Function of lamp2 Gene Response to Vibrio vulnificus Infection and LPS Stimulation in the Half-Smooth Tongue Sole (Cynoglossus semilaevis)
Abstract
1. Introduction
2. Results
2.1. Sequencing Characterization of lamp2
2.2. Effect of V. vulnificus on Head Kidney Ultramicroscopic Pathology
2.3. Expression of lamp2 in Different Tissues of Half-Smooth Tongue Sole
2.4. Expression of lamp2 in Tissues Stimulated with V. vulnificus
2.5. Expression of the lamp2-Related Genes in Tissues Stimulated with V. vulnificus
2.6. Subcellular Localization of lamp2 Gene
2.7. Expression of Relevant Genes in LPS-Stimulated Cells After lamp2 Overexpression and RNAi
2.7.1. Expression of Related Genes After lamp2 RNAi
2.7.2. Expression of Related Genes After lamp2 Overexpression
3. Discussion
4. Materials and Methods
4.1. Experimental Fish and Vibrio vulnificus
4.2. V. vulnificus Injection
4.3. Sequence Clone and Analysis
4.4. qRT-PCR
4.5. Transmission Electron Microscopy
4.6. Subcellular Localization
4.7. Cell Treatments
4.7.1. RNA Interference (RNAi) Experiments
4.7.2. Overexpression Experiments
4.8. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Trivedi, P.C.; Bartlett, J.J.; Pulinilkunnil, T. Lysosomal Biology and Function: Modern View of Cellular Debris Bin. Cells 2020, 9, 1131. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Z.; Yue, P.; Lu, T.; Wang, Y.; Wei, Y.; Wei, X. Role of lysosomes in physiological activities, diseases, and therapy. J. Hematol. Oncol. 2021, 14, 79. [Google Scholar] [CrossRef] [PubMed]
- Sachdeva, K.; Sundaramurthy, V. The Interplay of Host Lysoso mes and Intracellular Pathogens. Front. Cell. Infect. Microbiol. 2020, 10, 595502. [Google Scholar] [CrossRef] [PubMed]
- Eriksson, I.; Wäster, P.; Öllinger, K. Restoration of lysosomal function after damage is accompanied by recycling of lysosomal membrane proteins. Cell Death Dis. 2020, 11, 370. [Google Scholar] [CrossRef] [PubMed]
- Yamamoto, T.; Nakayama, J.; Yamamoto, Y.; Kuroda, M.; Hattori, Y.; Ochiya, T. SORT1/LAMP2-mediated extracellular vesicle secretion and cell adhesion are linked to lenalidomide resistance in multiple myeloma. Blood Adv. 2022, 6, 2480–2495. [Google Scholar] [CrossRef]
- Kain, R.; Matsui, K.; Exner, M.; Binder, S.; Schaffner, G.; Sommer, E.M.; Kerjaschki, D. A novel class of autoantigens of anti-neutrophil cytoplasmic antibodies in necrotizing and crescentic glomerulonephritis: The lysosomal membrane glycoprotein h-lamp-2 in neutrophil granulocytes and a related membrane protein in glomerular endothelial Cells. J. Exp. Med. 1995, 181, 585–597. [Google Scholar] [CrossRef] [PubMed]
- Watts, C. Lysosomes and lysosome-related organelles in immune responses. FEBS Open Bio 2022, 12, 678–693. [Google Scholar] [CrossRef] [PubMed]
- Cui, L.; Zhao, L.P.; Ye, J.Y.; Yang, L.; Huang, Y.; Jiang, X.P.; Zhang, Q.; Jia, J.Z.; Zhang, D.X.; Huang, Y. The lysosomal membrane protein Lamp2 alleviates lysosomal cell death by promoting autophagic flux in ischemic cardiomyocytes. Front. Cell Dev. Biol. 2020, 8, 31. [Google Scholar] [CrossRef] [PubMed]
- Kristen, H.; Sastre, I.; Aljama, S.; Fuentes, M.; Recuero, M.; Frank-García, A.; Martin, A.; Sanchez-Juan, P.; Lage, C.; Bullido, M.J.; et al. LAMP2 deficiency attenuates the neurodegeneration markers induced by HSV-1 infection. Neurochem. Int. 2021, 146, 105032. [Google Scholar] [CrossRef] [PubMed]
- Roark, E.A.; Haldar, K. Effects of lysosomal membrane protein depletion on the Salmonella-containing vacuole. PLoS ONE 2008, 3, e3538. [Google Scholar] [CrossRef][Green Version]
- Liu, Y.; Hao, Y.; Liu, Y.; Wang, G.; He, Z.; Zhao, Y.; Xu, Z.; Liu, X.; Wang, Y.; Gong, C.; et al. atp6v0b gene regulates the immune response against Vibrio vulnificus in half-smooth tongue sole (Cynoglossus semilaevis). Aquac. Rep. 2021, 20, 100758. [Google Scholar] [CrossRef]
- Hernández-Cabanyero, C.; Amaro, C. Phylogeny and life cycle of the zoonotic pathogen Vibrio vulnificus. Environ. Microbiol. 2020, 22, 4133–4148. [Google Scholar] [CrossRef] [PubMed]
- Høi, L.; Larsen, J.L.; Dalsgaard, I.; Dalsgaard, A. Occurrence of Vibrio vulnificus biotypes in Danish marine environments. Appl. Environ. Microbiol. 1998, 64, 7–13. [Google Scholar] [CrossRef]
- Meyer, H.L.; Polan, C.; Burggraf, M.; Podleska, L.; Beck, P.; Steinau, H.U.; Dudda, M.; Farzaliyev, F. “The baltic sea germ”: A case report of necrotizing fasciitis following Vibrio vulnificus infection. Case Rep. Orthop. 2022, 2022, 5908666. [Google Scholar] [CrossRef]
- Huang, X.H.; Ma, Y.; Zheng, M.M.; Chen, N.; Hu, M.N.; Wu, L.Y.; Zheng, Y.; Lou, Y.L.; Xie, D.L. NLRP3 and mTOR reciprocally regulate macrophage phagolysosome formation and acidification against Vibrio vulnificus infection. Front. Cell Dev. Biol. 2020, 8, 587961. [Google Scholar] [CrossRef] [PubMed]
- Pettis, G.S.; Mukerji, A.S. Structure, function, and regulation of the essential virulence factor capsular polysaccharide of Vibrio vulnificus. Int. J. Mol. Sci. 2020, 21, 3259. [Google Scholar] [CrossRef]
- Huang, P.S.; Lin, Y.H.; Chi, H.C.; Tseng, Y.H.; Chen, C.Y.; Lin, T.K.; Yeh, C.T.; Lin, K.H. Dysregulated FAM215A stimulates lamp2 expression to confer drug-resistant and malignant in human liver cancer. Cells 2020, 9, 961. [Google Scholar] [CrossRef] [PubMed]
- Bonnin-Jusserand, M.; Copin, S.; Le Bris, C.; Brauge, T.; Gay, M.; Brisabois, A.; Grard, T.; Midelet-Bourdin, G. Vibrio species involved in seafood-borne outbreaks (Vibrio cholerae, V. parahaemolyticus and V. vulnificus): Review of microbiological versus recent molecular detection methods in seafood products. Crit. Rev. Food Sci. Nutr. 2019, 59, 597–610. [Google Scholar] [CrossRef] [PubMed]
- Huynh, K.K.; Eskelinen, E.L.; Scott, C.C.; Malevanets, A.; Saftig, P.; Grinstein, S. LAMP proteins are required for fusion of lysosomes with phagosomes. EMBO J. 2007, 26, 313–324. [Google Scholar] [CrossRef] [PubMed]
- Chi, C.; Leonard, A.; Knight, W.E.; Beussman, K.M.; Zhao, Y.; Cao, Y.; Londono, P.; Aune, E.; Trembley, M.A.; Small, E.M.; et al. LAMP-2B regulates human cardiomyocyte function by mediating autophagosome-lysosome fusion. Proc. Natl. Acad. Sci. USA 2019, 116, 556–565. [Google Scholar] [CrossRef] [PubMed]
- Furuta, N.; Fujita, N.; Noda, T.; Yoshimori, T.; Amano, A. Combinational soluble N-ethylmaleimide-sensitive factor attachment protein receptor proteins VAMP8 and Vti1b mediate fusion of antimicrobial and canonical autophagosomes with lysosomes. Mol. Biol. Cell 2010, 21, 1001–1010. [Google Scholar] [CrossRef] [PubMed]
- Itakura, E.; Kishi-Itakura, C.; Mizushima, N. The hairpin-type tail-anchored SNARE syntaxin 17 targets to autophagosomes for fusion with endosomes/lysosomes. Cell 2012, 151, 1256–1269. [Google Scholar] [CrossRef]
- Diao, J.; Liu, R.; Rong, Y.; Zhao, M.; Zhang, J.; Lai, Y.; Zhou, Q.; Wilz, L.M.; Li, J.; Vivona, S.; et al. ATG14 promotes membrane tethering and fusion of autophagosomes to endolysosomes. Nature 2015, 520, 563–566. [Google Scholar] [CrossRef] [PubMed]
- Han, Y.C.; Chen, T.T. A pathway-focused RT-qPCR array study on immune relevant genes in rainbow trout (Oncorhynchus mykiss) harboring cecropin P1 transgene. Fish Shellfish Immunol. 2019, 89, 1–11. [Google Scholar] [CrossRef]
- Huang, H.; Ouyang, Q.; Zhu, M. mTOR-mediated phosphorylation of VAMP8 and SCFD1 regulates autophagosome maturation. Nat. Commun. 2021, 12, 6622. [Google Scholar] [CrossRef]
- Jian, F.; Wang, S.; Tian, R.; Wang, Y.; Li, C.; Li, Y.; Wang, S.; Fang, C.; Ma, C.; Rong, Y. The STX17-SNAP47-VAMP7/VAMP8 complex is the default SNARE complex mediating autophagosome-lysosome fusion. Cell Res. 2024, 34, 151–168. [Google Scholar] [CrossRef] [PubMed]
- Zheng, D.; Tong, M.; Zhang, S. Human YKT6 forms priming complex with STX17 and SNAP29 to facilitate autophagosome-lysosome fusion. Cell Rep. 2024, 43, 113760. [Google Scholar] [CrossRef]
- Koyama-Honda, I.; Mizushima, N. Transient visit of STX17 (syntaxin 17) to autophagosomes. Autophagy 2022, 18, 1213–1215. [Google Scholar] [CrossRef] [PubMed]
- Zhang, R.; Yang, Y.; He, C.; Zhang, X.; Torraca, V.; Wang, S.; Liu, N.; Yang, J.; Liu, S.; Yuan, J.; et al. RUNDC1 inhibits autolysosome formation and survival of zebrafish via clasping ATG14-STX17-SNAP29 complex. Cell Death Differ. 2023, 30, 2231–2248. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Cheng, X.; Li, M.; Wang, Y.; Fu, T.; Zhou, Z.; Wang, Y.; Gong, X.; Xu, X.; Liu, J.; et al. Decoding three distinct states of the Syntaxin17 SNARE motif in mediating autophagosome-lysosome fusion. Proc. Natl. Acad. Sci. USA 2020, 117, 21391–21402. [Google Scholar] [CrossRef] [PubMed]
- Zhang, R.; Torraca, V.; Lyu, H.; Xiao, S.; Guo, D.; Zhou, C.; Tang, J. RUNDC1 negatively mediates the fusion of autophagosomes with lysosomes via regulating SNARE complex assembly. Autophagy 2024, 20, 454–456. [Google Scholar] [CrossRef]
- Tian, X.; Teng, J.; Chen, J. New insights regarding SNARE proteins in autophagosome-lysosome fusion. Autophagy 2021, 17, 2680–2688. [Google Scholar] [CrossRef] [PubMed]
- Huang, J.; Wang, J. Selective protein degradation through chaperone-mediated autophagy: Implications for cellular homeostasis and disease (Review). Mol. Med. Rep. 2025, 31, 13. [Google Scholar] [CrossRef] [PubMed]
- Tseng, Y.H.; Chang, C.C.; Lin, K.H. Thyroid hormone upregulates LAMP2 expression and lysosome activity. Biochem. Biophys Res. Commun. 2023, 662, 66–75. [Google Scholar] [CrossRef] [PubMed]
- Man, S.M.; Kanneganti, T.D. Regulation of lysosomal dynamics and autophagy by CTSB/cathepsin B. Autophagy 2016, 12, 2504–2505. [Google Scholar] [CrossRef] [PubMed]
- Di, Y.Q.; Han, X.L.; Kang, X.L. Autophagy triggers CTSD (cathepsin D) maturation and localization inside cells to promote apoptosis. Autophagy 2021, 17, 1170–1192. [Google Scholar] [CrossRef]
- Chen, Y.; Zhu, S.; Liao, T. The HN protein of Newcastle disease virus induces cell apoptosis through the induction of lysosomal membrane permeabilization. PLoS Pathog. 2024, 20, e1011981. [Google Scholar] [CrossRef]
- Baumann, P.; Baumann, L.; Reichelt, J.L. Taxonomy of marine bacteria: Beneckea parahaemolytica and Beneckea alginolytica. J. Bacteriol. 1973, 113, 1144–1155. [Google Scholar] [CrossRef] [PubMed]
- Gong, C.; Hao, Y.; Liu, Y.; Zhao, Y.; Liu, Y.; Wang, G.; He, Z.; Liu, J.; An, B.; Zhang, Y.; et al. Immune response and intestinal microbial succession of half-smooth tongue sole (Cynoglossus semilaevis) infected with Vibrio vulnificus. Aquaculture 2020, 533, 736229. [Google Scholar] [CrossRef]
- Shao, C.; Bao, B.; Xie, Z.; Chen, X.; Li, B.; Jia, X.; Yao, Q.; Ortí, G.; Li, W.; Li, X.; et al. The genome and transcriptome of Japanese flounder provide insights into flatfish asymmetry. Nat. Genet. 2017, 49, 119–124. [Google Scholar] [CrossRef]
- Yao, C.; Lee, D.H.; Oh, J.H.; Kim, M.K.; Kim, K.H.; Park, C.H.; Chung, J.H. Poly(I:C) induces expressions of MMP-1, -2, and -3 through various signaling pathways including IRF3 in human skin fibroblasts. J. Dermatol. Sci. 2015, 80, 54–60. [Google Scholar] [CrossRef] [PubMed]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-DDCt method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Guo, Y.; Sun, Z.; Zhang, Y.; Wang, G.; He, Z.; Liu, Y.; Ren, Y.; Wang, Y.; Fu, Y.; Hou, J. Molecular identification and function characterization of four alternative splice variants of trim25 in Japanese flounder (Paralichthys olivaceus). Fish Shellfish Immunol. 2022, 120, 142–154. [Google Scholar] [CrossRef]
- Cheng, J.X.; Liu, P.F.; Yang, Y.; Liu, Y.Y.; Xia, Y.Q. Functional role of TrIL-1β in Takifugu rubripes defense against Cryptocaryon irritans infection. Int. J. Biol. Macromol. 2024, 269 Pt 2, 132167. [Google Scholar] [CrossRef] [PubMed]
- R Development Core Team. A Language and Environment for Statistical Computing. 2018. Available online: https://www.r-project.org/ (accessed on 21 November 2022).











| Primers | Sequence (5′-3′) | Applications |
|---|---|---|
| pEGFP-LAMP2-F | AGCTCAAGCTTCGAATTCATGAGCCGCTGCGCTGCTGCCTATG | Eukaryotic expression |
| pEGFP-LAMP2-R | GTCGACTGCAGAATTCCTAGAAAGACTCGTAGCCCGTGGCC | |
| Q-lamp2-F | ACCGCATCCAACGCCAAAACC | qRT-PCR |
| Q-lamp2-R | CGCTTGCTGGGCTGGTGAAGA | |
| β-actin-F | AGGGAAATCGTGCGTGACAT | |
| β-actin-R | GCCCATCTCCTGCTCGAA | |
| CS-lc3-F | ACCAGCATAGTATGGTGTCAGTG | |
| CS-lc3-R | AAAGTCTCCTGGGAGGCGTA | |
| CS-rab7-F | CCAGTACAAAGCCACAATAGG | |
| CS-rab7-R | TCCACGGTAGAACGCAACAC | |
| CS-stx17-F | CGCTGATGCCCTGGAAATGC | |
| CS-stx17-R | GGAGGTGATGGCGGTGGTGT | |
| CS-snap29-F | TGCGACAGGGTGAGGTTCTG | |
| CS-snap29-R | ACACTCTTGATGCTGCTAATG | |
| CS-vamp8-F | GGTGGTGGTCATTATTGTGG | |
| CS-vamp8-R | GTTTATGGCTTCTTGGTGGG | |
| CS-ctsd-F | TGCCGTCCATTCACTGCTCC | |
| CS-ctsd-R | CGAAGGCTGTGCCGTTCTTG | |
| CS-ctsb-F | TGTCAGGGTGAACAGGAAAC | |
| CS-ctsb-R | GACGGGACGCTGTAGATTTT | |
| CS-atg14-F | GAAGAGCACCAACCAGGGTC | |
| CS-atg14-R | CCAGGATGTGGGAAAGAATGT | |
| lamp2-siRNA-F | CAUCUGUUCUGCUGACCAATT | RNA interference |
| lamp2-siRNA-R | UUGGUCAGCAGAACAGAUGTT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Han, T.; Liu, Y.; Li, M.; Zhang, Y.; He, Z.; Ren, Y.; Cao, W.; Ren, J.; Wang, Y.; Wang, G.; et al. Function of lamp2 Gene Response to Vibrio vulnificus Infection and LPS Stimulation in the Half-Smooth Tongue Sole (Cynoglossus semilaevis). Int. J. Mol. Sci. 2025, 26, 1999. https://doi.org/10.3390/ijms26051999
Han T, Liu Y, Li M, Zhang Y, He Z, Ren Y, Cao W, Ren J, Wang Y, Wang G, et al. Function of lamp2 Gene Response to Vibrio vulnificus Infection and LPS Stimulation in the Half-Smooth Tongue Sole (Cynoglossus semilaevis). International Journal of Molecular Sciences. 2025; 26(5):1999. https://doi.org/10.3390/ijms26051999
Chicago/Turabian StyleHan, Tian, Yufeng Liu, Mengchao Li, Yitong Zhang, Zhongwei He, Yuqin Ren, Wei Cao, Jiangong Ren, Yufen Wang, Guixing Wang, and et al. 2025. "Function of lamp2 Gene Response to Vibrio vulnificus Infection and LPS Stimulation in the Half-Smooth Tongue Sole (Cynoglossus semilaevis)" International Journal of Molecular Sciences 26, no. 5: 1999. https://doi.org/10.3390/ijms26051999
APA StyleHan, T., Liu, Y., Li, M., Zhang, Y., He, Z., Ren, Y., Cao, W., Ren, J., Wang, Y., Wang, G., Gong, C., & Hou, J. (2025). Function of lamp2 Gene Response to Vibrio vulnificus Infection and LPS Stimulation in the Half-Smooth Tongue Sole (Cynoglossus semilaevis). International Journal of Molecular Sciences, 26(5), 1999. https://doi.org/10.3390/ijms26051999

