Allele-Specific CG/CCWGG Methylation of the PSA Promoter Discriminates Aggressive, Indolent, and Benign Prostate Cell Lines and Is Involved in the Regulation of PSA Expression
Abstract
1. Introduction
2. Results
2.1. The Proximal PSA Promoter Has an Individual CG/CCWGG Methylation Pattern in Prostate Cell Lines
2.1.1. The Monoallelic Methylation of CG/CCWGG Sites in the PSA Promoter Observed in BPH1 Cells and the Biallelic Stochastic Distribution of CpG Methylation in HPrEpiC Cells Represent Distinctive Patterns Specific to These Cell Lines
2.1.2. The Biallelic Methylation of the PSA Promoter in PC3 Cells and the Fully Unmethylated State in LNCaP Cells Represent Cancer-Specific Methylation Patterns
2.2. LNCaP Cells Biallelically Express PSA mRNA
2.3. Allele-Specific CG/CCWGG Methylation of the PSA Promoter Is Involved in the Regulation of PSA Expression
2.4. DNMT1 and DNMT3B Exhibit Overall Expression Profiles in BPH1 and PA1 Cells But Are Differentially Expressed in LNCaP, PC3, and HPrEpiC Cell Lines
3. Discussion
4. Materials and Methods
4.1. Cell Lines
4.2. DNA Extraction and Bisulfite Treatment
4.3. Bisulfite Sequencing Analysis
4.4. RNA Extraction
4.5. cDNA Synthesis, RT/Nested RT-PCR
4.6. Quantitative Real-Time PCR
4.7. Primer Design
4.8. Bioinformatics
4.9. Statistical Methods and Associated Software
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Stamey, T.A.; Yang, N.; Hay, A.R.; McNeal, J.E.; Freiha, F.S.; Redwine, E. Prostate specific antigen as a serum marker for adenocarcinoma of the prostate. N. Engl. J. Med. 1987, 317, 909–916. [Google Scholar] [CrossRef] [PubMed]
 - Catalona, W.J.; Smith, D.S.; Ratliff, T.L.; Dodds, K.M.; Coplen, D.E.; Yuan, J.J.; Petros, J.A.; Andriole, G.L. Measurement of prostate-specific antigen in serum as a screening test for prostate cancer. N. Engl. J. Med. 1991, 324, 1156–1161. [Google Scholar] [CrossRef] [PubMed]
 - Oesterling, J.E. Prostate specific antigen: A critical assessment of the most useful tumor marker for adenocarcinoma of the prostate. J. Urol. 1991, 145, 907–923. [Google Scholar] [CrossRef] [PubMed]
 - Majumdar, S.; Diamandis, E.P. The promoter and the enhancer region of the KLK 3 (prostate specific antigen) gene is frequently mutated in breast tumors and in breast carcinoma cell lines. Br. J. Cancer 1999, 79, 1594–1602. [Google Scholar] [CrossRef]
 - Merriel, S.W.D.; Pocock, L.; Gilbert, E.; Creavin, S.; Walter, F.M.; Spencer, A.; Hamilton, W. Systematic review and meta-analysis of the diagnostic accuracy of prostate-specific antigen (PSA) for the detection of prostate cancer in symptomatic patients. BMC Med. 2022, 20, 54. [Google Scholar] [CrossRef]
 - Olkhov-Mitsel, E.; van der Kwast, T.; Kron, K.; Ozcelik, H.; Briollais, L.; Massaey, C.; Recker, F.; Kwiatkowski, M.; Fleshner, N.; Diamandis, E.; et al. Quantitative DNA methylation analysis of genes coding for kallikrein-related peptidases 6 and 10 as biomarkers for prostate cancer. Epigenetics 2012, 7, 1037–1045. [Google Scholar] [CrossRef]
 - Tontonoz, P.; Hu, E.; Spiegelman, B.M. Stimulation of adipogenesis in fibroblasts by PPAR gamma 2, a lipid-activated transcription factor. Cell 1994, 79, 1147–1156. [Google Scholar] [CrossRef]
 - Baryshev, M.; Petrov, N.; Ryabov, V.; Popov, B. Transient expression of inactive RB in mesenchymal stem cells impairs their adipogenic potential and is associated with hypermethylation of the PPARγ2 promoter. Genes Dis. 2022, 9, 165–175. [Google Scholar] [CrossRef]
 - Su, X.J.; Zeng, X.T.; Fang, C.; Liu, T.Z.; Wang, X.H. Genetic association between PSA-158G/A polymorphism and the susceptibility of benign prostatic hyperplasia: A meta-analysis. Oncotarget 2017, 8, 33953–33960. [Google Scholar] [CrossRef]
 - Mitchell, S.; Abel, P.; Ware, M.; Stamp, G.; Lalani, E. Phenotypic and genotypic characterization of commonly used human prostatic cell lines. BJU Int. 2000, 85, 932–944. [Google Scholar] [CrossRef]
 - McIntyre, I.G.; Spreckley, K.; Clarke, R.B.; Anderson, E.; Clarke, N.W.; George, N.J.R. Optimization of the reverse transcriptase polymerase chain reaction for the detection of circulating prostate cells. Br. J. Cancer 2000, 83, 992–997. [Google Scholar] [CrossRef] [PubMed]
 - Rebelo, T.S.C.R.; Noronha, J.P.; Galésio, M.; Santos, H.; Diniz, M.; Sales, M.G.F.; Fernandes, M.H.; Costa-Rodrigues, J. Testing the variability of PSA expression by different human prostate cancer cell lines by means of a new potentiometric device employing molecularly antibody assembled on graphene surface. Mater. Sci. Eng. C 2016, 59, 1069–1078. [Google Scholar] [CrossRef] [PubMed]
 - Fagerberg, L.; Hallström, B.M.; Oksvold, P.; Kampf, C.; Djureinovic, D.; Odeberg, J.; Habuka, M.; Tahmasebpoor, S.; Danielsson, A.; Edlund, K.; et al. Analysis of the human tissue-specific expression by genome-wide integration of transcriptomics and antibody-based proteomics. Mol. Cell. Proteom. 2014, 13, 397–406. [Google Scholar] [CrossRef] [PubMed]
 - Liang, G.; Chan, M.F.; Tomigahara, Y.; Tsai, Y.C.; Gonzales, F.A.; Li, E.; Laird, P.W.; Jones, P.A. Cooperativity between DNA methyltransferases in the maintenance methylation of repetitive elements. Mol. Cell. Biol. 2002, 22, 480–491. [Google Scholar] [CrossRef] [PubMed]
 - Chen, T.; Ueda, Y.; Dodge, J.E.; Wang, Z.; Li, E. Establishment and maintenance of genomic methylation patterns in mouse embryonic stem cells by Dnmt3a and Dnmt3b. Mol. Cell. Biol. 2003, 23, 5594–5605. [Google Scholar] [CrossRef]
 - Monahan, K.; Lomvardas, S. Monoallelic expression of olfactory receptors. Annu. Rev. Cell Dev. Biol. 2015, 31, 721–740. [Google Scholar] [CrossRef]
 - da Rocha, S.T.; Gendrel, A.-V. The influence of DNA methylation on monoallelic expression. Essays Biochem. 2019, 63, 663–676. [Google Scholar]
 - Gupta, S.; Lafontaine, D.L.; Vigneau, S.; Vinogradova, S.; Mendelevich, A.; Igarashi, K.J.; Bortvin, A.; Alves-Pereira, C.F.; Clement, K.; Pinello, L.; et al. Mechanism of monoallelic expression and allelic rheostat role of DNA methylation. bioRxiv 2020. [Google Scholar] [CrossRef]
 - Kobayashi, H.; Sakurai, T.; Sato, S.; Nakabayashi, K.; Hata, K.; Kono, T. Imprinted DNA methylation reprogramming during early mouse embryogenesis at the Gpr1-Zdbf2 locus is linked to long cis-intergenic transcription. FEBS Lett. 2012, 586, 827–833. [Google Scholar] [CrossRef]
 - Franchina, M.; Kay, P.H. Evidence that cytosine residues within 5′-CCTGG-3′ pentanucleotides can be methylated in human DNA independently of the methylating system that modifies 5′-CG-3′ dinucleotides. DNA Cell Biol. 2000, 19, 521–526. [Google Scholar] [CrossRef]
 - Malone, C.S.; Miner, M.D.; Doerr, J.R.; Jackson, J.P.; Jacobsen, S.E.; Wall, R.; Teitell, M. CmC(A/T)GG DNA methylation in mature B-cell lymphoma gene silencing. Proc. Natl. Acad. Sci. USA 2001, 98, 10404–10409. [Google Scholar] [CrossRef] [PubMed]
 - Nishino, K.; Hattori, N.; Sato, S.; Arai, Y.; Tanaka, S.; Nagy, A.; Shiota, K. Non-CpG methylation occurs in the regulatory region of the Sry gene. J. Reprod. Dev. 2011, 57, 586–593. [Google Scholar] [CrossRef] [PubMed]
 - Lorincz, M.C.; Groudine, M. CmC(a/t)GG methylation: A new epigenetic mark in mammalian DNA? Proc. Natl. Acad. Sci. USA 2001, 98, 10034–10036. [Google Scholar] [CrossRef] [PubMed]
 - Baryshev, M.; Inashkina, I.; Salmina, K.; Huna, A.; Jackson, T.R.; Erenpreisa, J. DNA methylation of the Oct4A enhancers in embryonal carcinoma cells after etoposide treatment is associated with alternative splicing and altered pluripotency in reversibly senescent cells. Cell Cycle 2018, 17, 362–366. [Google Scholar] [CrossRef]
 - Ogawa, O.; Eccles, M.R.; Szeto, J.; McNoe, L.A.; Yun, K.; Maw, M.A.; Smith, P.J.; Reeve, A.E. Relaxation of insulin-like growth factor II gene imprinting implicated in Wilms’ tumor. Nature 1993, 362, 749–751. [Google Scholar] [CrossRef]
 - Rainier, S.; Johnson, L.A.; Dobry, C.J.; Ping, A.J.; Grundy, P.E.; Feinberg, A.P. Relaxation of imprinted genes in human cancer. Nature 1993, 362, 747–749. [Google Scholar] [CrossRef]
 - Cui, H.; Cruz-Correa, M.; Giardiello, F.M.; Hutcheon, D.F.; Kafonek, D.R.; Brandenburg, S.; Wu, Y.; He, X.; Powe, N.R.; Feinberg, A.P. Loss of IGF2 imprinting: A potential marker of colorectal cancer risk. Science 2003, 299, 1753–1755. [Google Scholar] [CrossRef]
 - de Souza, A.T.; Yamada, T.; Mills, J.J.; Jirtle, R.L. Imprinted genes in liver carcinogenesis. FASEB J. 1997, 11, 60–67. [Google Scholar] [CrossRef]
 - Kobatake, T.; Yano, M.; Toyooka, S.; Tsukuda, K.; Dote, H.; Kikuchi, T.; Toyota, M.; Ouchida, M.; Aoe, M.; Date, H.; et al. Aberrant methylation of p57KIP2 gene in lung and breast cancers and malignant mesotheliomas. Oncol. Rep. 2004, 12, 1087–1092. [Google Scholar] [CrossRef][Green Version]
 - Trouillard, O.; Aguirre-Cruz, L.; Hoang-Xuan, K.; Marie, Y.; Delattre, J.-Y.; Sanson, M. Parental 19q loss and PEG3 expression in oligodendrogliomas. Cancer Genet. Cytogenet. 2004, 151, 182–183. [Google Scholar] [CrossRef]
 - Thompson, I.M.; Dmitrijs, M.; Ivan, M. Prevalence of prostate cancer among men with a prostate-specific antigen level ≤4.0 ng per milliliter. N. Engl. J. Med. 2004, 350, 2239–2246. [Google Scholar] [CrossRef]
 - Baryshev, M.; Merculov, D.; Mironov, I. A new device-mediated miniprep method. AMB Express 2022, 12, 21. [Google Scholar]
 





| Gene Symbol  | Sequence (5′ ⟶ 3′) Forward/Reverse  | Exon Location  | Tm (°C) | Size (bp) | Accession No. | 
|---|---|---|---|---|---|
| DNMT1 | GGATTAGGGAGTTTTATAATTTTTTG AACCCACATAATAACACAACTCT  | 4 6  | 60 | 135 | NM_001160045 | 
| DNMT3A | TATTGATGAGCGCACAAGAGAGC TTGGCACATTCCTCCAACGAAG  | 11 12  | 60 | 136 | NM_022552 | 
| DNMT3B | GAATTACTCACGCCCCAAGGA TGGCATCAATCATCACTGGATTAC  | 19 20  | 60 | 135 | NM_006892 | 
| TBP | GAGCCAAGAGTGAAGAACAGTCC AACTTCACATCACAGCTCCCCA  | 5,6 6  | 60 | 130 | NM_003194 | 
| PSA  ORF  | AGCTGTGTCACCATGTGGG CTCAGGGGTTGGCCACGA  | 1 5  | 60 | 799 | NM_001648 | 
| PSA Inner  | CAGTCTGCGGCGGTGTTCT GGGTCAAGAACTCCTCTGGTTCA  | 2 3,4  | 58 | 358 | NM_001648 | 
| PSMA | CAGTCTGCGGCGGTGTTCT CAGGCCAAATTCTTTCCACTGGGA  | 1 3  | 60 | 478 | NM_004476 | 
| ACTB | CGCCCTGCCTATCTGTATT TCCCCACAGGGAGTGTGTAG  | 4 5  | 60 | 230 | NM_001101.5 | 
| Primer sequences for bisulfite sequencing analysis | |||||
| Gene Symbol  | Sequence (5′ ⟶ 3′) Forward/Reverse  | Promoter Location  | Tm (°C) | Size (bp) | Accession No | 
| PSA | GGATTAGGGAGTTTTATAATTTTTTG AACCCACATAATAACACAACTCT  | −393 +51  | 64 | 443 | Acc:HGNC:6364 50,854,915-50,860,764  | 
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.  | 
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Baryshev, M.; Vjaters, E. Allele-Specific CG/CCWGG Methylation of the PSA Promoter Discriminates Aggressive, Indolent, and Benign Prostate Cell Lines and Is Involved in the Regulation of PSA Expression. Int. J. Mol. Sci. 2025, 26, 1243. https://doi.org/10.3390/ijms26031243
Baryshev M, Vjaters E. Allele-Specific CG/CCWGG Methylation of the PSA Promoter Discriminates Aggressive, Indolent, and Benign Prostate Cell Lines and Is Involved in the Regulation of PSA Expression. International Journal of Molecular Sciences. 2025; 26(3):1243. https://doi.org/10.3390/ijms26031243
Chicago/Turabian StyleBaryshev, Mikhail, and Egils Vjaters. 2025. "Allele-Specific CG/CCWGG Methylation of the PSA Promoter Discriminates Aggressive, Indolent, and Benign Prostate Cell Lines and Is Involved in the Regulation of PSA Expression" International Journal of Molecular Sciences 26, no. 3: 1243. https://doi.org/10.3390/ijms26031243
APA StyleBaryshev, M., & Vjaters, E. (2025). Allele-Specific CG/CCWGG Methylation of the PSA Promoter Discriminates Aggressive, Indolent, and Benign Prostate Cell Lines and Is Involved in the Regulation of PSA Expression. International Journal of Molecular Sciences, 26(3), 1243. https://doi.org/10.3390/ijms26031243
        