Next Article in Journal
Effect of Co-Crosslinking Reaction on the Morphology of Octavinyl Polyhedral Oligomeric Silsesquioxane/Natural Rubber Composites
Previous Article in Journal
Temporal Transcriptomic Analysis of Periodontal Disease Progression and Its Molecular Links to Systemic Diseases
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Function of lamp2 Gene Response to Vibrio vulnificus Infection and LPS Stimulation in the Half-Smooth Tongue Sole (Cynoglossus semilaevis)

1
Ocean College, Hebei Agricultural University, Qinhuangdao 066009, China
2
Hebei Key Laboratory of the Bohai Sea Fish Germplasm Resources Conservation and Utilization, Beidaihe Central Experiment Station, Chinese Academy of Fishery Sciences, Qinhuangdao 066100, China
3
Bohai Sea Fishery Research Center, Chinese Academy of Fishery Sciences, Qinhuangdao 066100, China
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Int. J. Mol. Sci. 2025, 26(5), 1999; https://doi.org/10.3390/ijms26051999
Submission received: 8 January 2025 / Revised: 21 February 2025 / Accepted: 24 February 2025 / Published: 25 February 2025
(This article belongs to the Section Molecular Genetics and Genomics)

Abstract

Lysosome-associated membrane glycoproteins (LAMPs), including lysosomal membrane protein 1 (Lamp1) and lysosomal membrane protein 2 (Lamp2), are involved in phagocytosis, chaperone-mediated autophagy (CMA), and other pathways that interact with lysosomal activity. However, the role of Lamp2 in teleosts has not been clarified. In this study, we investigated the functions of lamp2 genes during Vibrio vulnificus infection. We achieved subcellular localization of the lamp2 gene at the cellular level and performed overexpression and RNA interference experiments followed by Lipopolysaccharides (LPS) stimulation to probe the expression changes of related genes. Ultrapathology analysis of the head-kidney revealed an increase in lysosomes and the formation of autophagosomal vesicles after V. vulnificus infection, suggesting that lysosomes bind to autophagosomes. The lamp2 gene, encoding 401 amino acids in Cynoglossus semilaevis, was constitutively expressed in all examined tissues of healthy half-smooth tongue sole, with the highest expression in blood. A challenge test was conducted to assess the response of half-smooth tongue sole (Cynoglossus semilaevis) to different concentrations of V. vulnificus. The results showed that the relative expression of lamp2 and its related genes—lc3, rab7, vamp8, atg14, stx17, snap29, ctsb, and ctsd—varied with time and concentration in the gill, spleen, head-kidney, blood, liver, and gut tissues. From the results of lamp2 gene overexpression and RNA interference experiments, it is hypothesized that lamp2 positively regulates lc3, rab7, vamp8, snap29, and stx17, and negatively regulates ctsd and ctsb. Our findings provide new primary data for the function of lamp2 gene in the half-smooth tongue sole., particularly its role in regulating the immune response against V. vulnificus.

1. Introduction

Lysosomes are organelles found in animal cells that contain enzymes capable of breaking down various biomolecules, including proteins, nucleic acids, and carbohydrates [1]. They play a crucial role in cellular digestion and waste removal. Lysosome-associated membrane glycoproteins (LAMPs), including lysosomal membrane protein 1 (Lamp1) and lysosomal membrane protein 2 (Lamp2), are involved in phagocytosis, chaperone-mediated autophagy (CMA) [2], and other pathways interacting with lysosomal activities. Bacterial infections can affect lysosomes in different ways. For instance, Mycobacterium tuberculosis and Staphylococcus aureus infections increase the host cellular lysosome levels compared with uninfected conditions, whereas Salmonella infection reduces the levels of lysosomal constituents, including lamp2 [3]. Innate immunity involves the internalization of pathogens, such as bacteria, through phagocytosis and targeting them to lysosomes for degradation [2]. Lysophagic clearance of damaged lysosomes generates lysosomal membrane protein complexes, which constitute small vesicles with the N-terminal protein chain facing the lumen of the vesicle [4]. Overall, lysosomes play a crucial role in degrading cellular waste and pathogens; bacterial infections can affect lysosomal constituents, including lamp2.
Recent studies have revealed that Lamp2 exists not only as a structural protein in membrane structures but also has many other functions [5]. For instance, Lamp2 is essential in regulating autoimmune diseases, autophagosome formation, endosomal fusion, cholesterol transport, thymus development, tumor invasion, and metastasis [6]. Lamp2 can be directly involved in neutrophil adhesion, autophagy, and antigen presentation. Several studies have shown that lysosomes and the spread of pathogens are closely linked to many complex biological processes [7].
While more research results are needed to provide a definitive conclusion on the effect of Lamp2 on bacterial infection, some studies have suggested that Lamp2 plays a role in lysosomal function and autophagic flux, which are essential for the degradation of cellular waste and pathogens [4,8]. Additionally, lamp2 deficiency has been shown to attenuate the neurodegeneration markers induced by HSV-1 infection [9]. Furthermore, Lamp2 has been associated with intracellular bacteria and Salmonella-containing vacuoles [10]. Overall, although the exact role of lamp2 in bacterial infection is unclear, it appears to be involved in lysosomal function and autophagic flux, which are important for pathogen degradation.
The half-smooth tongue sole (Cynoglossus semilaevis) is a vital marine fish species in China, particularly significant in aquaculture. However, diseases, especially those caused by bacterial infections, have led to substantial economic losses as the aquaculture industry has expanded [11]. Vibrio vulnificus, a zoonotic pathogen, poses a threat to both humans and fish, sometimes leading to sepsis and death. Understanding the interaction between the host and V. vulnificus is crucial for insights into the host’s bactericidal activity and the mechanisms of V. vulnificus clearance through lysosomal and phagosomal pathways [10,12,13,14,15,16]. In this study, we assessed the ultra-pathological changes associated with V. vulnificus infection in the half-smooth tongue sole, characterized the expression of lamp2, and analyzed the mRNA expression profiles in various tissues exposed to different concentrations of V. vulnificus at distinct time points. Additionally, we profiled the mRNA expression of lamp2 and its related genes in tissues subjected to Lipopolysaccharides (LPS) stimulation. Our findings offer new insights into the immune function of lamp2 in the half-smooth tongue sole.

2. Results

2.1. Sequencing Characterization of lamp2

The open reading frame of the half-smooth tongue sole lamp2 gene was 1206 bp in length (Figure 1), and encoded 401 amino acids with a predicted molecular weight of 42.91 kDa and a theoretical isoelectric point of 4.84; the probability of lamp2 having a signal peptide was 98.158%; the signal peptide type was SP (Sec/SPI) secretory signal peptide; the excision site was 23–24; the probability of the presence of a signal peptide was 95.28%; the signal peptide position was 1–23 aa; and the average hydrophobicity was 0.046, which is a hydrophobic protein. The prediction of the transmembrane region revealed that the transmembrane structural domain was located between 365 and 387 amino acids (Figure 2).
Phylogenetic analysis revealed that the lamp2 gene from the half-smooth tongue sole and other teleost fish clustered together, forming a distinct group separate from mammals, amphibians, and birds (Figure 3).

2.2. Effect of V. vulnificus on Head Kidney Ultramicroscopic Pathology

Under ultramicroscopic examination, the head kidney tissue of the healthy half-smooth tongue sole exhibited a uniform cytoplasmic distribution with round or oval nuclei centrally located within the cytoplasm. In these healthy fish, the nuclear membrane boundaries were visible, mitochondria were intact, and the cytoplasm contained numerous neatly arranged endoplasmic reticula (Figure 4A). In contrast, the ultrastructure of the head kidney tissues from infected fish displayed enlarged nuclei with distorted nuclear membrane boundaries. Some nuclei were extruded and displaced from the cell centre; mitochondria appeared swollen and partially lysed; and the endoplasmic reticulum was dilated and disorganized. Furthermore, there was an increase in lysosomes and the formation of autophagic vesicles that bind to lysosomes, as well as the fusion of autophagic vesicles (Figure 4B–F).

2.3. Expression of lamp2 in Different Tissues of Half-Smooth Tongue Sole

The expression of lamp2 in nine healthy tissues of half-smooth tongue sole was analyzed using qRT-PCR. The results indicated that lamp2 was expressed in the muscle, heart, gill, intestine, spleen, head kidney, liver, brain, and blood. As can be seen in Figure 5, the relative expression of the lamp2 gene was highest in blood and lowest in muscle (p < 0.01).

2.4. Expression of lamp2 in Tissues Stimulated with V. vulnificus

Following V. vulnificus injection, the differential expression of lamp2 in gill was observed. At 24 h post-injection, lamp2 expression was highest in the 105 CFU/mL group, reaching 5.04 times that of the control group. Significant differences in lamp2 expression were also noted in the 108 and 1011 CFU/mL groups compared to the control. At 48 h, significant differences in lamp2 expression were observed between all experimental groups and the control. At 72 h, a significant difference was found between the 108 CFU/mL and the control. Furthermore, our analysis revealed significant downregulation of lamp2 expression between 24 and 48 h (p < 0.001) and between 24 and 72 h (p < 0.001) across all experimental groups (Figure 6A).
The relative expression level of lamp2 in the spleen following V. vulnificus injection demonstrated significant upregulation in the 105 CFU/mL group at 24, 48, and 72 h, with fold changes of 3.86, 1.86, and 16.17, respectively, compared to the control group. At 48 and 72 h, the expression levels in the 108 and 1011 CFU/mL groups were not significantly different from the control group (p > 0.05). Additionally, the relative expression level in the 105 CFU/mL group was considerably upregulated at 72 h, increasing by 73% compared to the control group (p < 0.001). In contrast, the expression of the 108 CFU/mL group was significantly downregulated at both 48 and 72 h (p < 0.01), with reductions of 78% at 48 h and 66% at 72 h compared to 24 h (p < 0.001). Similarly, the expression in the 1011 CFU/mL group was significantly downregulated at both 48 and 72 h, with decreases of 71% at 48 h and 80% at 72 h compared to 24 h (p < 0.001) (Figure 6B).
In the head kidney, significant differences in the expression level of lamp2 were observed among the groups at 24 and 48 h. However, the expression level of lamp2 was highly upregulated in the 105 and 108 CFU/mL groups at 24 h, with fold changes of 2.86 and 1.75, respectively, compared to the control group. Moreover, at 48 h, the expression levels of the 108 and 1011 CFU/mL groups were significantly lower than that of the control group. The expression of lamp2 was significantly downregulated by 75% at 72 h and 76% at 48 h in the 105 CFU/mL group compared with 24 h (p < 0.001) and by 78% at 48 h and 40% at 72 h in the 108 CFU/mL group compared to 24 h (p < 0.001; p < 0.05). Conversely, in the 1011 CFU/mL group, the expression of lamp2 was significantly upregulated by 12% at 72 h compared with 48 h (p < 0.05) (Figure 6C).
The relative expression lamp2 in the blood following V. vulnificus injection indicated high upregulation in the 105 CFU/mL group at 24 h, with levels 4.20 times higher than those in the control group. The expression of lamp2 across all experimental groups was significantly different from that of the control group. Notably, the 108 CFU/mL group exhibited considerable differential expression of lamp2 at 48 and 72 h compared to the other groups. Relative to the 24 h result, the expression of lamp2 in the 105 CFU/mL group was downregulated by 0.78-fold and 0.64-fold at 48 and 72 h, respectively (p < 0.001). At 72 h, the expression was significantly higher than at 48 h. In contrast, the 1011 CFU/mL group showed a downregulation of lamp2 by 0.67-fold and 0.64-fold at 48 and 72 h, respectively (p < 0.01; p < 0.001) (Figure 6D).
In the liver, the relative expression of lamp2 at 24 h was significantly different in the 105 and 108 CFU/mL groups compared with the control group. At 48 h, the relative expression levels in the 105 CFU/mL group were significantly different from the control group. No significant difference was observed at 72 h. At 48 and 72 h, the expression of lamp2 was significantly downregulated in the 105 CFU/mL group by 85% and 74%, respectively (p < 0.001), compared to 24 h, and in the 108 CFU/mL group by 79% and 81%, respectively (p < 0.001), compared with 24 h. However, in the 1011 CFU/mL group, the expression of lamp2 was significantly downregulated by 55% at 72 h compared with 24 h (p < 0.01; p < 0.05) (Figure 6E).
In the gut, the relative expression of lamp2 at 24 h was significantly different in the 108 and 1011 CFU/mL groups compared to the control group, while no significant difference was observed at 48 h. At 72 h, the relative expression level in the 1011 CFU/mL group was significantly different from the other groups. Compared to 24 h, the expression of lamp2 was markedly reduced in the 108 CFU/mL group at 48 h (p < 0.01). In the 1011 CFU/mL group, lamp2 expression was significantly downregulated by 66% at 48 h (p < 0.001) but showed an upregulation of 28% at 72 h compared to 24 h (p < 0.05). Notably, the expression level was significantly increased by 2.76-fold at 72 h compared with 48 h (p < 0.001) (Figure 6F).

2.5. Expression of the lamp2-Related Genes in Tissues Stimulated with V. vulnificus

No notable distinction in the expression of lc3 was observed in the gills among all experimental groups injected with V. vulnificus at 24 and 48 h. In comparison, at 72 h, the expression of lc3 was markedly reduced in the 105 CFU/mL group (p < 0.01) and the 108 CFU/mL group (p < 0.05). Conversely, the expression of lc3 was significantly upregulated in the 1011 CFU/mL group at 72 h compared with the 105 and 108 CFU/mL groups (p < 0.05). The expression of rab7 was significantly upregulated in the 108 CFU/mL group at 24 h (p < 0.05) and in the 1011 CFU/mL group at 72 h (p < 0.05). The expression of vamp8 was drastically decreased in the 1011 CFU/mL group at 24 h (p < 0.05), and it was significantly downregulated in the 108 CFU/mL group at 24 h (p < 0.05). No significant differences were observed in the expression of atg14, stx17, snap29, ctsd, and ctsb genes (p ≥ 0.05) (Figure 7A–C).
In the spleen of the 105 CFU/mL group, the expression of lc3 was significantly upregulated at 72 h compared with the control group and increased significantly at 72 h compared to 24 and 48 h (p < 0.01). However, in the 108 CFU/mL group, the expression of lc3 was markedly increased at 48 h compared to 72 h and the control group (p < 0.01). In the 1011 CFU/mL group, lc3 expression was drastically decreased at 72 h compared to 24 h (p < 0.05) and significantly upregulated at 48 h (p < 0.05). In the 108 CFU/mL group, the lc3 was substantially raised at 48 h (p < 0.05) and markedly reduced at 72 h in contrast with 24 h (p < 0.05). The expression of rab7 in the 108 CFU/mL group was significantly downregulated (p < 0.05) at 48 h, while in the same group, it was substantially raised at 24 h and downregulated at 72 h. In the 1011 CFU/mL group, rab7 expression was drastically decreased at 48 h compared with the control group. The snap29 expression was substantially elevated in the 1011 CFU/mL group at 24 h in contrast with the control group. In the 1011 CFU/mL group, the expression of ctsd was significantly decreased at 48 h (p < 0.01), while there were no significant differences in the expressions of atg14, stx17, and ctsb (p ≥ 0.05) (Figure 7A–C).
In the head kidney, the expression of rab7 was markedly reduced in the 105 CFU/mL group at 24 h (p < 0.05) and 48 h (p < 0.01) but significantly upregulated at 72 h compared with 24 and 48 h (p < 0.05). In the 108 CFU/mL group, rab7 expression was significantly elevated at 48 and 72 h (p < 0.05). In the 1011 CFU /mL group, rab7 expression was significantly decreased at 72 h (p < 0.05). Meanwhile, ctsd expression was significantly upregulated at 48 h (p < 0.01) and markedly increased at 48 h compared with 24 h (p < 0.001). In all experimental groups, there were no significant differences in the expression of the lc3, vamp8, atg14, stx17, snap29, and ctsb genes (p ≥ 0.05) (Figure 7A–C).
In the blood, the expression of lc3 in the 105 CFU/mL group was markedly increased at 24 h compared to the control group (p < 0.05). However, at 72 h, lc3 expression was significantly downregulated compared with 24 h (p < 0.01). Additionally, rab7, atg14, and snap29 were markedly increased at 24 h compared with the control group (p < 0.01) but were markedly reduced at 48 and 72 h relative to 24 h (p < 0.01). In the 108 CFU/mL group, lc3 expression was significantly elevated at 24 and 48 h compared with the control group (p < 0.01), but was markedly reduced at 72 h compared to 24 and 48 h (p < 0.05). In the 108 and 1011 CFU/mL groups, rab7 was greatly elevated at 24 h compared to the control group and was significantly downregulated at 48 and 72 h compared with 24 h (p < 0.001). In the 1011 CFU/mL group, lc3 expression was significantly increased at 24 and 48 h (p < 0.05) and substantially reduced at 72 h compared with 24 and 48 h (p < 0.001), atg14 expression was significantly upregulated at 24 h, and snap29 expression was markedly increased at 48 and 72 h compared to the control group (p < 0.05) and was consistently upregulated at 48 h and 72 h compared to 24 h (p < 0.01). In contrast, the expressions of vamp8, stx17, ctsd, and ctsb were not significantly different (p ≥ 0.05) (Figure 7A–C).
In the liver of the 105 CFU/mL group, the expression of lc3 was significantly upregulated at 24 h in contrast with the control group (p < 0.05). The expression of rab7 was drastically decreased at 48 and 72 h compared with 24 h (p < 0.05). Snap29 and ctsd were considerably downregulated at 48 h (p < 0.01). In the 108 CFU/mL group, the expression of lc3 was markedly increased at 48 h compared to the control group (p < 0.05), and rab7 expression was significantly upregulated at 24 h and 72 h (p < 0.05). In the 1011 CFU/mL group, the expression of lc3 was substantially raised at 48 h compared with the control (p < 0.05), rab7 expression was markedly increased at 72 h (p < 0.001), and Snap29 expression was greatly increased at 24 h but was significantly downregulated at 48 h. Ctsd expression was also significantly downregulated at 48 h. The expressions of vamp8, atg14, stx17, and ctsb were not significantly different (Figure 7A–C).
In the gut, ctsb expression was greatly decreased at 48 and 72 h in the 108 CFU/mL group compared with the control group and was drastically lowered at 48 and 72 h compared with 24 h. No significant differences were observed for the expressions of lc3, rab7, vamp8, atg14, stx17, snap29, and ctsd (Figure 7A–C).

2.6. Subcellular Localization of lamp2 Gene

To determine the subcellular localization of lamp2 in vitro, pEGFP-N1 and pEGFP-lamp2 plasmids were transfected into Cynoglossus semilaevis brain cells (CSBCs) and the nuclei were counterstained with DAPI. As shown in Figure 8, green fluorescence was observed in the cytoplasm and nucleus of cells transfected with pEGFP-N1. In contrast, green fluorescence was detected exclusively in cells transfected with pEGFP-lamp2 cytoplasm. These results suggest that lamp2 is a cytoplasmic protein.

2.7. Expression of Relevant Genes in LPS-Stimulated Cells After lamp2 Overexpression and RNAi

2.7.1. Expression of Related Genes After lamp2 RNAi

The RNAi experiments yielded intriguing results regarding the expression patterns of autophagy-related genes in CSBCs across four distinct experimental groups (NC, LPS, LPS + lamp2-siRNA, and lamp2-siRNA) at 2, 4, and 6 h (Figure 9A–H). RT-qPCR analysis reveals that the expression levels of lc3, rab7, vamp8, atg14, snap29, stx17, ctsd, and ctsb were significantly upregulated at various times points in the LPS group compared to the NC group (p < 0.001). Conversely, in the lamp2-siRNA group, the expression of lc3, rab7, vamp8, atg14, and ctsd was significantly downregulated (p < 0.05). Furthermore, the gene expression levels of lc3, rab7, vamp8, snap29, and stx17 were notably downregulated (p < 0.05) at the 4 and 6 h in the LPS + lamp2-siRNA group relative to the LPS group. In contrast, atg14 and ctsd were significantly downregulated only at 4 h (p < 0.05). These findings underscore the dynamic interplay between LPS stimulation and lamp2 gene silencing in modulating autophagy-related gene expression.

2.7.2. Expression of Related Genes After lamp2 Overexpression

To investigate the impact of lamp2 on the expression of autophagy-related genes, including lc3, rab7, vamp8, atg14, snap29, stx17, ctsd, and ctsb. RT-qPCR analysis was conducted on samples from four distinct groups, as depicted in Figure 10A–D. Following transfection of CSBCs with the pcDNA3.1-lamp2 plasmid, a significant upregulation in the expression levels of lc3, rab7, vamp8, snap29, and stx17 genes was observed in the pcDNA3.1-lamp2 group compared to the NC group (p < 0.01). In contrast, the expression of the atg14, ctsd, and ctsb genes was significantly downregulated (p < 0.01). In the LPS + pcDNA3.1-lamp2 group, the combination of LPS and pcDNA3.1-lamp2 resulted in a synergistic and significant increase in the expression of vamp8, snap29, and stx17 at 2, 4, and 6 h, lc3 at 2 h and 6 h, and rab7 at 4 h and 6 h. These increases surpassed the levels observed in both the NC and LPS groups (p < 0.05). Conversely, the expression of the atg14, ctsd, and ctsb genes was markedly downregulated under these conditions (p < 0.05). These findings underscore the complex regulatory role of lamp2 in modulating the expression of key autophagy genes in response to LPS stimulation.

3. Discussion

The expression of lamp2 in the inflamed human liver was associated with the body’s immune state [17]. In the current study, the expression of lamp2 was significantly upregulated after V. vulnificus infection, and the expression of its upstream and downstream genes also changed significantly. In the context of V. vulnificus infection, Rab7 is a protein that plays a crucial role in the endocytic pathway and is responsible for the uptake and processing of various molecules in cells. It is involved in transporting vesicles from early endosomes to late endosomes and lysosomes; studies have shown that the bacterium can manipulate the host cell’s endocytic pathway by interacting with Rab7 [18]. This interaction allows V. vulnificus to evade the host’s immune response and establish a successful infection. V. vulnificus infection of fish causes autophagy in the form of macroautophagy [19,20], which is mediated by double-membrane autophagosomes that enclose cytosolic cargoes, followed by fusion with late endosomes/lysosomes for degradation [21,22]. Stx17 localized to autophagosomes is essential for autophagosome–lysosome fusion as it interacts with Snap29 and Vamp8 localized to late endosomes/lysosomes. Atg14 localized to autophagosomes enhances autophagic fusion by interacting with the Stx17–Snap29 complex [23]. The upregulated expression of these genes indicates an increase in the number of lysosomes, which is consistent with the results of TEM. It can be hypothesized that the rise in the number of lysosomes in the cells of different tissues after V. vulnificus infection caused cellular autophagy and fused with intracellular autophagosomes to form autophagic lysosomes, which are digested and hydrolyzed by hydrolases in the lysosomes.
In our study, stimulation of CSBCs with LPS led to a marked increase in the expression of key autophagy-related genes, including lc3, rab7, vamp8, atg14, snap29, stx17, ctsd, and ctsb. In a transgenic rainbow trout model, lamp2 gene expression was significantly upregulated in the lysosomal/phagocytic pathway following the tapping assay [24]. Interestingly, treatment with LPS and lamp2-siRNA resulted in a significant downregulation of lc3, rab7, vamp8, atg14, snap29, and stx17, while ctsd and ctsb expression levels were notably upregulated. Conversely, LPS stimulation after lamp2 overexpression showed an upregulation of lc3, rab7, vamp8, atg14, snap29, and stx17, alongside a significant downregulation of ctsd and ctsb. These data indicate that lamp2 has a regulatory function in the expression among these genes. Lamp2 appears to act through the phosphorylation of vamp8 by mTORC1, which negatively regulates autophagy, particularly during the maturation phase of autophagosomes [25]. Vamp8, an R-SNARE protein localized in lysosomes, governs the fusion of autophagosomes with lysosomes. Under autophagy-inducing conditions, mTORC1-mediated phosphorylation of Vamp8 is significantly reduced, while the dephosphorylated form of vamp8 robustly promotes the formation of the Stx17–Snap29–Vamp8 complex [25]. Stx17, an autophagosome-localized Qa protein, along with Snap29 and Vamp8, facilitates the fusion of autophagosomes with lysosomes [26]. The acetylation of Stx17, controlled by HDAC2, influences autophagosome maturation. Furthermore, Stx17 promotes translocation from the Golgi to the pre-autophagic structure (mPAS) through TBK1 phosphorylation [27]. Snap29, a Qbc protein, together with Stx17 and Vamp8, forms a SNARE complex that enhances autophagosome–lysosome fusion, and its O-GlcNAcylation modulates interaction with Stx17 [28]. In a zebrafish model, the assembly and function of the Stx17–Snap29–Samp8 complex were closely associated with autophagy. The RUNDC1 protein was identified as an inhibitory regulator of this complex, impacting the fusion of autophagosomes with lysosomes and the fish’s response to nutrient deficiencies and pathogen infections [29]. The Stx17–Snap29–Vamp8 complex also plays a crucial role in fish immune responses, with bacterial infection activating the STING pathway, which regulates the assembly of Stx17 with the Snap29–Vamp8 complex, thereby affecting autophagic flux and immune responses. This mechanism may be pivotal in fish resistance to bacterial and viral infections [26,30,31]. A synergistic role between Lamp2 and the Stx17–Snap29–Vamp8 complex in autophagy has been proposed, with Lamp2, as a lysosomal membrane protein, being involved in the recognition and fusion process between autophagosomes and lysosomes along with the Stx17–Snap29–Vamp8 complex [32]. Given the significance of autophagy in the cellular clearance of pathogens and maintenance of cellular homeostasis, regulating the Stx17–Snap29–Vamp8 complex may offer new targets for controlling bacterial and viral diseases in fish.
During autophagy, Lamp2 regulates the immune response and both macroautophagy (MA) and molecular chaperone-mediated autophagy (CMA) [33]. As major lysosomal proteases, Ctsd and Ctsb are involved in protein degradation, and Lamp2 may indirectly regulate their activities by affecting lysosomal function [34,35,36]. Under steady-state conditions, Ctsb can cleave the calcium channel Mcoln1/Trpml1 in lysosomes, maintaining the inhibition of the transcription factor TFEB and reducing the expression of lysosomal and autophagy-associated proteins, thus controlling lysosome and autophagosome numbers. Since TFEB is a key transcription factor for lysosomal biogenesis and autophagy, Ctsb, by affecting TFEB activity, may subsequently influence Lamp2 expression and function [35]. Newcastle disease virus (NDV) utilizes the sialidase activity of its HN proteins to hydrolyze sialic acid residues on Lamp1 and Lamp2 glycan chains, leading to deglycosylation and degradation of Lamp1 and Lamp2 by Ctsb within the lysosomal lumen, triggering lysosomal membrane permeability (LMP) and apoptosis. This discovery reveals a direct role for Lamp2 in regulating Ctsd and Ctsb activity by preventing their aberrant release by maintaining lysosomal membrane integrity [37].
Therefore, we hypothesized that the lamp2 gene has earlier and higher expression in the gill, blood, kidney, and liver. In this experiment, we used V. vulnificus for intraperitoneal injection of fish, which causes an autophagic response, thus affecting the expression differences in the lamp2 gene and its upstream and downstream genes in the autophagic pathway. The results of lamp2 gene overexpression and RNA interference experiments hypothesized that lamp2 positively regulated lc3, rab7, vamp8, snap29, and stx17 and negatively regulated ctsd and ctsb.

4. Materials and Methods

4.1. Experimental Fish and Vibrio vulnificus

The half-smooth tongue sole fish were obtained from Tangshan Sheng Ru Aquaculture Company (Tangshan, Hebei, China). The fish were 67.0 ± 10.0 g in body weight and 22.0 ± 3.0 cm in length. Before the experiment, the fish were cultured in aquariums for 2 weeks. The water temperature before and during the experiment was maintained at 23–25 °C. A total of 360 fish were selected for this study, divided into three treatments groups and one control group, with three parallel fish in each group and 30 fish in each parallel group.
V. vulnificus (ATCC 27562) [38] was obtained from the Marine Culture Collection of China (Xiamen, Fujian, China). The culture of V. vulnificus was performed according to the previously described method [11,39].

4.2. V. vulnificus Injection

The concentrations of V. vulnificus injection were set as 1 × 105 CFU/mL, 1 × 108 CFU/mL, and 1 × 1011 CFU/mL according to the protocol of Liu et al. [11].
The control group was injected with 100 μL of 1× PBS. At 24, 48, and 72 h after injection, samples of the gill, spleen, head kidney, blood, liver, and gut were collected from each group and quickly frozen in liquid nitrogen for 48 h, then stored at −80 °C.

4.3. Sequence Clone and Analysis

Using the half-smooth tongue sole cDNA sequence sample, we cloned the CDS region of lamp2 using the conventional PCR method [40,41] and head kidney transcriptome. The primers utilized in this study are detailed in Table 1. Homology analysis of lamp2 was conducted using the BLAST program (2.13.0). The ExPASy translate tool (https://web.expasy.org/translate/ (accessed on 20 July 2022) was employed for amino acid sequence analysis, and molecular weights were determined using the Compute pI/Mw software (http://web.expasy.org/protparam/ (accessed on 20 July 2022). Protein structure prediction was performed using the NCBI Conserved Domain program (https://www.ncbi.nlm.nih.gov/Structure/cdd/cdd.shtml (accessed on 22 July 2022). Multiple sequence alignment was carried out using the ClustalX1.83 software, and the data were edited using the END script program. The phylogenetic tree (bootstrap 1000) was constructed using the Neighbor-Joining (NJ) method in the MEGA X software [42].

4.4. qRT-PCR

To understand the expression profile of lamp2 and its associated genes in the experiment, total RNA was extracted using Trizol reagent (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s instructions. The RNA concentration was determined using a microspectrophotometer (Implen, Munich, Germany), and RNA quality was assessed by nucleic acid electrophoresis. The volume required for reverse transcription of 1 µg of RNA was calculated based on the measured RNA concentration. cDNA was synthesised using the PrimeScript™ RT reagent kit with gDNA Eraser (Perfect Real Time) (TAKARA, Kyoto, Japan), and subsequently diluted 5-fold with DEPC water. This was followed by qRT-PCR analysis conducted on the Novogene q225 platform, with primers designed using Primer 5 software at a concentration of 10 µM. Each time point included three replicates. The qRT-PCR reaction system and conditions were based on the study by Liu et al. [11], and the relative expression of the genes was evaluated using the 2−ΔΔCt method [43].

4.5. Transmission Electron Microscopy

The TEM experimental method was adapted from the study of Liu et al. [11]. Head kidney samples from the 1011 CFU/mL and PBS groups were fixed overnight in an electron microscopy fixative solution (Servicebio, Wuhan, China) and protected from light exposure. Subsequently, the samples were sent to Servicebio Biotech (Wuhan, China) for observation under the transmission electron microscope.

4.6. Subcellular Localization

In reference to the research by Guo et al. [44], CSBCs were cultured in 12-well plates until they reached 70–90% confluence for subcellular localization studies. Plasmid–lipid complexes were prepared according to the protocol provided by GeticoFect 3000 Transfection Reagent (Genetic Biotech, Wuxi, China). Specifically, the plasmids pEGFP-N1 and pEGFP-lamp2, along with the Lipo3000 reagents, were each diluted with Opti-MEM serum-free medium (Gibco, Carlsbad, CA, USA). The two diluents were then combined and incubated at room temperature for 15 min. The mixture was distributed evenly among the cells, which were incubated at 23 °C for 4 h. After this incubation period, the medium was replaced, and the cells were further incubated for 24 h. Following this, the medium was discarded, and the cells were washed with PBS and fixed with 4% PFA for 30 min. The cells were then washed twice with PBS for 10 min each. Nuclei were stained with DAPI for 10 min and rinsed with PBS in the dark five times. Finally, the cells were examined using a fluorescent microscope (Leica, Vizla, Germany).

4.7. Cell Treatments

The medium was changed on the first day of cell culture, and CSBCs were subjected to LPS challenge. Referring to the research of Cheng et al. [45], the experiment consisted of seven groups, each with six replicates: negative control (NC); LPS; lamp2-small interfering RNA (siRNA); lamp2-siRNA + LPS; pcDNA3.1-lamp2 plasmid; and LPS + pcDNA3.1-lamp2. RNA extraction was performed at 2, 4, and 6 h post-treatment.

4.7.1. RNA Interference (RNAi) Experiments

The lamp2-siRNA interfering strand was synthesized by GENCEFE Biotech (Wuxi, China). The sequences of the interfering strands, designated as lamp2-siRNA-F and lamp2-siRNA-R, are presented in Table 1. Following the protocol provided by the GeticoFect 3000 Transfection Kit (Genetic Biotech, Shanghai, China), the lamp2-siRNA and control siRNA reagents were introduced into CSBCs as detailed below: In tube A, 125 μL of Opti-MEM serum-free medium (Gibco, Carlsbad, CA, USA) was mixed with 5 μL of siRNA. In tube B, 125 μL of Opti-MEM serum-free medium was combined with 7.5 μL of Lipo3000 and incubated at room temperature for 15 min. The contents of tube B were then added dropwise to tube A. After 4 h of incubation, the medium was replaced with a complete medium, and the cells were further incubated at 23 °C for 24 h. Subsequently, LPS was added at a concentration of 100 μg/mL to stimulate the cellular response.

4.7.2. Overexpression Experiments

The pcDNA3.1-lamp2 plasmid was synthesized by GENCEFE Biotech. The method described in Section 4.6 for the subcellular localization experiments was followed for the transfection of cell overexpression plasmid. After 4 h, the medium was changed to a complete medium, and 24 h later, LPS (100 μg/mL) was added to stimulate the cellular response. For subsequent studies, eight genes related to the expression of lamp2 were selected: lc3, rab7, vamp8, atg14, snap29, stx17, ctsd, and ctsb. The primer information for these genes is detailed in Table 1.

4.8. Statistical Analysis

We conducted a Shapiro–Wilk test to evaluate the normality of the data distribution, and the results confirmed that the data were normally distributed. Given these findings, we employed one-way ANOVA followed by Tukey’s post hoc test (p < 0.05) to compare the qRT-PCR data. The data are presented as the mean ± standard error of the mean (SEM). For statistical analyses, we utilized R software (version 4.4.0) with the stats package (4.4.0) [46].

5. Conclusions

The present study characterized lamp2 in teleost for the first time and investigated its function in response to V. vulnificus infection. Injection V. vulnificus caused a significant upregulation of lamp2 expression and an increase in the number of phagosomes and lysosomes. Our findings indicate that the abnormal expression of lamp2 in V. vulnificus-injected half-smooth tongue sole may be related to the immune response evoked by V. vulnificus, which affects the differential expression of autophagosome and lysosome fusion-associated proteins.

Author Contributions

T.H.: writing—original draft preparation, investigation, formal analysis, and visualization. Y.L.: investigation, formal analysis, and visualization. M.L.: investigation. Y.Z.: investigation. Z.H.: investigation. Y.R.: investigation. W.C.: investigation. J.R.: investigation. Y.W.: investigation. G.W.: investigation. C.G.: conceptualization, resources, and supervision; J.H.: conceptualization, resources, supervision, and writing—review and editing. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the Central Public-Interest Scientific Institution Basal Research Fund, CAFS (2023TD41), the Key R&D Program of Hebei Province, China (21326307D), National Marine Genetic Resource Center.

Institutional Review Board Statement

This study followed the Guidelines for Care and Use of Laboratory Animals from the Chinese Association for Laboratory Animal Sciences (No. 2011-2). The study protocols were approved by the animal care and use committee of Beidaihe Central Experiment Station, The Chinese Academy of Fishery Sciences.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data are contained within the article.

Acknowledgments

We thank Zhaodi Sun of Hebei Provincial Aquatic Technology Promotion Station and Xiao Fang of the Ocean and Fisheries Science Research Institute of Hebei Province for their technical and resource support.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Trivedi, P.C.; Bartlett, J.J.; Pulinilkunnil, T. Lysosomal Biology and Function: Modern View of Cellular Debris Bin. Cells 2020, 9, 1131. [Google Scholar] [CrossRef] [PubMed]
  2. Zhang, Z.; Yue, P.; Lu, T.; Wang, Y.; Wei, Y.; Wei, X. Role of lysosomes in physiological activities, diseases, and therapy. J. Hematol. Oncol. 2021, 14, 79. [Google Scholar] [CrossRef] [PubMed]
  3. Sachdeva, K.; Sundaramurthy, V. The Interplay of Host Lysoso mes and Intracellular Pathogens. Front. Cell. Infect. Microbiol. 2020, 10, 595502. [Google Scholar] [CrossRef] [PubMed]
  4. Eriksson, I.; Wäster, P.; Öllinger, K. Restoration of lysosomal function after damage is accompanied by recycling of lysosomal membrane proteins. Cell Death Dis. 2020, 11, 370. [Google Scholar] [CrossRef] [PubMed]
  5. Yamamoto, T.; Nakayama, J.; Yamamoto, Y.; Kuroda, M.; Hattori, Y.; Ochiya, T. SORT1/LAMP2-mediated extracellular vesicle secretion and cell adhesion are linked to lenalidomide resistance in multiple myeloma. Blood Adv. 2022, 6, 2480–2495. [Google Scholar] [CrossRef]
  6. Kain, R.; Matsui, K.; Exner, M.; Binder, S.; Schaffner, G.; Sommer, E.M.; Kerjaschki, D. A novel class of autoantigens of anti-neutrophil cytoplasmic antibodies in necrotizing and crescentic glomerulonephritis: The lysosomal membrane glycoprotein h-lamp-2 in neutrophil granulocytes and a related membrane protein in glomerular endothelial Cells. J. Exp. Med. 1995, 181, 585–597. [Google Scholar] [CrossRef] [PubMed]
  7. Watts, C. Lysosomes and lysosome-related organelles in immune responses. FEBS Open Bio 2022, 12, 678–693. [Google Scholar] [CrossRef] [PubMed]
  8. Cui, L.; Zhao, L.P.; Ye, J.Y.; Yang, L.; Huang, Y.; Jiang, X.P.; Zhang, Q.; Jia, J.Z.; Zhang, D.X.; Huang, Y. The lysosomal membrane protein Lamp2 alleviates lysosomal cell death by promoting autophagic flux in ischemic cardiomyocytes. Front. Cell Dev. Biol. 2020, 8, 31. [Google Scholar] [CrossRef] [PubMed]
  9. Kristen, H.; Sastre, I.; Aljama, S.; Fuentes, M.; Recuero, M.; Frank-García, A.; Martin, A.; Sanchez-Juan, P.; Lage, C.; Bullido, M.J.; et al. LAMP2 deficiency attenuates the neurodegeneration markers induced by HSV-1 infection. Neurochem. Int. 2021, 146, 105032. [Google Scholar] [CrossRef] [PubMed]
  10. Roark, E.A.; Haldar, K. Effects of lysosomal membrane protein depletion on the Salmonella-containing vacuole. PLoS ONE 2008, 3, e3538. [Google Scholar] [CrossRef]
  11. Liu, Y.; Hao, Y.; Liu, Y.; Wang, G.; He, Z.; Zhao, Y.; Xu, Z.; Liu, X.; Wang, Y.; Gong, C.; et al. atp6v0b gene regulates the immune response against Vibrio vulnificus in half-smooth tongue sole (Cynoglossus semilaevis). Aquac. Rep. 2021, 20, 100758. [Google Scholar] [CrossRef]
  12. Hernández-Cabanyero, C.; Amaro, C. Phylogeny and life cycle of the zoonotic pathogen Vibrio vulnificus. Environ. Microbiol. 2020, 22, 4133–4148. [Google Scholar] [CrossRef] [PubMed]
  13. Høi, L.; Larsen, J.L.; Dalsgaard, I.; Dalsgaard, A. Occurrence of Vibrio vulnificus biotypes in Danish marine environments. Appl. Environ. Microbiol. 1998, 64, 7–13. [Google Scholar] [CrossRef]
  14. Meyer, H.L.; Polan, C.; Burggraf, M.; Podleska, L.; Beck, P.; Steinau, H.U.; Dudda, M.; Farzaliyev, F. “The baltic sea germ”: A case report of necrotizing fasciitis following Vibrio vulnificus infection. Case Rep. Orthop. 2022, 2022, 5908666. [Google Scholar] [CrossRef]
  15. Huang, X.H.; Ma, Y.; Zheng, M.M.; Chen, N.; Hu, M.N.; Wu, L.Y.; Zheng, Y.; Lou, Y.L.; Xie, D.L. NLRP3 and mTOR reciprocally regulate macrophage phagolysosome formation and acidification against Vibrio vulnificus infection. Front. Cell Dev. Biol. 2020, 8, 587961. [Google Scholar] [CrossRef] [PubMed]
  16. Pettis, G.S.; Mukerji, A.S. Structure, function, and regulation of the essential virulence factor capsular polysaccharide of Vibrio vulnificus. Int. J. Mol. Sci. 2020, 21, 3259. [Google Scholar] [CrossRef]
  17. Huang, P.S.; Lin, Y.H.; Chi, H.C.; Tseng, Y.H.; Chen, C.Y.; Lin, T.K.; Yeh, C.T.; Lin, K.H. Dysregulated FAM215A stimulates lamp2 expression to confer drug-resistant and malignant in human liver cancer. Cells 2020, 9, 961. [Google Scholar] [CrossRef] [PubMed]
  18. Bonnin-Jusserand, M.; Copin, S.; Le Bris, C.; Brauge, T.; Gay, M.; Brisabois, A.; Grard, T.; Midelet-Bourdin, G. Vibrio species involved in seafood-borne outbreaks (Vibrio cholerae, V. parahaemolyticus and V. vulnificus): Review of microbiological versus recent molecular detection methods in seafood products. Crit. Rev. Food Sci. Nutr. 2019, 59, 597–610. [Google Scholar] [CrossRef] [PubMed]
  19. Huynh, K.K.; Eskelinen, E.L.; Scott, C.C.; Malevanets, A.; Saftig, P.; Grinstein, S. LAMP proteins are required for fusion of lysosomes with phagosomes. EMBO J. 2007, 26, 313–324. [Google Scholar] [CrossRef] [PubMed]
  20. Chi, C.; Leonard, A.; Knight, W.E.; Beussman, K.M.; Zhao, Y.; Cao, Y.; Londono, P.; Aune, E.; Trembley, M.A.; Small, E.M.; et al. LAMP-2B regulates human cardiomyocyte function by mediating autophagosome-lysosome fusion. Proc. Natl. Acad. Sci. USA 2019, 116, 556–565. [Google Scholar] [CrossRef] [PubMed]
  21. Furuta, N.; Fujita, N.; Noda, T.; Yoshimori, T.; Amano, A. Combinational soluble N-ethylmaleimide-sensitive factor attachment protein receptor proteins VAMP8 and Vti1b mediate fusion of antimicrobial and canonical autophagosomes with lysosomes. Mol. Biol. Cell 2010, 21, 1001–1010. [Google Scholar] [CrossRef] [PubMed]
  22. Itakura, E.; Kishi-Itakura, C.; Mizushima, N. The hairpin-type tail-anchored SNARE syntaxin 17 targets to autophagosomes for fusion with endosomes/lysosomes. Cell 2012, 151, 1256–1269. [Google Scholar] [CrossRef]
  23. Diao, J.; Liu, R.; Rong, Y.; Zhao, M.; Zhang, J.; Lai, Y.; Zhou, Q.; Wilz, L.M.; Li, J.; Vivona, S.; et al. ATG14 promotes membrane tethering and fusion of autophagosomes to endolysosomes. Nature 2015, 520, 563–566. [Google Scholar] [CrossRef] [PubMed]
  24. Han, Y.C.; Chen, T.T. A pathway-focused RT-qPCR array study on immune relevant genes in rainbow trout (Oncorhynchus mykiss) harboring cecropin P1 transgene. Fish Shellfish Immunol. 2019, 89, 1–11. [Google Scholar] [CrossRef]
  25. Huang, H.; Ouyang, Q.; Zhu, M. mTOR-mediated phosphorylation of VAMP8 and SCFD1 regulates autophagosome maturation. Nat. Commun. 2021, 12, 6622. [Google Scholar] [CrossRef]
  26. Jian, F.; Wang, S.; Tian, R.; Wang, Y.; Li, C.; Li, Y.; Wang, S.; Fang, C.; Ma, C.; Rong, Y. The STX17-SNAP47-VAMP7/VAMP8 complex is the default SNARE complex mediating autophagosome-lysosome fusion. Cell Res. 2024, 34, 151–168. [Google Scholar] [CrossRef] [PubMed]
  27. Zheng, D.; Tong, M.; Zhang, S. Human YKT6 forms priming complex with STX17 and SNAP29 to facilitate autophagosome-lysosome fusion. Cell Rep. 2024, 43, 113760. [Google Scholar] [CrossRef]
  28. Koyama-Honda, I.; Mizushima, N. Transient visit of STX17 (syntaxin 17) to autophagosomes. Autophagy 2022, 18, 1213–1215. [Google Scholar] [CrossRef] [PubMed]
  29. Zhang, R.; Yang, Y.; He, C.; Zhang, X.; Torraca, V.; Wang, S.; Liu, N.; Yang, J.; Liu, S.; Yuan, J.; et al. RUNDC1 inhibits autolysosome formation and survival of zebrafish via clasping ATG14-STX17-SNAP29 complex. Cell Death Differ. 2023, 30, 2231–2248. [Google Scholar] [CrossRef] [PubMed]
  30. Li, Y.; Cheng, X.; Li, M.; Wang, Y.; Fu, T.; Zhou, Z.; Wang, Y.; Gong, X.; Xu, X.; Liu, J.; et al. Decoding three distinct states of the Syntaxin17 SNARE motif in mediating autophagosome-lysosome fusion. Proc. Natl. Acad. Sci. USA 2020, 117, 21391–21402. [Google Scholar] [CrossRef] [PubMed]
  31. Zhang, R.; Torraca, V.; Lyu, H.; Xiao, S.; Guo, D.; Zhou, C.; Tang, J. RUNDC1 negatively mediates the fusion of autophagosomes with lysosomes via regulating SNARE complex assembly. Autophagy 2024, 20, 454–456. [Google Scholar] [CrossRef]
  32. Tian, X.; Teng, J.; Chen, J. New insights regarding SNARE proteins in autophagosome-lysosome fusion. Autophagy 2021, 17, 2680–2688. [Google Scholar] [CrossRef] [PubMed]
  33. Huang, J.; Wang, J. Selective protein degradation through chaperone-mediated autophagy: Implications for cellular homeostasis and disease (Review). Mol. Med. Rep. 2025, 31, 13. [Google Scholar] [CrossRef] [PubMed]
  34. Tseng, Y.H.; Chang, C.C.; Lin, K.H. Thyroid hormone upregulates LAMP2 expression and lysosome activity. Biochem. Biophys Res. Commun. 2023, 662, 66–75. [Google Scholar] [CrossRef] [PubMed]
  35. Man, S.M.; Kanneganti, T.D. Regulation of lysosomal dynamics and autophagy by CTSB/cathepsin B. Autophagy 2016, 12, 2504–2505. [Google Scholar] [CrossRef] [PubMed]
  36. Di, Y.Q.; Han, X.L.; Kang, X.L. Autophagy triggers CTSD (cathepsin D) maturation and localization inside cells to promote apoptosis. Autophagy 2021, 17, 1170–1192. [Google Scholar] [CrossRef]
  37. Chen, Y.; Zhu, S.; Liao, T. The HN protein of Newcastle disease virus induces cell apoptosis through the induction of lysosomal membrane permeabilization. PLoS Pathog. 2024, 20, e1011981. [Google Scholar] [CrossRef]
  38. Baumann, P.; Baumann, L.; Reichelt, J.L. Taxonomy of marine bacteria: Beneckea parahaemolytica and Beneckea alginolytica. J. Bacteriol. 1973, 113, 1144–1155. [Google Scholar] [CrossRef] [PubMed]
  39. Gong, C.; Hao, Y.; Liu, Y.; Zhao, Y.; Liu, Y.; Wang, G.; He, Z.; Liu, J.; An, B.; Zhang, Y.; et al. Immune response and intestinal microbial succession of half-smooth tongue sole (Cynoglossus semilaevis) infected with Vibrio vulnificus. Aquaculture 2020, 533, 736229. [Google Scholar] [CrossRef]
  40. Shao, C.; Bao, B.; Xie, Z.; Chen, X.; Li, B.; Jia, X.; Yao, Q.; Ortí, G.; Li, W.; Li, X.; et al. The genome and transcriptome of Japanese flounder provide insights into flatfish asymmetry. Nat. Genet. 2017, 49, 119–124. [Google Scholar] [CrossRef]
  41. Yao, C.; Lee, D.H.; Oh, J.H.; Kim, M.K.; Kim, K.H.; Park, C.H.; Chung, J.H. Poly(I:C) induces expressions of MMP-1, -2, and -3 through various signaling pathways including IRF3 in human skin fibroblasts. J. Dermatol. Sci. 2015, 80, 54–60. [Google Scholar] [CrossRef] [PubMed]
  42. Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef] [PubMed]
  43. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-DDCt method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
  44. Guo, Y.; Sun, Z.; Zhang, Y.; Wang, G.; He, Z.; Liu, Y.; Ren, Y.; Wang, Y.; Fu, Y.; Hou, J. Molecular identification and function characterization of four alternative splice variants of trim25 in Japanese flounder (Paralichthys olivaceus). Fish Shellfish Immunol. 2022, 120, 142–154. [Google Scholar] [CrossRef]
  45. Cheng, J.X.; Liu, P.F.; Yang, Y.; Liu, Y.Y.; Xia, Y.Q. Functional role of TrIL-1β in Takifugu rubripes defense against Cryptocaryon irritans infection. Int. J. Biol. Macromol. 2024, 269 Pt 2, 132167. [Google Scholar] [CrossRef] [PubMed]
  46. R Development Core Team. A Language and Environment for Statistical Computing. 2018. Available online: https://www.r-project.org/ (accessed on 21 November 2022).
Figure 1. The nucleotide and amino acid sequences of the protein encoded by the CDS region of the lamp2 gene in Cynoglossus semilaevis. (The symbol * denotes the stop codon).
Figure 1. The nucleotide and amino acid sequences of the protein encoded by the CDS region of the lamp2 gene in Cynoglossus semilaevis. (The symbol * denotes the stop codon).
Ijms 26 01999 g001
Figure 2. Alignment of multiple Lamp2 amino acid sequences from Cynoglossus semilaevis and other species. “*” indicates the position of the amino acid of the sequence, which is used to mark the number of the amino acid in the sequence, green shading indicates amino acid identity; yellow shading indicates similarity (50% threshold).
Figure 2. Alignment of multiple Lamp2 amino acid sequences from Cynoglossus semilaevis and other species. “*” indicates the position of the amino acid of the sequence, which is used to mark the number of the amino acid in the sequence, green shading indicates amino acid identity; yellow shading indicates similarity (50% threshold).
Ijms 26 01999 g002
Figure 3. Comparative phylogenetic analysis of the Lamp2 amino acid sequences of Cynoglossus semilaevis and other species. The black bold italics font represents the Cynoglossus semilaevis branch. (Bootstrap values displayed at nodes).
Figure 3. Comparative phylogenetic analysis of the Lamp2 amino acid sequences of Cynoglossus semilaevis and other species. The black bold italics font represents the Cynoglossus semilaevis branch. (Bootstrap values displayed at nodes).
Ijms 26 01999 g003
Figure 4. The ultrastructure pathology of tissues in V. vulnificus challenge in half-smooth tongue sole (Cynoglossus semilaevis) after V. vulnificus challenge is depicted as follows: (A) shows the head kidney from control group. (B,C) illustrate the head kidney ultrastructure from 1011 CFU/mL group at 72 h post-injection. (D) is a magnified view of the area in (C), and (F) is a magnified view of the area in (E). AP, autophagosome; ER, endoplasmic reticulum; N, nucleus; MT, mitochondria; LD, lipid drop; LY, lysosome.
Figure 4. The ultrastructure pathology of tissues in V. vulnificus challenge in half-smooth tongue sole (Cynoglossus semilaevis) after V. vulnificus challenge is depicted as follows: (A) shows the head kidney from control group. (B,C) illustrate the head kidney ultrastructure from 1011 CFU/mL group at 72 h post-injection. (D) is a magnified view of the area in (C), and (F) is a magnified view of the area in (E). AP, autophagosome; ER, endoplasmic reticulum; N, nucleus; MT, mitochondria; LD, lipid drop; LY, lysosome.
Ijms 26 01999 g004
Figure 5. Expression of lamp2 in various tissues of Cynoglossus semilaevis. β-actin is used as the internal control gene to calibrate the cDNA templates for all the samples. The differential significance of lamp2 expression in different tissues (p < 0.05) was expressed by different letters.
Figure 5. Expression of lamp2 in various tissues of Cynoglossus semilaevis. β-actin is used as the internal control gene to calibrate the cDNA templates for all the samples. The differential significance of lamp2 expression in different tissues (p < 0.05) was expressed by different letters.
Ijms 26 01999 g005
Figure 6. Expression profiles of the lamp2 gene in various tissues of Cynoglossus semilaevis were analyzed following intraperitoneal injection with varying concentrations of V. vulnificus at multiple time points. (A): gill; (B): spleen; (C): head kidney; (D): blood; (E): liver; (F): gut. Distinct differences (p < 0.05) in lamp2 expression across varying bacterial concentrations and time points are represented by different letters. Differences in lamp2 expression at identical bacterial fluid concentrations across various time points are denoted by ‘*’, ‘**’, ‘***’ (‘*’ p < 0.05, ‘**’ p < 0.01, ‘***’ p < 0.001).
Figure 6. Expression profiles of the lamp2 gene in various tissues of Cynoglossus semilaevis were analyzed following intraperitoneal injection with varying concentrations of V. vulnificus at multiple time points. (A): gill; (B): spleen; (C): head kidney; (D): blood; (E): liver; (F): gut. Distinct differences (p < 0.05) in lamp2 expression across varying bacterial concentrations and time points are represented by different letters. Differences in lamp2 expression at identical bacterial fluid concentrations across various time points are denoted by ‘*’, ‘**’, ‘***’ (‘*’ p < 0.05, ‘**’ p < 0.01, ‘***’ p < 0.001).
Ijms 26 01999 g006
Figure 7. Temporal expression of lamp2-related genes is detected in gill, spleen, head kidney, blood, liver, and gut by qRT-PCR after different concentrations of V. vulnificus infection (24 h, 48 h, 72 h). (A): The V. vulnificus concentration is 105 CFU/mL; (B): the V. vulnificus concentration is 108 CFU/mL; (C): the V. vulnificus concentration is 1011 CFU/mL; β-actin is used as the internal control gene to calibrate the cDNA templates for all the samples. The heatmap is constructed by TBtools software (v2.142).
Figure 7. Temporal expression of lamp2-related genes is detected in gill, spleen, head kidney, blood, liver, and gut by qRT-PCR after different concentrations of V. vulnificus infection (24 h, 48 h, 72 h). (A): The V. vulnificus concentration is 105 CFU/mL; (B): the V. vulnificus concentration is 108 CFU/mL; (C): the V. vulnificus concentration is 1011 CFU/mL; β-actin is used as the internal control gene to calibrate the cDNA templates for all the samples. The heatmap is constructed by TBtools software (v2.142).
Ijms 26 01999 g007aIjms 26 01999 g007b
Figure 8. Localization of Lamp2 within the cytoplasm of Cynoglossus semilaevis brain cells (CSBCs). CSBCs were transfected with pEGFP-N1, pEGFP-LAMP2, and nuclei were stained with DAPI. Observe the cells under a fluorescence microscope (the scale’s length is 50 μm).
Figure 8. Localization of Lamp2 within the cytoplasm of Cynoglossus semilaevis brain cells (CSBCs). CSBCs were transfected with pEGFP-N1, pEGFP-LAMP2, and nuclei were stained with DAPI. Observe the cells under a fluorescence microscope (the scale’s length is 50 μm).
Ijms 26 01999 g008
Figure 9. Investigations related to RNA interference. To determine the biological role of lamp2 in CSBCs, RT-qPCR was employed to assess the impact of lamp2 gene interference on the expression levels of lc3, rab7, vamp8, atg14, snap29, stx17, ctsd, and ctsb at various time points (2, 4, 6 h). (A): Gene expression of lc3. (B): Gene expression of rab7. (C): Gene expression of vamp8. (D): Gene expression of atg14. (E): Gene expression of stx17. (F): Gene expression of snap29. (G): Gene expression of ctsd. (H): Gene expression of ctsb. The significance of the differences in gene expression (p < 0.05) between different groups and time points was expressed in different letters.
Figure 9. Investigations related to RNA interference. To determine the biological role of lamp2 in CSBCs, RT-qPCR was employed to assess the impact of lamp2 gene interference on the expression levels of lc3, rab7, vamp8, atg14, snap29, stx17, ctsd, and ctsb at various time points (2, 4, 6 h). (A): Gene expression of lc3. (B): Gene expression of rab7. (C): Gene expression of vamp8. (D): Gene expression of atg14. (E): Gene expression of stx17. (F): Gene expression of snap29. (G): Gene expression of ctsd. (H): Gene expression of ctsb. The significance of the differences in gene expression (p < 0.05) between different groups and time points was expressed in different letters.
Ijms 26 01999 g009
Figure 10. Overexpression experiments. To explore the biological function of lamp2 in CSBCs, influences of lamp2 on the expression of lc3, rab7, vamp8, atg14, snap29, stx17, ctsd, and ctsb were detected by RT-qPCR at different times (2, 4, 6 h). (A): Gene expression of lc3. (B): Gene expression of rab7. (C): Gene expression of vamp8. (D): Gene expression of atg14. (E): Gene expression of stx17. (F): Gene expression of snap29. (G): Gene expression of ctsd. (H): Gene expression of ctsb. The significance of the differences in gene expression (p < 0.05) between different groups and time points was expressed in different letters.
Figure 10. Overexpression experiments. To explore the biological function of lamp2 in CSBCs, influences of lamp2 on the expression of lc3, rab7, vamp8, atg14, snap29, stx17, ctsd, and ctsb were detected by RT-qPCR at different times (2, 4, 6 h). (A): Gene expression of lc3. (B): Gene expression of rab7. (C): Gene expression of vamp8. (D): Gene expression of atg14. (E): Gene expression of stx17. (F): Gene expression of snap29. (G): Gene expression of ctsd. (H): Gene expression of ctsb. The significance of the differences in gene expression (p < 0.05) between different groups and time points was expressed in different letters.
Ijms 26 01999 g010
Table 1. Primer sequence table.
Table 1. Primer sequence table.
PrimersSequence (5′-3′)Applications
pEGFP-LAMP2-FAGCTCAAGCTTCGAATTCATGAGCCGCTGCGCTGCTGCCTATGEukaryotic expression
pEGFP-LAMP2-RGTCGACTGCAGAATTCCTAGAAAGACTCGTAGCCCGTGGCC
Q-lamp2-FACCGCATCCAACGCCAAAACCqRT-PCR
Q-lamp2-RCGCTTGCTGGGCTGGTGAAGA
β-actin-FAGGGAAATCGTGCGTGACAT
β-actin-RGCCCATCTCCTGCTCGAA
CS-lc3-FACCAGCATAGTATGGTGTCAGTG
CS-lc3-RAAAGTCTCCTGGGAGGCGTA
CS-rab7-FCCAGTACAAAGCCACAATAGG
CS-rab7-RTCCACGGTAGAACGCAACAC
CS-stx17-FCGCTGATGCCCTGGAAATGC
CS-stx17-RGGAGGTGATGGCGGTGGTGT
CS-snap29-FTGCGACAGGGTGAGGTTCTG
CS-snap29-RACACTCTTGATGCTGCTAATG
CS-vamp8-FGGTGGTGGTCATTATTGTGG
CS-vamp8-RGTTTATGGCTTCTTGGTGGG
CS-ctsd-FTGCCGTCCATTCACTGCTCC
CS-ctsd-RCGAAGGCTGTGCCGTTCTTG
CS-ctsb-FTGTCAGGGTGAACAGGAAAC
CS-ctsb-RGACGGGACGCTGTAGATTTT
CS-atg14-FGAAGAGCACCAACCAGGGTC
CS-atg14-RCCAGGATGTGGGAAAGAATGT
lamp2-siRNA-FCAUCUGUUCUGCUGACCAATTRNA interference
lamp2-siRNA-RUUGGUCAGCAGAACAGAUGTT
Note: the primer concentration is 10 µM.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Han, T.; Liu, Y.; Li, M.; Zhang, Y.; He, Z.; Ren, Y.; Cao, W.; Ren, J.; Wang, Y.; Wang, G.; et al. Function of lamp2 Gene Response to Vibrio vulnificus Infection and LPS Stimulation in the Half-Smooth Tongue Sole (Cynoglossus semilaevis). Int. J. Mol. Sci. 2025, 26, 1999. https://doi.org/10.3390/ijms26051999

AMA Style

Han T, Liu Y, Li M, Zhang Y, He Z, Ren Y, Cao W, Ren J, Wang Y, Wang G, et al. Function of lamp2 Gene Response to Vibrio vulnificus Infection and LPS Stimulation in the Half-Smooth Tongue Sole (Cynoglossus semilaevis). International Journal of Molecular Sciences. 2025; 26(5):1999. https://doi.org/10.3390/ijms26051999

Chicago/Turabian Style

Han, Tian, Yufeng Liu, Mengchao Li, Yitong Zhang, Zhongwei He, Yuqin Ren, Wei Cao, Jiangong Ren, Yufen Wang, Guixing Wang, and et al. 2025. "Function of lamp2 Gene Response to Vibrio vulnificus Infection and LPS Stimulation in the Half-Smooth Tongue Sole (Cynoglossus semilaevis)" International Journal of Molecular Sciences 26, no. 5: 1999. https://doi.org/10.3390/ijms26051999

APA Style

Han, T., Liu, Y., Li, M., Zhang, Y., He, Z., Ren, Y., Cao, W., Ren, J., Wang, Y., Wang, G., Gong, C., & Hou, J. (2025). Function of lamp2 Gene Response to Vibrio vulnificus Infection and LPS Stimulation in the Half-Smooth Tongue Sole (Cynoglossus semilaevis). International Journal of Molecular Sciences, 26(5), 1999. https://doi.org/10.3390/ijms26051999

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop