, D.Z.; McAnally, J.; Qi, X.; Richardson, J.A.; Hill, J.A.; Bassel-Duby, R.; Olson, E.N. The MEF2D transcription factor mediates stress-dependent cardiac remodeling in mice. J. Clin. Investig. 2008, 118, 124–132. [Google Scholar] [CrossRef]
- Kolodziejczyk, S.M.; Wang, L.; Balazsi, K.; DeRepentigny, Y.; Kothary, R.; Megeney, L.A. MEF2 is upregulated during cardiac hypertrophy and is required for normal post-natal growth of the myocardium. Curr. Biol. 1999, 9, 1203–1206. [Google Scholar] [CrossRef]
- Tapashetti, R.P.; Guvva, S.; Patil, S.R.; Sharma, S.; Pushpalatha, H.M. C-reactive Protein as Predict of Increased Carotid Intima Media Thickness in Patients with Chronic Periodontitis. J. Int. Oral Health 2014, 6, 47–52. [Google Scholar]
- de Molon, R.S.; Rossa, C., Jr.; Thurlings, R.M.; Cirelli, J.A.; Koenders, M.I. Linkage of Periodontitis and Rheumatoid Arthritis: Current Evidence and Potential Biological Interactions. Int. J. Mol. Sci. 2019, 20, 4541. [Google Scholar] [CrossRef]
- Alunno, A.; Carubbi, F.; Giacomelli, R.; Gerli, R. Cytokines in the pathogenesis of rheumatoid arthritis: New players and therapeutic targets. BMC Rheumatol. 2017, 1, 3. [Google Scholar] [CrossRef]
- Plachokova, A.S.; Gjaltema, J.; Hagens, E.R.C.; Hashemi, Z.; Knuppe, T.B.A.; Kootstra, T.J.M.; Visser, A.; Bloem, B.R. Periodontitis: A Plausible Modifiable Risk Factor for Neurodegenerative Diseases? A Comprehensive Review. Int. J. Mol. Sci. 2024, 25, 4504. [Google Scholar] [CrossRef] [PubMed]
- Fu, J.; Huang, Y.; Bao, T.; Liu, C.; Liu, X.; Chen, X. The role of Th17 cells/IL-17A in AD, PD, ALS and the strategic therapy targeting on IL-17A. J. Neuroinflammation 2022, 19, 98. [Google Scholar] [CrossRef]
- Wu, D.T.; Cho, Y.W.; Spalti, M.D.; Bishara, M.; Nguyen, T.T. The link between periodontitis and Alzheimer’s disease–emerging clinical evidence. Dent. Rev. 2023, 3, 100062. [Google Scholar] [CrossRef]
- Fruhwurth, S.; Zetterberg, H.; Paludan, S.R. Microglia and amyloid plaque formation in Alzheimer’s disease—Evidence, possible mechanisms, and future challenges. J. Neuroimmunol. 2024, 390, 578342. [Google Scholar] [CrossRef] [PubMed]
- Weng, H.R.; Taing, K.; Chen, L.; Penney, A. EZH2 Methyltransferase Regulates Neuroinflammation and Neuropathic Pain. Cells 2023, 12, 1058. [Google Scholar] [CrossRef]
- Wang, W.; Qin, X.; Wang, R.; Xu, J.; Wu, H.; Khalid, A.; Jiang, H.; Liu, D.; Pan, F. EZH2 is involved in vulnerability to neuroinflammation and depression-like behaviors induced by chronic stress in different aged mice. J. Affect. Disord. 2020, 272, 452–464. [Google Scholar] [CrossRef]
- Cao, Y.; Li, L.; Fan, Z. The role and mechanisms of polycomb repressive complex 2 on the regulation of osteogenic and neurogenic differentiation of stem cells. Cell Prolif. 2021, 54, e13032. [Google Scholar] [CrossRef]
- Hu, D.; Sheeja Prabhakaran, H.; Zhang, Y.Y.; Luo, G.; He, W.; Liou, Y.C. Mitochondrial dysfunction in sepsis: Mechanisms and therapeutic perspectives. Crit. Care 2024, 28, 292. [Google Scholar] [CrossRef]
- Deng, Y.; Xiao, J.; Ma, L.; Wang, C.; Wang, X.; Huang, X.; Cao, Z. Mitochondrial Dysfunction in Periodontitis and Associated Systemic Diseases: Implications for Pathomechanisms and Therapeutic Strategies. Int. J. Mol. Sci. 2024, 25, 1024. [Google Scholar] [CrossRef]
- Pulik, L.; Legosz, P.; Motyl, G. Matrix metalloproteinases in rheumatoid arthritis and osteoarthritis: A state of the art review. Reumatologia 2023, 61, 191–201. [Google Scholar] [CrossRef]
- Egeblad, M.; Werb, Z. New functions for the matrix metalloproteinases in cancer progression. Nat. Rev. Cancer 2002, 2, 161–174. [Google Scholar] [CrossRef] [PubMed]
- Ghaleb, A.M.; Yang, V.W. Kruppel-like factor 4 (KLF4): What we currently know. Gene 2017, 611, 27–37. [Google Scholar] [CrossRef] [PubMed]
- Fadous-Khalife, M.C.; Aloulou, N.; Jalbout, M.; Hadchity, J.; Aftimos, G.; Paris, F.; Hadchity, E. Kruppel-like factor 4: A new potential biomarker of lung cancer. Mol. Clin. Oncol. 2016, 5, 35–40. [Google Scholar] [CrossRef]
- Yang, C.; Xiao, X.; Huang, L.; Zhou, F.; Chen, L.H.; Zhao, Y.Y.; Qu, S.L.; Zhang, C. Role of Kruppel-like factor 4 in atherosclerosis. Clin. Chim. Acta 2021, 512, 135–141. [Google Scholar] [CrossRef] [PubMed]
- Piantadosi, C.A.; Suliman, H.B. Transcriptional control of mitochondrial biogenesis and its interface with inflammatory processes. Biochim. Biophys. Acta 2012, 1820, 532–541. [Google Scholar] [CrossRef]
- Zhu, H.X.; Shi, L.; Zhang, Y.; Zhu, Y.C.; Bai, C.X.; Wang, X.D.; Zhou, J.B. Myocyte enhancer factor 2D provides a cross-talk between chronic inflammation and lung cancer. J. Transl. Med. 2017, 15, 65. [Google Scholar] [CrossRef]
- Kitchen, G.B.; Hopwood, T.; Gali Ramamoorthy, T.; Downton, P.; Begley, N.; Hussell, T.; Dockrell, D.H.; Gibbs, J.E.; Ray, D.W.; Loudon, A.S.I. The histone methyltransferase Ezh2 restrains macrophage inflammatory responses. FASEB J. 2021, 35, e21843. [Google Scholar] [CrossRef]
- Ren, J.; Huang, D.; Li, R.; Wang, W.; Zhou, C. Control of mesenchymal stem cell biology by histone modifications. Cell Biosci. 2020, 10, 11. [Google Scholar] [CrossRef]
- Fujihara, C.; Murakami, K.; Magi, S.; Motooka, D.; Nantakeeratipat, T.; Canela, A.; Tanaka, R.J.; Okada, M.; Murakami, S. Omics-Based Mathematical Modeling Unveils Pathogenesis of Periodontitis in an Experimental Murine Model. J. Dent. Res. 2023, 102, 1468–1477. [Google Scholar] [CrossRef]
- Abe, T.; Hajishengallis, G. Optimization of the ligature-induced periodontitis model in mice. J. Immunol. Methods 2013, 394, 49–54. [Google Scholar] [CrossRef]
- Zhong, S.; Joung, J.G.; Zheng, Y.; Chen, Y.R.; Liu, B.; Shao, Y.; Xiang, J.Z.; Fei, Z.; Giovannoni, J.J. High-throughput illumina strand-specific RNA sequencing library preparation. Cold Spring Harb. Protoc. 2011, 2011, 940–949. [Google Scholar] [CrossRef]
- Dobin, A.; Davis, C.A.; Schlesinger, F.; Drenkow, J.; Zaleski, C.; Jha, S.; Batut, P.; Chaisson, M.; Gingeras, T.R. STAR: Ultrafast universal RNA-seq aligner. Bioinformatics 2013, 29, 15–21. [Google Scholar] [CrossRef]
- Liao, Y.; Smyth, G.K.; Shi, W. featureCounts: An efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics 2014, 30, 923–930. [Google Scholar] [CrossRef]
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef]
- Kanehisa, M.; Goto, S. KEGG: Kyoto encyclopedia of genes and genomes. Nucleic Acids Res. 2000, 28, 27–30. [Google Scholar] [CrossRef]
- Gillespie, M.; Jassal, B.; Stephan, R.; Milacic, M.; Rothfels, K.; Senff-Ribeiro, A.; Griss, J.; Sevilla, C.; Matthews, L.; Gong, C.; et al. The reactome pathway knowledgebase 2022. Nucleic Acids Res. 2022, 50, D687–D692. [Google Scholar] [CrossRef]
- Yu, G.; Wang, L.G.; Han, Y.; He, Q.Y. clusterProfiler: An R package for comparing biological themes among gene clusters. OMICS 2012, 16, 284–287. [Google Scholar] [CrossRef]
- Zou, Z.; Ohta, T.; Oki, S. ChIP-Atlas 3.0: A data-mining suite to explore chromosome architecture together with large-scale regulome data. Nucleic Acids Res. 2024, 52, W45–W53. [Google Scholar] [CrossRef]





Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Nantakeeratipat, T.; Fujihara, C.; Takedachi, M. Temporal Transcriptomic Analysis of Periodontal Disease Progression and Its Molecular Links to Systemic Diseases. Int. J. Mol. Sci. 2025, 26, 1998. https://doi.org/10.3390/ijms26051998
Nantakeeratipat T, Fujihara C, Takedachi M. Temporal Transcriptomic Analysis of Periodontal Disease Progression and Its Molecular Links to Systemic Diseases. International Journal of Molecular Sciences. 2025; 26(5):1998. https://doi.org/10.3390/ijms26051998
Chicago/Turabian StyleNantakeeratipat, Teerachate, Chiharu Fujihara, and Masahide Takedachi. 2025. "Temporal Transcriptomic Analysis of Periodontal Disease Progression and Its Molecular Links to Systemic Diseases" International Journal of Molecular Sciences 26, no. 5: 1998. https://doi.org/10.3390/ijms26051998
APA StyleNantakeeratipat, T., Fujihara, C., & Takedachi, M. (2025). Temporal Transcriptomic Analysis of Periodontal Disease Progression and Its Molecular Links to Systemic Diseases. International Journal of Molecular Sciences, 26(5), 1998. https://doi.org/10.3390/ijms26051998

