Next Article in Journal
Hemostatic Profile and Serum Levels of Interferon Gamma-Induced Protein 10 (IP-10) in Neonates Born to Mothers with COVID-19 During the Peripartum Period
Next Article in Special Issue
Discovery of TRPV4-Targeting Small Molecules with Anti-Influenza Effects Through Machine Learning and Experimental Validation
Previous Article in Journal
HCoV-229E Mpro Suppresses RLR-Mediated Innate Immune Signalling Through Cleavage of NEMO and Through Other Mechanisms
Previous Article in Special Issue
Alzheimer’s Disease: Exploring Pathophysiological Hypotheses and the Role of Machine Learning in Drug Discovery
 
 
Correction published on 7 April 2026, see Int. J. Mol. Sci. 2026, 27(7), 3330.
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Elucidating the Mechanism of VVTT Infection Through Machine Learning and Transcriptome Analysis

1
Academy of Military Medical Sciences, Beijing 100850, China
2
Key Laboratory for Molecular Enzymology and Engineering of Ministry of Education, School of Life Sciences, Jilin University, 2699 Qianjin Street, Changchun 130012, China
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Int. J. Mol. Sci. 2025, 26(3), 1203; https://doi.org/10.3390/ijms26031203
Submission received: 17 December 2024 / Revised: 23 January 2025 / Accepted: 28 January 2025 / Published: 30 January 2025 / Corrected: 7 April 2026

Abstract

The vaccinia virus (VV) is extensively utilized as a vaccine vector in the treatment of various infectious diseases, cardiovascular diseases, immunodeficiencies, and cancers. The vaccinia virus Tiantan strain (VVTT) has been instrumental as an irreplaceable vaccine strain in the eradication of smallpox in China; however, it still presents significant adverse toxic effects. After the WHO recommended that routine smallpox vaccination be discontinued, the Chinese government stopped the national smallpox vaccination program in 1981. The outbreak of monkeypox in 2022 has focused people’s attention on the Orthopoxvirus. However, there are limited reports on the safety and toxic side effects of VVTT. In this study, we employed a combination of transcriptomic analysis and machine learning-based feature selection to identify key genes implicated in the VVTT infection process. We utilized four machine learning algorithms, including random forest (RF), minimum redundancy maximum relevance (MRMR), eXtreme Gradient Boosting (XGB), and least absolute shrinkage and selection operator cross-validation (LASSOCV), for feature selection. Among these, XGB was found to be the most effective and was used for further screening, resulting in an optimal model with an ROC curve of 0.98. Our analysis revealed the involvement of pathways such as spinocerebellar ataxia and the p53 signaling pathway. Additionally, we identified three critical targets during VVTT infection—ARC, JUNB, and EGR2—and further validated these targets using qPCR. Our research elucidates the mechanism by which VVTT infects cells, enhancing our understanding of the smallpox vaccine. This knowledge not only facilitates the development of new and more effective vaccines but also contributes to a deeper comprehension of viral pathogenesis. By advancing our understanding of the molecular mechanisms underlying VVTT infection, this study lays the foundation for the further development of VVTT. Such insights are crucial for strengthening global health security and ensuring a resilient response to future pandemics.

Graphical Abstract

1. Introduction

The vaccinia virus (VV), which is used as a smallpox vaccine, belongs to the family Poxviridae and genus Orthopoxvirus. It is a complex double-stranded DNA virus that only replicates and forms special viral particles in the cytoplasm of the host [1]. The VV genome size is 185–200 kb, and it can encode about 200 different proteins [2]. The smallpox vaccine developed from VV has played a crucial role in the global smallpox eradication campaign [3]. Furthermore, research on VV as a vector has made significant advancements in various areas [4]. VV has proven valuable in investigating vaccine vectors and exogenous gene expression systems [5] and is extensively utilized in genetic engineering for these purposes [6,7]. Moreover, live genetically engineered vector vaccines utilizing VV as vectors have been successfully developed [8,9]. Presently, key areas of focus in VV vector research include reducing the side effects of VV vaccines, enhancing the efficacy of vector vaccines, and streamlining preparation protocols [10,11,12,13,14].
The largest outbreak of monkeypox in history began in May 2022 and has rapidly spread across the globe ever since [15]. To date, the most effective way to prevent or control an Orthopoxvirus outbreak is through vaccination [16]. Research on antibody responses to Orthopoxvirus species suggests perfect cross-immunity between smallpox and monkeypox [17]. Attack rates in individuals with and without vaccination scars indicated that smallpox vaccination (discontinued in 1980) imparted approximately 85% protection against monkeypox [18]. Data suggest that prior immunization with the smallpox vaccine may have a protective effect against the monkeypox virus and may improve clinical manifestations of infection [19,20,21]. However, numerous reports of adverse reactions following smallpox vaccination have been documented in the United States, some of which are even life-threatening [22]. Second-generation vaccines have contraindications. Third-generation vaccines, although safer for immunocompromised populations, require two doses, which is an impediment to rapid outbreak response and still has side effects [23,24]. The Bipartisan Commission on Biodefense pointed out that smallpox and other Orthopoxviruses pose significant threats to the United States and the world because of their potential for weaponization, accidental release, and vulnerability of populations who stopped routinely vaccinating against smallpox in the 1970s [25]. Therefore, further research is needed to prepare for the potential hazards they may bring.
With the advancement of omics technologies, studies utilizing genomics and proteomics to investigate VV have been published, enhancing our understanding of the molecular mechanisms of VV infection in cells [26,27]. Machine learning has demonstrated significant potential in handling complex and diverse modern biological data [28,29,30]. It effectively overcomes the limitations of traditional methods in dealing with high-dimensional data, capturing non-linear relationships, processing noise, and integrating multiple data types, thus better elucidating the complex patterns and biological mechanisms within [31]. This capability not only makes data analysis more precise and efficient but also provides deeper insights into research [32]. Feature selection is a crucial step in machine learning, especially when dealing with high-dimensional data [33]. The goal of feature selection is to identify a subset of features that contribute most significantly to the model’s predictive performance, thereby reducing model complexity, improving generalization ability, and lowering computational costs. In transcriptome analysis, feature selection can help identify the most relevant genes, further elucidating their roles in biological processes [34]. Thus, feature selection holds significant potential for effectively mining transcriptome data.
The vaccinia virus Tiantan strain (VVTT) plays an irreplaceable role as a vaccine strain for the eradication of smallpox in China [35]. After the WHO recommended that routine smallpox vaccination be discontinued, the Chinese government stopped the national smallpox vaccination program in 1981 [36]. The emergence of studies on VVTT-specific humoral immunity timing and cross-immunity with monkeypox only occurred following the outbreak of monkeypox in China [37,38,39,40]. Nonetheless, there are limited reports on the safety and toxic side effects of VVTT. To address future demands, we utilize transcriptome analysis and machine learning for feature selection to pinpoint significantly differentially expressed genes in 293A cells under VVTT treatment. This approach aims to deepen our understanding of VVTT’s impact on cells and explore the pathogenesis of smallpox vaccine side effects, offering theoretical insights for future vaccine development.

2. Results and Discussion

2.1. Differential Gene Analysis

The results of the differential gene analysis are shown in Figure (Figure 1). The data indicate that the number of differentially expressed genes (DEGs) increases with the duration of VVTT infection. Specifically, the numbers of DEGs at 6 h, 12 h, and 24 h post-infection were 360, 391, and 1449, respectively. Additionally, there was a general upward trend in gene expression levels as the infection time increased.

2.2. Protein–Protein Interaction Network

To identify potential key genes, we constructed a protein–protein interaction (PPI) network using the genes identified in the differential gene analysis. Figure 2 displays approximately the top 100 genes. Based on their degree, we selected the top 20 genes from each group (Table 1). Genes such as DUSP1, EGR1, EGR2, EGR3, FOS, FOSB, FOSL1, JUNB, and ZFP36 appear multiple times, suggesting their possible roles in VVTT-infected cells.

2.3. Enrichment Analysis

To further investigate the potential mechanisms of VVTT infection in cells, we performed GO and KEGG pathway analyses on the DEGs (Figures S1–S6, Supplementary Materials). The GO analysis results suggest that processes such as the cellular response to decreased oxygen levels, cellular response to hypoxia, cellular response to oxygen levels, negative regulation of cell adhesion, positive regulation of cell development, regulation of nervous system development, response to glucocorticoids, and response to hypoxia may play significant roles when cells are infected with VVTT. Additionally, the GO terms “response to decreased oxygen levels” and “response to oxygen levels” appeared in the results of all three analyses, suggesting that they may play significant roles.
Then, we selected the top 20 KEGG pathways from each group for display (Table 2). Combined with the targets identified in the PPI network analysis, pathways such as amphetamine addiction, circadian entrainment, MAPK signaling pathway, osteoclast differentiation, C-type lectin receptor signaling pathway, and TNF signaling pathway may be associated with VVTT infection in A293 cells. Further analysis of the genes enriched in these pathways indicated that genes such as ARC, FOS, EGR2, EGR3, IL6, JUN, and JUNB may warrant further attention.

2.4. Initial Gene Screening Based on Machine Learning

To further investigate potential key genes, we used four machine learning algorithms—RF, LASSOCV, EN, and XGB—to preliminarily screen key genes from the expression matrix. We performed five-fold cross-validation twice, and the evaluation parameters obtained in each fold are shown in Figure 3. The comparison revealed that XGB produced the best results, so we focused subsequent analyses on further screening using XGB. Additionally, we combined the genes selected by the four algorithms with those obtained from the differential gene analysis to create a new feature set for further screening.
To further reduce the number of genes, we applied RFE, and the AUROC curves for the results are shown in Figure 4. Ultimately, we screened out 151 genes, which were ranked by importance and prepared for further screening.

2.5. Further Screening of Genes

To further refine the selection of key genes, we incorporated data from the GEO database into the analysis, combined with the previously screened 151 genes, forming a new dataset. We constructed models and evaluated them by combining different sampling methods, scaling methods, and numbers of features. As shown in Figure 5, the best scaling method was standard scaling (std), with an average ACC of 97.75%, and the best sampling method was SMOTE, with an average ACC of 98.33%, both yielding good results.
To determine the number of selected features, we analyzed the impact of different feature numbers on the model results (Figure 6). The results showed that the best performance was achieved with 30 features, with an average ACC of 98.04%. Therefore, we ultimately selected the top 30 genes as important genes.
Next, we evaluated the best model obtained from the above combinations, and its confusion matrix is shown in Figure 7, indicating good discrimination ability. Combining the above analysis with the results of the PPI and enrichment analyses, we found that genes such as ARC, EGR2, EGR3, FOS, FOSB, and JUNB appeared multiple times, suggesting they may be key genes in the process of VVTT infection in cells.

2.6. Quantitative Real-Time PCR (RT-qPCR) Analysis

To validate the reproducibility and repeatability of the DEGs identified from transcriptome sequencing, we selected twelve genes—JUNB, ARC, EGR3, DUSP5, CTGF, ZFP36, GPR3, NR4A1, TNFRSE12A, ETV5, TAF11L11, and ETV4—for RT-qPCR analysis (Figure 8). The results showed that these genes were significantly differentially expressed and consistently up- or down-regulated in line with the gene expression changes observed in RNA-Seq, indicating the reliability of the DEGs obtained from transcriptome sequencing.
The trends in differential expression of these genes confirmed by RT-qPCR in the mock vs. VVTT6 h, mock vs. VVTT12 h, and mock vs. VVTT24 h groups were consistent with those of the transcriptome sequencing results. This indicates that these genes are indeed up-regulated or down-regulated during infection and may play important roles in the infection process.

2.7. Discussion

In the field of Orthopoxvirus research, the integration of machine learning and transcriptomics has emerged as a potent tool. For instance, studies have utilized machine learning models to predict drugs against the monkeypox virus (MPXV) [41] or identified conserved surface sites of MPXV through immunoinformatics [42]. These studies offer valuable insights, particularly in enhancing the efficiency of vaccine and drug development through computational models. Poxvirus can exploit aberrant cell tumor suppression signals, such as the P53 signaling pathway, to enhance its oncolytic specificity and efficacy [43]. Our analysis confirms the engagement of pathways like spinocerebellar ataxia and the p53 signaling pathway during the infection process. These results were obtained by integrating high-throughput gene expression data with machine learning algorithms to identify potential key genes and signaling pathways during VVTT infection. The selection of these genes and pathways not only offers new insights into the pathogenic mechanisms of VVTT but also holds theoretical implications for future vaccine enhancements.
Since the eradication of smallpox, research on VVTT vaccines has been scarce, with a notable absence of human experimental data compared to other vaccine studies. Insufficient reliable data sources exist regarding the current analytical methods and results of VVTT, indicating numerous areas warranting further investigation. Particularly noteworthy are the recurring outbreaks of monkeypox, which, because of their close phylogenetic relationship, can serve as a breakthrough point if research data on monkeypox can be effectively consolidated and leveraged. Our current research primarily relies on computational simulations, leaving gaps in our understanding of the actual disease mechanisms. Further investigation is necessary to elucidate these mechanisms.
Furthermore, the experiment’s use of only three sub-holes per group may have resulted in a limited sample size for machine learning, potentially introducing more noise and requiring additional validation of the outcomes. Furthermore, while cross-validation was employed to minimize overfitting, the small sample size and high number of features could still pose a risk of overfitting, warranting further experimental scrutiny.

3. Materials and Methods

3.1. Datasets

Our dataset comprised transcriptome data obtained from our own experiments as well as data retrieved from the GEO database, specifically GSE36854 and GSE11238 [44]. To ensure the rigor of our data, we identified common gene expression data between our measured data and the GEO database entries and merged them into a new dataset. This newly formed dataset was subsequently used for machine learning in the following steps.

3.2. Virus and Cells

Human Embryonic Kidney 293A (A293) cells were maintained at 37 °C, 5% CO2 in a high-glucose Dulbecco’s modified Eagle’s medium (DMEM; Gibco, Waltham, MA, USA) that was supplemented with 10% fetal bovine serum (FBS; Gibco, Waltham, MA, USA), 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES; Gibco, Waltham, MA, USA), and 1% Penicillin Streptomycin (P/S; Gibco, Waltham, MA, USA). The 293A cells were purchased from the Cell Resource Center, Institute of Basic Medical Sciences (CAMS/PUMC), Beijing China, Laboratory Preservation and Subculture. The VVTT strain (GenBank accession no. AF095689) was obtained from the Institute of Virology at the Chinese Center for Disease Control and Prevention.

3.3. Sample Collection and RNA Extraction

The 293A cells were plated into a 6-well cell culture plate (Corning) in DMEM with 10% FBS until 5 × 105 cells/well density. The 293A cells were inoculated with 0.1 MOI VVTT and maintained at 37 °C, 5% CO2 for 1 h [45,46]. Afterward, the cells were washed thrice with PBS and grown in DMEM with 1% FBS. Samples were collected at 6, 12, and 24 h post-infection based on the growth curve pattern [47,48]. The experiment was performed with three biological replicates for error reduction.

3.4. Transcriptome Analysis

Total RNA was extracted using TRIzol® Reagent (Invitrogen, Waltham, Massachusetts, USA) according to the manufacturer’s instructions. Subsequently, samples were collected for transcriptome analysis. Quality control was performed on the raw data to remove low-quality data and noise. The sequencing data were then mapped to the reference genome, followed by normalization to determine gene expression levels. Finally, the differences in gene expression among different samples were analyzed.
We conducted differential gene analysis by comparing samples infected with VVTT at 6, 12, and 24 h to uninfected A293 cells at corresponding time points. The criteria for differential gene selection were a fold change greater than 2 and a p-value less than 0.05. The identified differentially expressed genes were then imported into STRING https://cn.string-db.org/ (accessed on 21 June 2024) and visualized using Cytoscape (Version: 3.10.1) [49,50]. The top 20 genes were selected as key genes based on their degree of centrality.
Next, we performed Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses on the differentially expressed genes [51,52,53]. Similarly, the top 20 pathways were selected as key pathways for further analysis.

3.5. Preliminary Screening

We employed algorithms such as random forest (RF), lasso regression (LASSOCV), elastic net (EN), and eXtreme Gradient Boosting (XGB) for feature selection, using the previously obtained expression matrix as the dataset. For RF, we used ExtraTreesClassifier with 500 estimators and a random state of 42 to ensure reproducibility. For LASSOCV, we utilized LassoCV with a random state of 42 and 50 parallel jobs. For EN, we employed ElasticNetCV with 5-fold cross-validation, a maximum of 10,000 iterations, a range of alpha values from 0.001 to 10, and l1_ratio values from 0.1 to 0.9. For XGB, we used XGBClassifier with 300 estimators, a learning rate of 1.0, a maximum depth of 3, and a random state of 42.
Five-fold cross-validation was performed and repeated twice. The features selected by these four algorithms were combined with those identified through differential gene analysis for the next round of screening. Additionally, accuracy (ACC), the area under the curve (AUC), Matthews correlation coefficient (MCC), sensitivity (SEN), and specificity (SPE) were used to evaluate each algorithm, and the best-performing algorithm was chosen for further analysis.
Next, we applied Recursive Feature Elimination (RFE) to further refine the selected features. The BRF function utilizes the following parameters: class_weight = “balanced_subsample” addresses class imbalance by assigning balanced weights to each class during training. Hyperparameter tuning is performed using param_grid to adjust three key parameters: n_estimators (100, 200, 300, 400, 500) controls the forest size; max_features (“sqrt: and “log2:) determines the number of features for tree splitting; max_depth (1, 3, 5, 7, 9) limits tree depth to prevent overfitting or underfitting. Furthermore, cv = 3 employs 3-fold cross-validation for model evaluation to ensure generalization ability. These parameters, combined with feature selection and hyperparameter optimization, train an optimized random forest classifier. The area under the receiver operating characteristic curve (AUROC) was generated for the analysis, and the genes were ranked by their importance from highest to lowest, preparing them for the next step of analysis.

3.6. Further Screening

We combined the selected data from the GEO database with the expression matrix of differentially expressed genes, using the genes and their expression levels identified in the previous step to form a new dataset. Using XGB as the base algorithm, we combined different scaling methods (StandardScaler, QuantileTransformer, PowerTransformer, and RobustScaler) and different sampling methods (Synthetic Minority Over-sampling Technique (SMOTE), Adaptive Synthetic Sampling Approach (ADASYN), Random Under-sampling (RUS), Random Over-sampling (ROS), Borderline-SMOTE (B-SMOTE), Support Vector Machine-SMOTE (SVM-SMOTE), Tomek Links, and NearMiss) and numbers of features, performing five-fold cross-validation and repeating twice. The performance of the algorithms was evaluated with the ACC score. The best algorithm was selected, and a confusion matrix was plotted. The selected features were comprehensively evaluated and combined with PPI and pathway enrichment analyses to identify the key features.

3.7. Validation of Transcriptome Sequencing Results

Reverse transcription quantitative real-time PCR (RT-qPCR) was performed to validate the DEGs identified from transcriptome sequencing. Twelve DEGs, namely, JUNB, ARC, EGR3, DUSP5, CTGF, ZFP36, GPR3, NR4A1, TNFRSE12A, ETV5, TAF11L11, and ETV4, were selected for RT-qPCR validation and analyses of gene expression. Total RNA extraction was performed using TRIzol reagent (Invitrogen, Waltham, Massachusetts, USA) following the manufacturer’s instructions. Sequence-specific primers of genes were designed using the NCBI website design (Table 3). Fastking One Step Probe RT-qPCR (Probe) was used to perform RT-qPCR following the manufacturer’s instructions. RT-qPCR was performed in 20 μL reaction volumes containing 10 μL of 2× Fastking One Step Probe RT-qPCR MasterMix, 0.8 μL of 2× Fastking Enzyme Mix, 0.5 μL of upstream and downstream primers (10 μM), 0.4 μL of probe (10 μM), 1 μL of RNA template, and 6.8 μL of ddH2O. The following reaction profile was used: 50 °C for 30 min, 95 °C for 3 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 30 s; melting curve analysis was performed to validate specific amplification. The NADPH gene was used as an endogenous reference gene. RT-qPCR was performed in a 96-well plate on a BIO RAD CFX96 Real-Time System (Bio-Rad CFX Maestro, Singapore). The detection was performed in triplicate for each biological replicate. The relative expression values of selected genes were calculated using the 2−ΔΔCt method and normalized against the expression levels of the NADPH gene.

4. Conclusions

Through enrichment analysis, we found that pathways such as amphetamine addiction, circadian entrainment, MAPK signaling pathway, osteoclast differentiation, C-type lectin receptor signaling pathway, and TNF signaling pathway are closely related to VVTT infection in A293 cells, explaining some of the changes that occur during VVTT infection.
By combining transcriptome analysis and machine learning, we identified four key targets related to VVTT infection in A293 cells: ARC, JUNB, EGR3, and FOS.
Finally, through qPCR analysis, we validated the up-regulation of these four targets following VVTT infection, indicating their potential importance in the VVTT infection process. Taken together, our integrated approach using transcriptomics and machine learning has provided a deeper understanding of the potential mechanisms underlying VVTT infection in A293 cells and identified potential key regulatory targets. Research on these targets not only offers new insights into the molecular mechanisms of VVTT infection but also provides a scientific basis and direction for developing future vaccines and therapeutic strategies against VVTT. We have included plans for further validation of target genes through gene-targeted knockdown and overexpression techniques. Subsequently, we aim to compare genetic alterations at the cellular level post-infection of A293 cells with the VVTT-modified vaccine strain, known for its reduced toxicity and enhanced safety, alongside the VVT vaccine strain. Furthermore, we will conduct efficacy validation experiments on known targeted drugs for the genes obtained in the study. This study lays a solid foundation for subsequent in-depth research on VVTT infection and related diseases and offers potential targets and ideas for developing new antiviral drugs.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/ijms26031203/s1.

Author Contributions

Conceptualization: W.H., W.L., and G.L.; methodology: W.H., W.L., G.L., and Y.J.; software: Y.J.; validation: G.L., Z.C., and J.C.; formal analysis: Z.C. and Y.J.; investigation: Z.C. and J.C.; resources: W.H., W.L., and G.L.; data curation: Y.J.; writing—original draft preparation: Z.C. and Y.J.; writing—review and editing: W.H., W.L., G.L., and J.C.; visualization: Z.C.; supervision: W.H., W.L., and G.L.; project administration: W.L. and G.L.; funding acquisition: G.L. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data will be provided upon request.

Conflicts of Interest

The authors declare no conflicts of interest.

Abbreviations

The following abbreviations are used in this manuscript:
VVVaccinia virus
VVTTVaccinia virus Tiantan
GOGene Ontology
KEGGKyoto Encyclopedia of Genes and Genomes
RFRandom forest
LASSOCVLeast absolute shrinkage and selection operator
ENElastic net
XGBeXtreme Gradient Boosting
RFERecursive Feature Elimination
ACCAccuracy
AUROC Area under the receiver operating characteristic curve
MCCMatthews correlation coefficient
SenSensitivity
SpeSpecificity
AUCArea under the curve
DEGDifferentially expressed genes
PPIProtein–protein interaction

References

  1. Greseth, M.D.; Traktman, P. The Life Cycle of the Vaccinia Virus Genome. Annu. Rev. Virol. 2022, 9, 239–259. [Google Scholar] [CrossRef] [PubMed]
  2. Qin, L.; Favis, N.; Famulski, J.; Evans, D.H.; McFadden, G. Evolution of and Evolutionary Relationships between Extant Vaccinia Virus Strains. J. Virol. 2015, 89, 1809–1824. [Google Scholar] [PubMed]
  3. Sánchez-Sampedro, L.; Perdiguero, B.; Mejías-Pérez, E.; García-Arriaza, J.; Di Pilato, M.; Esteban, M. The evolution of poxvirus vaccines. Viruses 2015, 7, 1726–1803. [Google Scholar] [CrossRef] [PubMed]
  4. Moss, B. Vaccinia virus: A tool for research and vaccine development. Science 1991, 252, 1662–1667. [Google Scholar] [CrossRef] [PubMed]
  5. Noisumdaeng, P.; Pooruk, P.; Kongchanagul, A.; Assanasen, S.; Kitphati, R.; Auewarakul, P.; Puthavathana, P. Biological properties of H5 hemagglutinin expressed by vaccinia virus vector and its immunological reactivity with human sera. Viral Immunol. 2013, 26, 49–59. [Google Scholar] [CrossRef]
  6. Stritzker, J.; Huppertz, S.; Zhang, Q.; Geissinger, U.; Härtl, B.; Gentschev, I.; Szalay, A.A. Inducible gene expression in tumors colonized by modified oncolytic vaccinia virus strains. J. Virol. 2014, 88, 11556–11567. [Google Scholar] [PubMed]
  7. Remy-Ziller, C.; Germain, C.; Spindler, A.; Hoffmann, C.; Silvestre, N.; Rooke, R.; Bonnefoy, J.Y.; Préville, X. Immunological characterization of a modified vaccinia virus Ankara vector expressing the human papillomavirus 16 E1 protein. Clin. Vaccine Immunol. 2014, 21, 147–155. [Google Scholar] [CrossRef] [PubMed]
  8. Wyatt, L.S.; Xiao, W.; Americo, J.L.; Earl, P.L.; Moss, B. Novel Nonreplicating Vaccinia Virus Vector Enhances Expression of Heterologous Genes and Suppresses Synthesis of Endogenous Viral Proteins. mBio 2017, 8, e00790-17. [Google Scholar] [CrossRef]
  9. Volz, A.; Sutter, G. Modified Vaccinia Virus Ankara: History, Value in Basic Research, and Current Perspectives for Vaccine Development. Adv. Virus Res. 2017, 97, 187–243. [Google Scholar]
  10. Yu, C.; Wu, Q.; Xin, J.; Yu, Q.; Ma, Z.; Xue, M.; Xu, Q.; Zheng, C. Designing a Smallpox B-Cell and T-Cell Multi-Epitope Subunit Vaccine Using a Comprehensive Immunoinformatics Approach. Microbiol. Spectr. 2024, 12, e0046524. [Google Scholar]
  11. Zeng, J.; Li, Y.; Jiang, L.; Luo, L.; Wang, Y.; Wang, H.; Han, X.; Zhao, J.; Gu, G.; Fang, M.; et al. Mpox Multi-Antigen mRNA Vaccine Candidates by a Simplified Manufacturing Strategy Afford Efficient Protection Against Lethal Orthopoxvirus Challenge. Emerg. Microbes Infect. 2023, 12, 2204151. [Google Scholar]
  12. Freyn, A.W.; Atyeo, C.; Earl, P.L.; Americo, J.L.; Chuang, G.Y.; Natarajan, H.; Frey, T.R.; Gall, J.G.; Moliva, J.I.; Hunegnaw, R.; et al. An Mpox Virus mRNA-Lipid Nanoparticle Vaccine Confers Protection Against Lethal Orthopoxviral Challenge. Sci. Transl. Med. 2023, 15, eadg3540. [Google Scholar]
  13. Zhou, J.; Ye, T.; Yang, Y.; Li, E.; Zhang, K.; Wang, Y.; Chen, S.; Hu, J.; Zhang, K.; Liu, F.; et al. Circular RNA Vaccines Against Monkeypox Virus Provide Potent Protection Against Vaccinia Virus Infection in Mice. Mol. Ther. 2024, 32, 1779–1789. [Google Scholar] [CrossRef] [PubMed]
  14. Miura, F.; Kanzawa-Kiriyama, H.; Hisano, O.; Miura, M.; Shibata, Y.; Adachi, N.; Kakuda, T.; Shinoda, K.I.; Ito, T. A Highly Efficient Scheme for Library Preparation from Single-Stranded DNA. Sci. Rep. 2023, 13, 13913. [Google Scholar]
  15. Poland, G.A.; Kennedy, R.B.; Tosh, P.K. Prevention of Monkeypox with Vaccines: A Rapid Review. Lancet Infect. Dis. 2022, 22, e349–e358. [Google Scholar] [PubMed]
  16. Noy-Porat, T.; Tamir, H.; Alcalay, R.; Rosenfeld, R.; Epstein, E.; Cherry, L.; Achdout, H.; Erez, N.; Politi, B.; Yahalom-Ronen, Y.; et al. Generation of Recombinant mAbs to Vaccinia Virus Displaying High Affinity and Potent Neutralization. Microbiol. Spectr. 2023, 11, e0159823. [Google Scholar]
  17. Grant, R.; Nguyen, L.L.; Breban, R. Modelling Human-to-Human Transmission of Monkeypox. Bull. World Health Organ. 2020, 98, 638–640. [Google Scholar] [PubMed]
  18. Fine, P.E.; Jezek, Z.; Grab, B.; Dixon, H. The Transmission Potential of Monkeypox Virus in Human Populations. Int. J. Epidemiol. 1988, 17, 643–650. [Google Scholar] [PubMed]
  19. Rizk, J.G.; Lippi, G.; Henry, B.M.; Forthal, D.N.; Rizk, Y. Prevention and Treatment of Monkeypox. Drugs 2022, 82, 957–963. [Google Scholar] [CrossRef] [PubMed]
  20. Heymann, D.L.; Szczeniowski, M.; Esteves, K. Re-Emergence of Monkeypox in Africa: A Review of the Past Six Years. Br. Med. Bull. 1998, 54, 693–702. [Google Scholar]
  21. Hammarlund, E.; Lewis, M.W.; Carter, S.V.; Amanna, I.; Hansen, S.G.; I Strelow, L.; Wong, S.W.; Yoshihara, P.; Hanifin, J.M.; Slifka, M.K. Multiple Diagnostic Techniques Identify Previously Vaccinated Individuals with Protective Immunity Against Monkeypox. Nat. Med. 2005, 11, 1005–1011. [Google Scholar] [CrossRef] [PubMed]
  22. Casey, C.G.; Iskander, J.K.; Roper, M.H.; Mast, E.E.; Wen, X.-J.; Török, T.J.; Chapman, L.E.; Swerdlow, D.L.; Morgan, J.; Heffelfinger, J.D.; et al. Adverse Events Associated with Smallpox Vaccination in the United States, January–October 2003. JAMA 2005, 294, 2734–2743. [Google Scholar] [CrossRef] [PubMed]
  23. Frey, S.E.; Newman, F.K.; Kennedy, J.S.; Ennis, F.; Abate, G.; Hoft, D.F.; Monath, T.P. Comparison of the Safety and Immunogenicity of ACAM1000, ACAM2000 and Dryvax in Healthy Vaccinia-Naive Adults. Vaccine 2009, 27, 1637–1644. [Google Scholar] [CrossRef]
  24. Pittman, P.R.; Hahn, M.; Lee, H.S.; Koca, C.; Samy, N.; Schmidt, D.; Hornung, J.; Weidenthaler, H.; Heery, C.R.; Meyer, T.P.; et al. Phase 3 Efficacy Trial of Modified Vaccinia Ankara as a Vaccine Against Smallpox. N. Engl. J. Med. 2019, 381, 1897–1908. [Google Scholar] [CrossRef] [PubMed]
  25. Bipartisan Commission on Biodefense. Box the Pox: Reducing the Risk of Smallpox and Other Orthopoxviruses; Bipartisan Commission on Biodefense: Washington, DC, USA, 2024. [Google Scholar]
  26. Albarnaz, J.D.; Kite, J.; Oliveira, M.; Li, H.; Di, Y.; Christensen, M.H.; Paulo, J.A.; Antrobus, R.; Gygi, S.P.; Schmidt, F.I.; et al. Quantitative proteomics defines mechanisms of antiviral defence and cell death during modified vaccinia Ankara infection. Nat. Commun. 2023, 14, 8134. [Google Scholar] [CrossRef]
  27. Venu, V.; Roth, C.; Adikari, S.H.; Small, E.M.; Starkenburg, S.R.; Sanbonmatsu, K.Y.; Steadman, C.R. Multi-omics analysis reveals the dynamic interplay between Vero host chromatin structure and function during vaccinia virus infection. Commun. Biol. 2024, 7, 721. [Google Scholar] [CrossRef] [PubMed]
  28. Maroti, Z.; Tombacz, D.; Prazsak, I.; Moldovan, N.; Csabai, Z.; Torma, G.; Balazs, Z.; Kalmar, T.; Denes, B.; Snyder, M.; et al. Time-course transcriptome analysis of host cell response to poxvirus infection using a dual long-read sequencing approach. BMC Res. Notes 2021, 14, 239. [Google Scholar] [CrossRef] [PubMed]
  29. Tombácz, D.; Prazsák, I.; Szűcs, A.; Dénes, B.; Snyder, M.; Boldogkői, Z. Dynamic transcriptome profiling dataset of vaccinia virus obtained from long-read sequencing techniques. GigaScience 2018, 7, giy139. [Google Scholar] [CrossRef] [PubMed]
  30. He, W.; Fu, X.; Chen, S. Advancing polytrauma care: Developing and validating machine learning models for early mortality prediction. J. Transl. Med. 2023, 21, 664. [Google Scholar] [CrossRef]
  31. Song, L.; Zhang, B.; Li, R.; Duan, Y.; Chi, Y.; Xu, Y.; Hua, X.; Xu, Q. Significance of neutrophil extracellular traps-related gene in the diagnosis and classification of atherosclerosis. Apoptosis 2024, 29, 605–619. [Google Scholar] [CrossRef] [PubMed]
  32. Zhang, N.; Zhang, H.; Liu, Z.; Dai, Z.; Wu, W.; Zhou, R.; Li, S.; Wang, Z.; Liang, X.; Wen, J.; et al. An artificial intelligence network-guided signature for predicting outcome and immunotherapy response in lung adenocarcinoma patients based on 26 machine learning algorithms. Cell Prolif. 2023, 56, e13409. [Google Scholar] [CrossRef]
  33. Atreya, M.R.; Banerjee, S.; Lautz, A.J.; Alder, M.N.; Varisco, B.M.; Wong, H.R.; Muszynski, J.A.; Hall, M.W.; Sanchez-Pinto, L.N.; Kamaleswaran, R.; et al. Machine learning-driven identification of the gene-expression signature associated with a persistent multiple organ dysfunction trajectory in critical illness. eBioMedicine 2024, 99, 104938. [Google Scholar] [CrossRef] [PubMed]
  34. Rychkov, D.; Neely, J.; Oskotsky, T.; Yu, S.; Perlmutter, N.; Nititham, J.; Carvidi, A.; Krueger, M.; Gross, A.; Criswell, L.A.; et al. Cross-Tissue Transcriptomic Analysis Leveraging Machine Learning Approaches Identifies New Biomarkers for Rheumatoid Arthritis. Front. Immunol. 2021, 12, 638066. [Google Scholar] [CrossRef] [PubMed]
  35. Qin, L.; Liang, M.; Evans, D.H. Genomic analysis of vaccinia virus strain TianTan provides new insights into the evolution and evolutionary relationships between Orthopoxviruses. Virology 2013, 442, 59–66. [Google Scholar] [CrossRef] [PubMed]
  36. Li, E.; Guo, X.; Hong, D.; Gong, Q.; Xie, W.; Li, T.; Wang, J.; Chuai, X.; Chiu, S. Duration of humoral immunity from smallpox vaccination and its cross-reaction with Mpox virus. Signal Transduct. Target. Ther. 2023, 8, 350. [Google Scholar] [CrossRef] [PubMed]
  37. Li, M.; Guo, Y.; Deng, Y.; Gao, W.; Huang, B.; Yao, W.; Zhao, Y.; Zhang, Q.; Huang, M.; Liu, M.; et al. Long-lasting humoral and cellular memory immunity to vaccinia virus Tiantan provides pre-existing immunity against mpox virus in Chinese population. Cell Rep. 2024, 43, 113609. [Google Scholar] [CrossRef] [PubMed]
  38. Xia, A.; Wang, X.; He, J.; Wu, W.; Jiang, W.; Xue, S.; Zhang, Q.; Gao, Y.; Han, Y.; Li, Y.; et al. Cross-reactive antibody response to Monkeypox virus surface proteins in a small proportion of individuals with and without Chinese smallpox vaccination history. BMC Biol. 2023, 21, 205. [Google Scholar] [CrossRef] [PubMed]
  39. Huang, Q.; Wang, Y.; Zhao, T.; Wang, Y.; Wang, X.; Li, S.; Su, W.; Ren, X.; Zhang, X.; Liu, J.; et al. Examination of the cross-reactivity between vaccinia virus Tiantan strain and monkeypox virus. J. Virol. Methods 2023, 320, 114772. [Google Scholar] [CrossRef]
  40. Huang, Y.; Guo, L.; Li, Y.; Ren, L.; Nie, J.; Xu, F.; Huang, T.; Zhong, J.; Fan, Z.; Zhang, Y.; et al. Residual Immunity from Smallpox Vaccination and Possible Protection from Mpox, China. Emerg. Infect. Dis. 2024, 30, 321–324. [Google Scholar] [CrossRef]
  41. Hashemi, M.; Zabihian, A.; Hajsaeedi, M.; Hooshmand, M. Antivirals for monkeypox virus: Proposing an effective machine/deep learning framework. PLoS ONE 2024, 19, e0299342. [Google Scholar] [CrossRef] [PubMed]
  42. Izadi, M.; Mirzaei, F.; Bagherzadeh, M.A.; Ghiabi, S.; Khalifeh, A. Discovering conserved epitopes of Monkeypox: Novel immunoinformatic and machine learning approaches. Heliyon 2024, 10, e24972. [Google Scholar] [CrossRef] [PubMed]
  43. Kim, M. Replicating poxviruses for human cancer therapy. J. Microbiol. 2015, 53, 209–218. [Google Scholar] [PubMed]
  44. Bourquain, D.; Dabrowski, P.W.; Nitsche, A. Comparison of host cell gene expression in cowpox, monkeypox or vaccinia virus-infected cells reveals virus-specific regulation of immune response genes. Virol. J. 2013, 10, 61. [Google Scholar]
  45. Li, Y.; Sheng, Y.; Chu, Y.; Ji, H.; Jiang, S.; Lan, T.; Li, M.; Chen, S.; Fan, Y.; Li, W.; et al. Seven major genomic deletions of vaccinia virus Tiantan strain are sufficient to decrease pathogenicity. Antivir. Res. 2016, 129, 1–12. [Google Scholar] [CrossRef] [PubMed]
  46. Dong, H.L.; Chen, Z.L.; He, M.J.; Cui, J.Z.; Cheng, H.; Wang, Q.Y.; Xiong, X.H.; Liu, G.; Chen, H.P. The Chimeric Chaoyang-Zika Vaccine Candidate Is Safe and Protective in Mice. Vaccines 2024, 12, 215. [Google Scholar] [CrossRef]
  47. Li, Y.; Zhu, Y.; Chen, S.; Li, W.; Yin, X.; Li, S.; Xiao, P.; Han, J.; Li, X.; Sun, L.; et al. Generation of an Attenuated Tiantan Vaccinia Virus Strain by Deletion of Multiple Genes. Front. Cell Infect. Microbiol. 2017, 7, 462. [Google Scholar]
  48. Liu, C.; Liu, Y.; Liang, L.; Cui, S.; Zhang, Y. RNA-Seq based transcriptome analysis during bovine viral diarrhoea virus (BVDV) infection. BMC Genom. 2019, 20, 774. [Google Scholar]
  49. Szklarczyk, D.; Kirsch, R.; Koutrouli, M.; Nastou, K.; Mehryary, F.; Hachilif, R.; Gable, A.L.; Fang, T.; Doncheva, N.T.; Pyysalo, S.; et al. The STRING database in 2023: Protein—Protein association networks and functional enrichment analyses for any sequenced genome of interest. Nucleic Acids Res. 2023, 51, D638–D646. [Google Scholar] [PubMed]
  50. Shannon, P.; Markiel, A.; Ozier, O.; Baliga, N.S.; Wang, J.T.; Ramage, D.; Amin, N.; Schwikowski, B.; Ideker, T. Cytoscape: A software environment for integrated models of biomolecular interaction networks. Genome Res. 2003, 13, 2498–2504. [Google Scholar] [PubMed]
  51. Ashburner, M.; Ball, C.A.; Blake, J.A.; Botstein, D.; Butler, H.; Cherry, J.M.; Davis, A.P.; Dolinski, K.; Dwight, S.S.; Eppig, J.T.; et al. Gene Ontology: Tool for the unification of biology. Nat. Genet. 2000, 25, 25–29. [Google Scholar]
  52. Consortium, T.G.O.; Aleksander, S.A.; Balhoff, J.; Carbon, S.; Cherry, J.M.; Drabkin, H.J.; Ebert, D.; Feuermann, M.; Gaudet, P.; Harris, N.L.; et al. The Gene Ontology knowledgebase in 2023. Genetics 2023, 224, iyad031. [Google Scholar] [CrossRef] [PubMed]
  53. Kanehisa, M.; Furumichi, M.; Sato, Y.; Kawashima, M.; Ishiguro-Watanabe, M. KEGG for taxonomy-based analysis of pathways and genomes. Nucleic Acids Res. 2023, 51, D587–D592. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Volcano plots of differentially expressed genes. Results of differential gene analysis for mock vs. VVTT−6 h (A), mock vs. VVTT−12 h (B), and mock vs. VVTT−24 h (C) groups. Red indicates up-regulated genes; blue indicates downregulated genes.
Figure 1. Volcano plots of differentially expressed genes. Results of differential gene analysis for mock vs. VVTT−6 h (A), mock vs. VVTT−12 h (B), and mock vs. VVTT−24 h (C) groups. Red indicates up-regulated genes; blue indicates downregulated genes.
Ijms 26 01203 g001
Figure 2. PPI networks for (A) mock vs. VVTT−6 h, (B) mock vs. VVTT−12 h, and (C) mock vs. VVTT−24 h groups. Darker colors indicate higher degree. Each node represents a corresponding protein and each edge represents the interaction between two proteins.
Figure 2. PPI networks for (A) mock vs. VVTT−6 h, (B) mock vs. VVTT−12 h, and (C) mock vs. VVTT−24 h groups. Darker colors indicate higher degree. Each node represents a corresponding protein and each edge represents the interaction between two proteins.
Ijms 26 01203 g002
Figure 3. AUC, ACC, Mcc, Sen, and Spe of each algorithm in each fold of the five-fold cross-validation repeated twice.
Figure 3. AUC, ACC, Mcc, Sen, and Spe of each algorithm in each fold of the five-fold cross-validation repeated twice.
Ijms 26 01203 g003
Figure 4. AUROC curves of the algorithms when applying RFE. The blue curve represents the ROC curve of a single cross-validation, while the orange curve indicates the average ROC curve. The gray area denotes the fluctuation range of the True Positive Rate.
Figure 4. AUROC curves of the algorithms when applying RFE. The blue curve represents the ROC curve of a single cross-validation, while the orange curve indicates the average ROC curve. The gray area denotes the fluctuation range of the True Positive Rate.
Ijms 26 01203 g004
Figure 5. Box plots of ACC for the algorithms using different scaling methods and sampling techniques.
Figure 5. Box plots of ACC for the algorithms using different scaling methods and sampling techniques.
Ijms 26 01203 g005
Figure 6. Box plots of ACC for the algorithms using different scaling methods and feature numbers.
Figure 6. Box plots of ACC for the algorithms using different scaling methods and feature numbers.
Ijms 26 01203 g006
Figure 7. Confusion matrices of the best models obtained with different combinations of feature numbers, scaling methods, and sampling techniques.
Figure 7. Confusion matrices of the best models obtained with different combinations of feature numbers, scaling methods, and sampling techniques.
Ijms 26 01203 g007
Figure 8. Matrices of the best models obtained with different combinations of feature numbers, scaling methods, and sampling techniques. Expression levels of genes JUNB, ARC, EGR3, DUSP5, CTGF, ZFP36, GPR3, NR4A1, TNFRSF12A, ETV5, TAF11L11, and ETV4 were validated by RT-qPCR. The NADPH gene was used as an internal control, and the relative quantity of gene expression (fold change) of each gene was calculated using the comparative 2−ΔΔCt method. RT-qPCR values are shown as the mean ± SD.
Figure 8. Matrices of the best models obtained with different combinations of feature numbers, scaling methods, and sampling techniques. Expression levels of genes JUNB, ARC, EGR3, DUSP5, CTGF, ZFP36, GPR3, NR4A1, TNFRSF12A, ETV5, TAF11L11, and ETV4 were validated by RT-qPCR. The NADPH gene was used as an internal control, and the relative quantity of gene expression (fold change) of each gene was calculated using the comparative 2−ΔΔCt method. RT-qPCR values are shown as the mean ± SD.
Ijms 26 01203 g008
Table 1. Top 20 genes ranked by degree in the PPI network.
Table 1. Top 20 genes ranked by degree in the PPI network.
RANKVVTT_6 h vs. A293_6 hVVTT_12 h vs. A293_12 hVVTT_24 h vs. A293_24 h
1FOSFOSFOS
2EGR2EGR1EGR1
3EGR1FOSBATF3
4DUSP1NR4A1FOSB
5FOSBJUNBNR4A1
6ZFP36IER2JUNB
7JUNBEGR2EGR2
8IER2ZFP36DUSP1
9EGR3DUSP1ZFP36
10H3C13EGR3IL6
11H3C12DUSP2IER2
12PTGS2GADD45BEGR3
13IER3FOSL1FOSL2
14H4C6ARCFOSL1
15H2AC8H3C13GADD45B
16ARCH3C12PTGS2
17SOCS3CCN1DUSP2
18DUSP6H4C6CSRNP1
19CCN2H2AC8DUSP5
20BHLHE40H2AC20CCN1
Table 2. Top 20 pathways ranked in the KEGG analysis.
Table 2. Top 20 pathways ranked in the KEGG analysis.
RankA6 h_VS._M6 hA12 h_VS._M12 hA24 h_VS._M24 h
1HIF-1 signalingCarbon metabolismHippo signaling
2Cell cycleCellular senescenceCocaine addiction
3Longevity regulatingBiosynthesis of amino acidsp53 signaling
4Autophagy-animalHIF-1 signaling pathwayInsulin resistance
5Human papillomavirus infectionHuntington diseaseArginine and proline metabolism
6EfferocytosisProtein processing in endoplasmic reticulumMAPK signaling pathway
7p53 signaling pathwayCell cycleAutophagy-animal
8ProteasomeEndocytosisAmphetamine addiction
9Protein processing in endoplasmic reticulumFoxO signaling pathwayProtein processing in endoplasmic reticulum
10Proteoglycans in cancerAutophagy-animalHepatocellular carcinoma
11FoxO signaling pathwayBladder cancerAMPK signaling pathway
12TNF signaling pathwayAMPK signaling pathwayInsulin signaling pathway
13Chronic myeloid leukemiaHuman T-cell leukemia virus 1 infectionBreast cancer
14Spinocerebellar ataxiaCentral carbon metabolism in cancerCell cycle
15mTOR signaling pathwaymTOR signaling pathwaySpinocerebellar ataxia
16Thyroid hormone signaling pathwaySpinocerebellar ataxiaSynaptic vesicle cycle
17Insulin resistanceNon-small cell lung cancerNotch signaling pathway
18Biosynthesis of amino acidsHepatocellular carcinomaLysosome
19DNA replicationHepatitis BLongevity regulating pathway
20Hepatocellular carcinomap53 signaling pathwayBladder cancer
Table 3. Primer name and sequence
Table 3. Primer name and sequence
Gene NamePrime Sequence (5′-3′)Gene NamePrime Sequence (5′-3′)Gene NamePrime Sequence (5′-3′)
GAPDH-FTCAAGCTCATTTCCTGGTATGACAGAPDH-RGGGTCTTACTCCTTGGAGGCGAPDH-PTGGTGGACCTCATGGCCCACA
JUNB-FCGACCACCATCAGCTACCTCJUNB-RGTCTGCGGTTCCTCCTTGAAJUNB-PCTTCGCCGGTGGCCACCC
ARC-FGGCCCCTCAGCTCCAGTARC-RGACAGCTGATGGTGGGGTCARC-PGGCAGCAGCTGGCACCATCA
EGR3-FCGCGGTGGGAGAGAGAATGEGR3-RGTTGGAAGGGGAGTCGAAGGEGR3-PCCCCCGGCAACAAGACCGTG
DUSP5-FAGCTTATGACCAGGGTGGCDUSP5-RGTCGGGAGACATTCAGCAGGDUSP5-PCGAGTTCCTCGCCAACCTGCA
CTGF-FGGAGTGGGTGTGTGACGAGCTGF-RCTTCCAGTCGGTAAGCCGCCTGF-PAAACCGTGGTTGGGCCTGCC
ZFP36-FTGACTGCCATCTACGAGAGCCZFP36-RGTCCCTCCATGGTCGGATGGZFP36-PGTCGCTGAGCCCTGACGTGC
GPR3-FGTGACTCACGCCGCTTCTGPR3-RCCACATCATGGTACCGCTCAGPR3-PGCTTCTCGGGGTCCACGCAC
NR4A1-FGACCCCGGAAAGCGGGNR4A1-RTGGATACAGGGCATCTCACTCTGNR4A1-PGGCAGCCTGGCTCCTTCTGC
TNFRSF12A-FAGAGAGAAGTTCACCACCCCTNFRSF12A-RGCACATTGTCACTGGATCAGCTNFRSF12A-PGAGGAGACCGGCGGAGAGGG
ETV5-FAACCGGAAGAGGTTGCTCGETV5-RGGCATCTGGGTCACAGACAAETV5-PGCGCTGGGGCATCCAGAAGA
TAF11L11-FTGGCACAGCAGAAACACAGAATAF11L11-RTGAGATTCCAGTCTGCTCCGTAF11L11-PTCGAACCACCCCAGCCAGAACT
ETV4-FCGCCTACGACTCAGATGTCAETV4-RGGTTTCTCATAGCCATAGCCCAETV4-PCTCTCCAGGTGACGGGGCCA
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Chen, Z.; Jiang, Y.; Cui, J.; Li, W.; Han, W.; Liu, G. Elucidating the Mechanism of VVTT Infection Through Machine Learning and Transcriptome Analysis. Int. J. Mol. Sci. 2025, 26, 1203. https://doi.org/10.3390/ijms26031203

AMA Style

Chen Z, Jiang Y, Cui J, Li W, Han W, Liu G. Elucidating the Mechanism of VVTT Infection Through Machine Learning and Transcriptome Analysis. International Journal of Molecular Sciences. 2025; 26(3):1203. https://doi.org/10.3390/ijms26031203

Chicago/Turabian Style

Chen, Zhili, Yongxin Jiang, Jiazhen Cui, Wannan Li, Weiwei Han, and Gang Liu. 2025. "Elucidating the Mechanism of VVTT Infection Through Machine Learning and Transcriptome Analysis" International Journal of Molecular Sciences 26, no. 3: 1203. https://doi.org/10.3390/ijms26031203

APA Style

Chen, Z., Jiang, Y., Cui, J., Li, W., Han, W., & Liu, G. (2025). Elucidating the Mechanism of VVTT Infection Through Machine Learning and Transcriptome Analysis. International Journal of Molecular Sciences, 26(3), 1203. https://doi.org/10.3390/ijms26031203

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop