ANKRD2 Knockdown as a Therapeutic Strategy in Osteosarcoma: Effects on Proliferation and Drug Response in U2OS and HOS Cells
Abstract
1. Introduction
2. Results
2.1. Ankrd2 Knockdown Impairs Cell Proliferation
2.2. Ankrd2 Reduction Affects the Transduction of Mitogenic Stimulation
2.3. Ankrd2 Reduction Impairs Nuclear Morphology and DNA Integrity
2.4. Ankrd2 Modulates the Cellular Sensitivity to Doxorubicin and Cisplatin
3. Discussion
4. Material and Methods
4.1. Cell Cultures, Plasmids, and Treatments
4.2. Cell Cycle Analysis
4.3. Protein Extracts and Immunoblot
4.4. Quantitative Real-Time PCR
- human RPLP0
- (F: TACACCTTC CCACTTGCTGA, R: CCATATCCTCGTCCGACTCC);
- human ANKRD2
- (F: CGGTTATGGACGGCACCAT, R: CTTCTCATCCTCCAGCACCA);
- human Lamin A
- (F: CTCCTACCTCCTGGGCAACT, R: AGGTCCCAGATTACATGATGCT);
- human LMNA
- (F: GCAAAGTGCGTGAGGAGTTT, R: GAGTTCAGCAGAGCCTCCAG);
- human CCND1
- (F: CATCTACACCGACAACTCCATC, R: TCTGGCATTTTGGAGAGGAAG);
- human CCNB1
- (F: CCTCCCTTTTCAGTCCGC, R: CTCCTGTGTCAATATTCTCCAAATC).
4.5. Immunofluorescence
4.6. Reverse-Phase Protein Array (RPPA)
4.7. MTT Assay
4.8. Analysis of Clinical Data
4.9. Image Processing and Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Choi, J.H.; Ro, J.Y. The 2020 WHO Classification of Tumors of Soft Tissue: Selected Changes and New Entities. Adv. Anat. Pathol. 2021, 28, 44–58. [Google Scholar] [CrossRef] [PubMed]
- Schwab, J.H.; Springfield, D.S.; Raskin, K.A.; Mankin, H.J.; Hornicek, F.J. What’s new in primary bone tumors. J. Bone Jt. Surg. 2012, 94, 1913–1919. [Google Scholar] [CrossRef] [PubMed]
- Zhu, L.; McManus, M.M.; Hughes, D.P. Understanding the Biology of Bone Sarcoma from Early Initiating Events through Late Events in Metastasis and Disease Progression. Front. Oncol. 2013, 3, 230. [Google Scholar] [CrossRef] [PubMed]
- Meltzer, P.S.; Helman, L.J. New Horizons in the Treatment of Osteosarcoma. N. Engl. J. Med. 2021, 385, 2066–2076. [Google Scholar] [CrossRef] [PubMed]
- Ferrari, S.; Serra, M. An update on chemotherapy for osteosarcoma. Expert Opin. Pharmacother. 2015, 16, 2727–2736. [Google Scholar] [CrossRef] [PubMed]
- Cenni, V.; Kojic, S.; Capanni, C.; Faulkner, G.; Lattanzi, G. Ankrd2 in Mechanotransduction and Oxidative Stress Response in Skeletal Muscle: New Cues for the Pathogenesis of Muscular Laminopathies. Oxidative Med. Cell. Longev. 2019, 2019, 7318796. [Google Scholar] [CrossRef]
- Miller, M.K.; Bang, M.L.; Witt, C.C.; Labeit, D.; Trombitas, C.; Watanabe, K.; Granzier, H.; McElhinny, A.S.; Gregorio, C.C.; Labeit, S. The muscle ankyrin repeat proteins: CARP, ankrd2/Arpp and DARP as a family of titin filament-based stress response molecules. J. Mol. Biol. 2003, 333, 951–964. [Google Scholar] [CrossRef] [PubMed]
- Kojic, S.; Medeot, E.; Guccione, E.; Krmac, H.; Zara, I.; Martinelli, V.; Valle, G.; Faulkner, G. The Ankrd2 protein, a link between the sarcomere and the nucleus in skeletal muscle. J. Mol. Biol. 2004, 339, 313–325. [Google Scholar] [CrossRef]
- Kim, J.J.; Lee, S.Y.; Gong, F.; Battenhouse, A.M.; Boutz, D.R.; Bashyal, A.; Refvik, S.T.; Chiang, C.M.; Xhemalce, B.; Paull, T.T.; et al. Systematic bromodomain protein screens identify homologous recombination and R-loop suppression pathways involved in genome integrity. Genes Dev. 2019, 33, 1751–1774. [Google Scholar] [CrossRef] [PubMed]
- Cenni, V.; Bavelloni, A.; Beretti, F.; Tagliavini, F.; Manzoli, L.; Lattanzi, G.; Maraldi, N.M.; Cocco, L.; Marmiroli, S. Ankrd2/ARPP is a novel Akt2 specific substrate and regulates myogenic differentiation upon cellular exposure to H2O2. Mol. Biol. Cell 2011, 22, 2946–2956. [Google Scholar] [CrossRef]
- Luck, K.; Kim, D.K.; Lambourne, L.; Spirohn, K.; Begg, B.E.; Bian, W.; Brignall, R.; Cafarelli, T.; Campos-Laborie, F.J.; Charloteaux, B.; et al. A reference map of the human binary protein interactome. Nature 2020, 580, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Bean, C.; Facchinello, N.; Faulkner, G.; Lanfranchi, G. The effects of Ankrd2 alteration indicate its involvement in cell cycle regulation during muscle differentiation. Biochim. Biophys. Acta 2008, 1783, 1023–1035. [Google Scholar] [CrossRef] [PubMed]
- Angori, S.; Capanni, C.; Faulkner, G.; Bean, C.; Boriani, G.; Lattanzi, G.; Cenni, V. Emery-Dreifuss Muscular Dystrophy-Associated Mutant Forms of Lamin A Recruit the Stress Responsive Protein Ankrd2 into the Nucleus, Affecting the Cellular Response to Oxidative Stress. Cell. Physiol. Biochem. 2017, 42, 169–184. [Google Scholar] [CrossRef] [PubMed]
- Piazzi, M.; Kojic, S.; Capanni, C.; Stamenkovic, N.; Bavelloni, A.; Marin, O.; Lattanzi, G.; Blalock, W.; Cenni, V. Ectopic Expression of Ankrd2 Affects Proliferation, Motility and Clonogenic Potential of Human Osteosarcoma Cells. Cancers 2021, 13, 174. [Google Scholar] [CrossRef]
- Kuijjer, M.L.; van den Akker, B.E.; Hilhorst, R.; Mommersteeg, M.; Buddingh, E.P.; Serra, M.; Burger, H.; Hogendoorn, P.C.; Cleton-Jansen, A.M. Kinome and mRNA expression profiling of high-grade osteosarcoma cell lines implies Akt signaling as possible target for therapy. BMC Med. Genom. 2014, 7, 4. [Google Scholar] [CrossRef]
- Sasaki, K.; Hitora, T.; Nakamura, O.; Kono, R.; Yamamoto, T. The role of MAPK pathway in bone and soft tissue tumors. Anticancer Res. 2011, 31, 549–553. [Google Scholar]
- Yu, Y.; Luk, F.; Yang, J.L.; Walsh, W.R. Ras/Raf/MEK/ERK pathway is associated with lung metastasis of osteosarcoma in an orthotopic mouse model. Anticancer Res. 2011, 31, 1147–1152. [Google Scholar]
- Cenni, V.; Capanni, C.; Mattioli, E.; Schena, E.; Squarzoni, S.; Bacalini, M.G.; Garagnani, P.; Salvioli, S.; Franceschi, C.; Lattanzi, G. Lamin A involvement in ageing processes. Ageing Res. Rev. 2020, 62, 101073. [Google Scholar] [CrossRef]
- Zhao, J.; Zhang, H.; Pan, C.; He, Q.; Zheng, K.; Tang, Y. Advances in research on the relationship between the LMNA gene and human diseases (Review). Mol. Med. Rep. 2024, 30, 236. [Google Scholar] [CrossRef]
- Shin, J.Y.; Worman, H.J. Molecular Pathology of Laminopathies. Annu. Rev. Pathol. 2022, 17, 159–180. [Google Scholar] [CrossRef] [PubMed]
- Gonzalo, S. DNA damage and lamins. Adv. Exp. Med. Biol. 2014, 773, 377–399. [Google Scholar] [PubMed]
- Singh, M.; Hunt, C.R.; Pandita, R.K.; Kumar, R.; Yang, C.R.; Horikoshi, N.; Bachoo, R.; Serag, S.; Story, M.D.; Shay, J.W.; et al. Lamin A/C depletion enhances DNA damage-induced stalled replication fork arrest. Mol. Cell. Biol. 2013, 33, 1210–1222. [Google Scholar] [CrossRef] [PubMed]
- Romani, A.M.P. Cisplatin in cancer treatment. Biochem. Pharmacol. 2022, 206, 115323. [Google Scholar] [CrossRef] [PubMed]
- Johnson-Arbor, K.; Dubey, R. Doxorubicin. In StatPearls; StatPearls Inc.: Treasure Island, FL, USA, 2024. [Google Scholar]
- Zhang, L.M.; Su, L.X.; Hu, J.Z.; Wang, M.; Ju, H.Y.; Li, X.; Han, Y.F.; Xia, W.Y.; Guo, W.; Ren, G.X.; et al. Epigenetic regulation of VENTXP1 suppresses tumor proliferation via miR-205-5p/ANKRD2/NF-kB signaling in head and neck squamous cell carcinoma. Cell Death Dis. 2020, 11, 838. [Google Scholar] [CrossRef] [PubMed]
- Yao, S.; Xiao, H.; Wei, C.; Chen, S. ANKRD2 expression combined with TNFRSF19 expression for evaluating the prognosis of oral squamous cell carcinoma patients. Heliyon 2024, 10, e24091. [Google Scholar] [CrossRef] [PubMed]
- Ishiguro, N.; Motoi, T.; Osaki, M.; Araki, N.; Minamizaki, T.; Moriyama, M.; Ito, H.; Yoshida, H. Immunohistochemical analysis of a muscle ankyrin-repeat protein, Arpp, in paraffin-embedded tumors: Evaluation of Arpp as a tumor marker for rhabdomyosarcoma. Hum. Pathol. 2005, 36, 620–625. [Google Scholar] [CrossRef] [PubMed]
- Shomori, K.; Nagashima, Y.; Kuroda, N.; Honjo, A.; Tsukamoto, Y.; Tokuyasu, N.; Maeta, N.; Matsuura, K.; Hijiya, N.; Yano, S.; et al. ARPP protein is selectively expressed in renal oncocytoma, but rarely in renal cell carcinomas. Mod. Pathol. 2007, 20, 199–207. [Google Scholar] [CrossRef]
- Pawlonka, J.; Rak, B.; Ambroziak, U. The regulation of cyclin D promoters—Review. Cancer Treat. Res. Commun. 2021, 27, 100338. [Google Scholar] [CrossRef]
- Bean, C.; Verma, N.K.; Yamamoto, D.L.; Chemello, F.; Cenni, V.; Filomena, M.C.; Chen, J.; Bang, M.L.; Lanfranchi, G. Ankrd2 is a modulator of NF-kappaB-mediated inflammatory responses during muscle differentiation. Cell Death Dis. 2014, 5, e1002. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Sun, Z.; Cui, Y.; Qin, L.; Wu, F.; Li, Y.; Du, N.; Li, X. Knockdown of LMNB1 Inhibits the Proliferation of Lung Adenocarcinoma Cells by Inducing DNA Damage and Cell Senescence. Front. Oncol. 2022, 12, 913740. [Google Scholar] [CrossRef]
- Qiu, H.; Sun, Y.; Wang, X.; Gong, T.; Su, J.; Shen, J.; Zhou, J.; Xia, J.; Wang, H.; Meng, X.; et al. Lamin A/C deficiency-mediated ROS elevation contributes to pathogenic phenotypes of dilated cardiomyopathy in iPSC model. Nat. Commun. 2024, 15, 7000. [Google Scholar] [CrossRef]
- Kovacs, M.T.; Vallette, M.; Wiertsema, P.; Dingli, F.; Loew, D.; Nader, G.P.F.; Piel, M.; Ceccaldi, R. DNA damage induces nuclear envelope rupture through ATR-mediated phosphorylation of lamin A/C. Mol. Cell 2023, 83, 3659–3668.e10. [Google Scholar] [CrossRef]
- Lee, J.M.; Nobumori, C.; Tu, Y.; Choi, C.; Yang, S.H.; Jung, H.J.; Vickers, T.A.; Rigo, F.; Bennett, C.F.; Young, S.G.; et al. Modulation of LMNA splicing as a strategy to treat prelamin A diseases. J. Clin. Investig. 2016, 126, 1592–1602. [Google Scholar] [CrossRef]
- Edmond, V.; Merdzhanova, G.; Gout, S.; Brambilla, E.; Gazzeri, S.; Eymin, B. A new function of the splicing factor SRSF2 in the control of E2F1-mediated cell cycle progression in neuroendocrine lung tumors. Cell Cycle 2013, 12, 1267–1278. [Google Scholar] [CrossRef] [PubMed]
- Jung, H.J.; Coffinier, C.; Choe, Y.; Beigneux, A.P.; Davies, B.S.; Yang, S.H.; Barnes, R.H., 2nd; Hong, J.; Sun, T.; Pleasure, S.J.; et al. Regulation of prelamin A but not lamin C by miR-9, a brain-specific microRNA. Proc. Natl. Acad. Sci. USA 2012, 109, E423–E431. [Google Scholar] [CrossRef]
- Tsukamoto, Y.; Hijiya, N.; Yano, S.; Yokoyama, S.; Nakada, C.; Uchida, T.; Matsuura, K.; Moriyama, M. Arpp/Ankrd2, a member of the muscle ankyrin repeat proteins (MARPs), translocates from the I-band to the nucleus after muscle injury. Histochem. Cell Biol. 2008, 129, 55–64. [Google Scholar] [CrossRef]
- Lane, D. Awakening angels. Nature 1998, 394, 616–617. [Google Scholar] [CrossRef] [PubMed]
- Rocha, S.; Martin, A.M.; Meek, D.W.; Perkins, N.D. p53 represses cyclin D1 transcription through down regulation of Bcl-3 and inducing increased association of the p52 NF-kappaB subunit with histone deacetylase 1. Mol. Cell. Biol. 2003, 23, 4713–4727. [Google Scholar] [CrossRef]
- Krause, K.; Wasner, M.; Reinhard, W.; Haugwitz, U.; Dohna, C.L.; Mossner, J.; Engeland, K. The tumour suppressor protein p53 can repress transcription of cyclin B. Nucleic Acids Res. 2000, 28, 4410–4418. [Google Scholar] [CrossRef]
- Chen, J. The Cell-Cycle Arrest and Apoptotic Functions of p53 in Tumor Initiation and Progression. Cold Spring Harb. Perspect. Med. 2016, 6, a026104. [Google Scholar] [CrossRef] [PubMed]
- Kirby, T.J.; Zahr, H.C.; Fong, E.H.H.; Lammerding, J. Eliminating elevated p53 signaling fails to rescue skeletal muscle defects or extend survival in lamin A/C-deficient mice. Cell Death Discov. 2024, 10, 245. [Google Scholar] [CrossRef] [PubMed]
- Bednarski, B.K.; Baldwin, A.S., Jr.; Kim, H.J. Addressing reported pro-apoptotic functions of NF-kappaB: Targeted inhibition of canonical NF-kappaB enhances the apoptotic effects of doxorubicin. PLoS ONE 2009, 4, e6992. [Google Scholar] [CrossRef] [PubMed]
- Marioli-Sapsakou, G.K.; Kourti, M. Targeting Production of Reactive Oxygen Species as an Anticancer Strategy. Anticancer Res. 2021, 41, 5881–5902. [Google Scholar] [CrossRef]
- Mueck, K.; Rebholz, S.; Harati, M.D.; Rodemann, H.P.; Toulany, M. Akt1 Stimulates Homologous Recombination Repair of DNA Double-Strand Breaks in a Rad51-Dependent Manner. Int. J. Mol. Sci. 2017, 18, 2473. [Google Scholar] [CrossRef]
- Vidal, M.A.; Kilroy, G.E.; Johnson, J.R.; Lopez, M.J.; Moore, R.M.; Gimble, J.M. Cell growth characteristics and differentiation frequency of adherent equine bone marrow-derived mesenchymal stromal cells: Adipogenic and osteogenic capacity. Vet. Surg. 2006, 35, 601–610. [Google Scholar] [CrossRef]
- Cenni, V.; Evangelisti, C.; Santi, S.; Sabatelli, P.; Neri, S.; Cavallo, M.; Lattanzi, G.; Mattioli, E. Desmin and Plectin Recruitment to the Nucleus and Nuclei Orientation Are Lost in Emery-Dreifuss Muscular Dystrophy Myoblasts Subjected to Mechanical Stimulation. Cells 2024, 13, 162. [Google Scholar] [CrossRef]
- Coarfa, C.; Grimm, S.L.; Rajapakshe, K.; Perera, D.; Lu, H.Y.; Wang, X.; Christensen, K.R.; Mo, Q.; Edwards, D.P.; Huang, S. Reverse-Phase Protein Array: Technology, Application, Data Processing, and Integration. J. Biomol. Tech. 2021, 32, 15–29. [Google Scholar] [CrossRef]
- Amore, E.; Cenni, V.; Piazzi, M.; Signore, M.; Orlandi, G.; Neri, S.; Biressi, S.; Barone, R.; Di Felice, V.; Follo, M.Y.; et al. Myoblast-Derived Galectin 3 Impairs the Early Phases of Osteogenesis Affecting Notch and Akt Activity. Biomolecules 2024, 14, 1243. [Google Scholar] [CrossRef] [PubMed]




Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cenni, V.; Bavelloni, A.; Capanni, C.; Mattioli, E.; Bortolozzo, F.; Kojic, S.; Orlandi, G.; Bertacchini, J.; Blalock, W.L. ANKRD2 Knockdown as a Therapeutic Strategy in Osteosarcoma: Effects on Proliferation and Drug Response in U2OS and HOS Cells. Int. J. Mol. Sci. 2025, 26, 1736. https://doi.org/10.3390/ijms26041736
Cenni V, Bavelloni A, Capanni C, Mattioli E, Bortolozzo F, Kojic S, Orlandi G, Bertacchini J, Blalock WL. ANKRD2 Knockdown as a Therapeutic Strategy in Osteosarcoma: Effects on Proliferation and Drug Response in U2OS and HOS Cells. International Journal of Molecular Sciences. 2025; 26(4):1736. https://doi.org/10.3390/ijms26041736
Chicago/Turabian StyleCenni, Vittoria, Alberto Bavelloni, Cristina Capanni, Elisabetta Mattioli, Federico Bortolozzo, Snezana Kojic, Giulia Orlandi, Jessika Bertacchini, and William L. Blalock. 2025. "ANKRD2 Knockdown as a Therapeutic Strategy in Osteosarcoma: Effects on Proliferation and Drug Response in U2OS and HOS Cells" International Journal of Molecular Sciences 26, no. 4: 1736. https://doi.org/10.3390/ijms26041736
APA StyleCenni, V., Bavelloni, A., Capanni, C., Mattioli, E., Bortolozzo, F., Kojic, S., Orlandi, G., Bertacchini, J., & Blalock, W. L. (2025). ANKRD2 Knockdown as a Therapeutic Strategy in Osteosarcoma: Effects on Proliferation and Drug Response in U2OS and HOS Cells. International Journal of Molecular Sciences, 26(4), 1736. https://doi.org/10.3390/ijms26041736

