Elucidating the Mechanism of VVTT Infection Through Machine Learning and Transcriptome Analysis
Abstract
1. Introduction
2. Results and Discussion
2.1. Differential Gene Analysis
2.2. Protein–Protein Interaction Network
2.3. Enrichment Analysis
2.4. Initial Gene Screening Based on Machine Learning
2.5. Further Screening of Genes
2.6. Quantitative Real-Time PCR (RT-qPCR) Analysis
2.7. Discussion
3. Materials and Methods
3.1. Datasets
3.2. Virus and Cells
3.3. Sample Collection and RNA Extraction
3.4. Transcriptome Analysis
3.5. Preliminary Screening
3.6. Further Screening
3.7. Validation of Transcriptome Sequencing Results
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
VV | Vaccinia virus |
VVTT | Vaccinia virus Tiantan |
GO | Gene Ontology |
KEGG | Kyoto Encyclopedia of Genes and Genomes |
RF | Random forest |
LASSOCV | Least absolute shrinkage and selection operator |
EN | Elastic net |
XGB | eXtreme Gradient Boosting |
RFE | Recursive Feature Elimination |
ACC | Accuracy |
AUROC | Area under the receiver operating characteristic curve |
MCC | Matthews correlation coefficient |
Sen | Sensitivity |
Spe | Specificity |
AUC | Area under the curve |
DEG | Differentially expressed genes |
PPI | Protein–protein interaction |
References
- Greseth, M.D.; Traktman, P. The Life Cycle of the Vaccinia Virus Genome. Annu. Rev. Virol. 2022, 9, 239–259. [Google Scholar] [CrossRef] [PubMed]
- Qin, L.; Favis, N.; Famulski, J.; Evans, D.H.; McFadden, G. Evolution of and Evolutionary Relationships between Extant Vaccinia Virus Strains. J. Virol. 2015, 89, 1809–1824. [Google Scholar] [PubMed]
- Sánchez-Sampedro, L.; Perdiguero, B.; Mejías-Pérez, E.; García-Arriaza, J.; Di Pilato, M.; Esteban, M. The evolution of poxvirus vaccines. Viruses 2015, 7, 1726–1803. [Google Scholar] [CrossRef] [PubMed]
- Moss, B. Vaccinia virus: A tool for research and vaccine development. Science 1991, 252, 1662–1667. [Google Scholar] [CrossRef] [PubMed]
- Noisumdaeng, P.; Pooruk, P.; Kongchanagul, A.; Assanasen, S.; Kitphati, R.; Auewarakul, P.; Puthavathana, P. Biological properties of H5 hemagglutinin expressed by vaccinia virus vector and its immunological reactivity with human sera. Viral Immunol. 2013, 26, 49–59. [Google Scholar] [CrossRef]
- Stritzker, J.; Huppertz, S.; Zhang, Q.; Geissinger, U.; Härtl, B.; Gentschev, I.; Szalay, A.A. Inducible gene expression in tumors colonized by modified oncolytic vaccinia virus strains. J. Virol. 2014, 88, 11556–11567. [Google Scholar] [PubMed]
- Remy-Ziller, C.; Germain, C.; Spindler, A.; Hoffmann, C.; Silvestre, N.; Rooke, R.; Bonnefoy, J.Y.; Préville, X. Immunological characterization of a modified vaccinia virus Ankara vector expressing the human papillomavirus 16 E1 protein. Clin. Vaccine Immunol. 2014, 21, 147–155. [Google Scholar] [CrossRef] [PubMed]
- Wyatt, L.S.; Xiao, W.; Americo, J.L.; Earl, P.L.; Moss, B. Novel Nonreplicating Vaccinia Virus Vector Enhances Expression of Heterologous Genes and Suppresses Synthesis of Endogenous Viral Proteins. mBio 2017, 8, e00790-17. [Google Scholar] [CrossRef]
- Volz, A.; Sutter, G. Modified Vaccinia Virus Ankara: History, Value in Basic Research, and Current Perspectives for Vaccine Development. Adv. Virus Res. 2017, 97, 187–243. [Google Scholar]
- Yu, C.; Wu, Q.; Xin, J.; Yu, Q.; Ma, Z.; Xue, M.; Xu, Q.; Zheng, C. Designing a Smallpox B-Cell and T-Cell Multi-Epitope Subunit Vaccine Using a Comprehensive Immunoinformatics Approach. Microbiol. Spectr. 2024, 12, e0046524. [Google Scholar]
- Zeng, J.; Li, Y.; Jiang, L.; Luo, L.; Wang, Y.; Wang, H.; Han, X.; Zhao, J.; Gu, G.; Fang, M.; et al. Mpox Multi-Antigen mRNA Vaccine Candidates by a Simplified Manufacturing Strategy Afford Efficient Protection Against Lethal Orthopoxvirus Challenge. Emerg. Microbes Infect. 2023, 12, 2204151. [Google Scholar]
- Freyn, A.W.; Atyeo, C.; Earl, P.L.; Americo, J.L.; Chuang, G.Y.; Natarajan, H.; Frey, T.R.; Gall, J.G.; Moliva, J.I.; Hunegnaw, R.; et al. An Mpox Virus mRNA-Lipid Nanoparticle Vaccine Confers Protection Against Lethal Orthopoxviral Challenge. Sci. Transl. Med. 2023, 15, eadg3540. [Google Scholar]
- Zhou, J.; Ye, T.; Yang, Y.; Li, E.; Zhang, K.; Wang, Y.; Chen, S.; Hu, J.; Zhang, K.; Liu, F.; et al. Circular RNA Vaccines Against Monkeypox Virus Provide Potent Protection Against Vaccinia Virus Infection in Mice. Mol. Ther. 2024, 32, 1779–1789. [Google Scholar] [CrossRef] [PubMed]
- Miura, F.; Kanzawa-Kiriyama, H.; Hisano, O.; Miura, M.; Shibata, Y.; Adachi, N.; Kakuda, T.; Shinoda, K.I.; Ito, T. A Highly Efficient Scheme for Library Preparation from Single-Stranded DNA. Sci. Rep. 2023, 13, 13913. [Google Scholar]
- Poland, G.A.; Kennedy, R.B.; Tosh, P.K. Prevention of Monkeypox with Vaccines: A Rapid Review. Lancet Infect. Dis. 2022, 22, e349–e358. [Google Scholar] [PubMed]
- Noy-Porat, T.; Tamir, H.; Alcalay, R.; Rosenfeld, R.; Epstein, E.; Cherry, L.; Achdout, H.; Erez, N.; Politi, B.; Yahalom-Ronen, Y.; et al. Generation of Recombinant mAbs to Vaccinia Virus Displaying High Affinity and Potent Neutralization. Microbiol. Spectr. 2023, 11, e0159823. [Google Scholar]
- Grant, R.; Nguyen, L.L.; Breban, R. Modelling Human-to-Human Transmission of Monkeypox. Bull. World Health Organ. 2020, 98, 638–640. [Google Scholar] [PubMed]
- Fine, P.E.; Jezek, Z.; Grab, B.; Dixon, H. The Transmission Potential of Monkeypox Virus in Human Populations. Int. J. Epidemiol. 1988, 17, 643–650. [Google Scholar] [PubMed]
- Rizk, J.G.; Lippi, G.; Henry, B.M.; Forthal, D.N.; Rizk, Y. Prevention and Treatment of Monkeypox. Drugs 2022, 82, 957–963. [Google Scholar] [CrossRef] [PubMed]
- Heymann, D.L.; Szczeniowski, M.; Esteves, K. Re-Emergence of Monkeypox in Africa: A Review of the Past Six Years. Br. Med. Bull. 1998, 54, 693–702. [Google Scholar]
- Hammarlund, E.; Lewis, M.W.; Carter, S.V.; Amanna, I.; Hansen, S.G.; I Strelow, L.; Wong, S.W.; Yoshihara, P.; Hanifin, J.M.; Slifka, M.K. Multiple Diagnostic Techniques Identify Previously Vaccinated Individuals with Protective Immunity Against Monkeypox. Nat. Med. 2005, 11, 1005–1011. [Google Scholar] [CrossRef] [PubMed]
- Casey, C.G.; Iskander, J.K.; Roper, M.H.; Mast, E.E.; Wen, X.-J.; Török, T.J.; Chapman, L.E.; Swerdlow, D.L.; Morgan, J.; Heffelfinger, J.D.; et al. Adverse Events Associated with Smallpox Vaccination in the United States, January–October 2003. JAMA 2005, 294, 2734–2743. [Google Scholar] [CrossRef] [PubMed]
- Frey, S.E.; Newman, F.K.; Kennedy, J.S.; Ennis, F.; Abate, G.; Hoft, D.F.; Monath, T.P. Comparison of the Safety and Immunogenicity of ACAM1000, ACAM2000 and Dryvax in Healthy Vaccinia-Naive Adults. Vaccine 2009, 27, 1637–1644. [Google Scholar] [CrossRef]
- Pittman, P.R.; Hahn, M.; Lee, H.S.; Koca, C.; Samy, N.; Schmidt, D.; Hornung, J.; Weidenthaler, H.; Heery, C.R.; Meyer, T.P.; et al. Phase 3 Efficacy Trial of Modified Vaccinia Ankara as a Vaccine Against Smallpox. N. Engl. J. Med. 2019, 381, 1897–1908. [Google Scholar] [CrossRef] [PubMed]
- Bipartisan Commission on Biodefense. Box the Pox: Reducing the Risk of Smallpox and Other Orthopoxviruses; Bipartisan Commission on Biodefense: Washington, DC, USA, 2024. [Google Scholar]
- Albarnaz, J.D.; Kite, J.; Oliveira, M.; Li, H.; Di, Y.; Christensen, M.H.; Paulo, J.A.; Antrobus, R.; Gygi, S.P.; Schmidt, F.I.; et al. Quantitative proteomics defines mechanisms of antiviral defence and cell death during modified vaccinia Ankara infection. Nat. Commun. 2023, 14, 8134. [Google Scholar] [CrossRef]
- Venu, V.; Roth, C.; Adikari, S.H.; Small, E.M.; Starkenburg, S.R.; Sanbonmatsu, K.Y.; Steadman, C.R. Multi-omics analysis reveals the dynamic interplay between Vero host chromatin structure and function during vaccinia virus infection. Commun. Biol. 2024, 7, 721. [Google Scholar] [CrossRef] [PubMed]
- Maroti, Z.; Tombacz, D.; Prazsak, I.; Moldovan, N.; Csabai, Z.; Torma, G.; Balazs, Z.; Kalmar, T.; Denes, B.; Snyder, M.; et al. Time-course transcriptome analysis of host cell response to poxvirus infection using a dual long-read sequencing approach. BMC Res. Notes 2021, 14, 239. [Google Scholar] [CrossRef] [PubMed]
- Tombácz, D.; Prazsák, I.; Szűcs, A.; Dénes, B.; Snyder, M.; Boldogkői, Z. Dynamic transcriptome profiling dataset of vaccinia virus obtained from long-read sequencing techniques. GigaScience 2018, 7, giy139. [Google Scholar] [CrossRef] [PubMed]
- He, W.; Fu, X.; Chen, S. Advancing polytrauma care: Developing and validating machine learning models for early mortality prediction. J. Transl. Med. 2023, 21, 664. [Google Scholar] [CrossRef]
- Song, L.; Zhang, B.; Li, R.; Duan, Y.; Chi, Y.; Xu, Y.; Hua, X.; Xu, Q. Significance of neutrophil extracellular traps-related gene in the diagnosis and classification of atherosclerosis. Apoptosis 2024, 29, 605–619. [Google Scholar] [CrossRef] [PubMed]
- Zhang, N.; Zhang, H.; Liu, Z.; Dai, Z.; Wu, W.; Zhou, R.; Li, S.; Wang, Z.; Liang, X.; Wen, J.; et al. An artificial intelligence network-guided signature for predicting outcome and immunotherapy response in lung adenocarcinoma patients based on 26 machine learning algorithms. Cell Prolif. 2023, 56, e13409. [Google Scholar] [CrossRef]
- Atreya, M.R.; Banerjee, S.; Lautz, A.J.; Alder, M.N.; Varisco, B.M.; Wong, H.R.; Muszynski, J.A.; Hall, M.W.; Sanchez-Pinto, L.N.; Kamaleswaran, R.; et al. Machine learning-driven identification of the gene-expression signature associated with a persistent multiple organ dysfunction trajectory in critical illness. eBioMedicine 2024, 99, 104938. [Google Scholar] [CrossRef] [PubMed]
- Rychkov, D.; Neely, J.; Oskotsky, T.; Yu, S.; Perlmutter, N.; Nititham, J.; Carvidi, A.; Krueger, M.; Gross, A.; Criswell, L.A.; et al. Cross-Tissue Transcriptomic Analysis Leveraging Machine Learning Approaches Identifies New Biomarkers for Rheumatoid Arthritis. Front. Immunol. 2021, 12, 638066. [Google Scholar] [CrossRef] [PubMed]
- Qin, L.; Liang, M.; Evans, D.H. Genomic analysis of vaccinia virus strain TianTan provides new insights into the evolution and evolutionary relationships between Orthopoxviruses. Virology 2013, 442, 59–66. [Google Scholar] [CrossRef] [PubMed]
- Li, E.; Guo, X.; Hong, D.; Gong, Q.; Xie, W.; Li, T.; Wang, J.; Chuai, X.; Chiu, S. Duration of humoral immunity from smallpox vaccination and its cross-reaction with Mpox virus. Signal Transduct. Target. Ther. 2023, 8, 350. [Google Scholar] [CrossRef] [PubMed]
- Li, M.; Guo, Y.; Deng, Y.; Gao, W.; Huang, B.; Yao, W.; Zhao, Y.; Zhang, Q.; Huang, M.; Liu, M.; et al. Long-lasting humoral and cellular memory immunity to vaccinia virus Tiantan provides pre-existing immunity against mpox virus in Chinese population. Cell Rep. 2024, 43, 113609. [Google Scholar] [CrossRef] [PubMed]
- Xia, A.; Wang, X.; He, J.; Wu, W.; Jiang, W.; Xue, S.; Zhang, Q.; Gao, Y.; Han, Y.; Li, Y.; et al. Cross-reactive antibody response to Monkeypox virus surface proteins in a small proportion of individuals with and without Chinese smallpox vaccination history. BMC Biol. 2023, 21, 205. [Google Scholar] [CrossRef] [PubMed]
- Huang, Q.; Wang, Y.; Zhao, T.; Wang, Y.; Wang, X.; Li, S.; Su, W.; Ren, X.; Zhang, X.; Liu, J.; et al. Examination of the cross-reactivity between vaccinia virus Tiantan strain and monkeypox virus. J. Virol. Methods 2023, 320, 114772. [Google Scholar] [CrossRef]
- Huang, Y.; Guo, L.; Li, Y.; Ren, L.; Nie, J.; Xu, F.; Huang, T.; Zhong, J.; Fan, Z.; Zhang, Y.; et al. Residual Immunity from Smallpox Vaccination and Possible Protection from Mpox, China. Emerg. Infect. Dis. 2024, 30, 321–324. [Google Scholar] [CrossRef]
- Hashemi, M.; Zabihian, A.; Hajsaeedi, M.; Hooshmand, M. Antivirals for monkeypox virus: Proposing an effective machine/deep learning framework. PLoS ONE 2024, 19, e0299342. [Google Scholar] [CrossRef] [PubMed]
- Izadi, M.; Mirzaei, F.; Bagherzadeh, M.A.; Ghiabi, S.; Khalifeh, A. Discovering conserved epitopes of Monkeypox: Novel immunoinformatic and machine learning approaches. Heliyon 2024, 10, e24972. [Google Scholar] [CrossRef] [PubMed]
- Kim, M. Replicating poxviruses for human cancer therapy. J. Microbiol. 2015, 53, 209–218. [Google Scholar] [PubMed]
- Bourquain, D.; Dabrowski, P.W.; Nitsche, A. Comparison of host cell gene expression in cowpox, monkeypox or vaccinia virus-infected cells reveals virus-specific regulation of immune response genes. Virol. J. 2013, 10, 61. [Google Scholar]
- Li, Y.; Sheng, Y.; Chu, Y.; Ji, H.; Jiang, S.; Lan, T.; Li, M.; Chen, S.; Fan, Y.; Li, W.; et al. Seven major genomic deletions of vaccinia virus Tiantan strain are sufficient to decrease pathogenicity. Antivir. Res. 2016, 129, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Dong, H.L.; Chen, Z.L.; He, M.J.; Cui, J.Z.; Cheng, H.; Wang, Q.Y.; Xiong, X.H.; Liu, G.; Chen, H.P. The Chimeric Chaoyang-Zika Vaccine Candidate Is Safe and Protective in Mice. Vaccines 2024, 12, 215. [Google Scholar] [CrossRef]
- Li, Y.; Zhu, Y.; Chen, S.; Li, W.; Yin, X.; Li, S.; Xiao, P.; Han, J.; Li, X.; Sun, L.; et al. Generation of an Attenuated Tiantan Vaccinia Virus Strain by Deletion of Multiple Genes. Front. Cell Infect. Microbiol. 2017, 7, 462. [Google Scholar]
- Liu, C.; Liu, Y.; Liang, L.; Cui, S.; Zhang, Y. RNA-Seq based transcriptome analysis during bovine viral diarrhoea virus (BVDV) infection. BMC Genom. 2019, 20, 774. [Google Scholar]
- Szklarczyk, D.; Kirsch, R.; Koutrouli, M.; Nastou, K.; Mehryary, F.; Hachilif, R.; Gable, A.L.; Fang, T.; Doncheva, N.T.; Pyysalo, S.; et al. The STRING database in 2023: Protein—Protein association networks and functional enrichment analyses for any sequenced genome of interest. Nucleic Acids Res. 2023, 51, D638–D646. [Google Scholar] [PubMed]
- Shannon, P.; Markiel, A.; Ozier, O.; Baliga, N.S.; Wang, J.T.; Ramage, D.; Amin, N.; Schwikowski, B.; Ideker, T. Cytoscape: A software environment for integrated models of biomolecular interaction networks. Genome Res. 2003, 13, 2498–2504. [Google Scholar] [PubMed]
- Ashburner, M.; Ball, C.A.; Blake, J.A.; Botstein, D.; Butler, H.; Cherry, J.M.; Davis, A.P.; Dolinski, K.; Dwight, S.S.; Eppig, J.T.; et al. Gene Ontology: Tool for the unification of biology. Nat. Genet. 2000, 25, 25–29. [Google Scholar]
- Consortium, T.G.O.; Aleksander, S.A.; Balhoff, J.; Carbon, S.; Cherry, J.M.; Drabkin, H.J.; Ebert, D.; Feuermann, M.; Gaudet, P.; Harris, N.L.; et al. The Gene Ontology knowledgebase in 2023. Genetics 2023, 224, iyad031. [Google Scholar] [CrossRef] [PubMed]
- Kanehisa, M.; Furumichi, M.; Sato, Y.; Kawashima, M.; Ishiguro-Watanabe, M. KEGG for taxonomy-based analysis of pathways and genomes. Nucleic Acids Res. 2023, 51, D587–D592. [Google Scholar] [CrossRef] [PubMed]
RANK | VVTT_6 h vs. A293_6 h | VVTT_12 h vs. A293_12 h | VVTT_24 h vs. A293_24 h |
---|---|---|---|
1 | FOS | FOS | FOS |
2 | EGR2 | EGR1 | EGR1 |
3 | EGR1 | FOSB | ATF3 |
4 | DUSP1 | NR4A1 | FOSB |
5 | FOSB | JUNB | NR4A1 |
6 | ZFP36 | IER2 | JUNB |
7 | JUNB | EGR2 | EGR2 |
8 | IER2 | ZFP36 | DUSP1 |
9 | EGR3 | DUSP1 | ZFP36 |
10 | H3C13 | EGR3 | IL6 |
11 | H3C12 | DUSP2 | IER2 |
12 | PTGS2 | GADD45B | EGR3 |
13 | IER3 | FOSL1 | FOSL2 |
14 | H4C6 | ARC | FOSL1 |
15 | H2AC8 | H3C13 | GADD45B |
16 | ARC | H3C12 | PTGS2 |
17 | SOCS3 | CCN1 | DUSP2 |
18 | DUSP6 | H4C6 | CSRNP1 |
19 | CCN2 | H2AC8 | DUSP5 |
20 | BHLHE40 | H2AC20 | CCN1 |
Rank | A6 h_VS._M6 h | A12 h_VS._M12 h | A24 h_VS._M24 h |
---|---|---|---|
1 | HIF-1 signaling | Carbon metabolism | Hippo signaling |
2 | Cell cycle | Cellular senescence | Cocaine addiction |
3 | Longevity regulating | Biosynthesis of amino acids | p53 signaling |
4 | Autophagy-animal | HIF-1 signaling pathway | Insulin resistance |
5 | Human papillomavirus infection | Huntington disease | Arginine and proline metabolism |
6 | Efferocytosis | Protein processing in endoplasmic reticulum | MAPK signaling pathway |
7 | p53 signaling pathway | Cell cycle | Autophagy-animal |
8 | Proteasome | Endocytosis | Amphetamine addiction |
9 | Protein processing in endoplasmic reticulum | FoxO signaling pathway | Protein processing in endoplasmic reticulum |
10 | Proteoglycans in cancer | Autophagy-animal | Hepatocellular carcinoma |
11 | FoxO signaling pathway | Bladder cancer | AMPK signaling pathway |
12 | TNF signaling pathway | AMPK signaling pathway | Insulin signaling pathway |
13 | Chronic myeloid leukemia | Human T-cell leukemia virus 1 infection | Breast cancer |
14 | Spinocerebellar ataxia | Central carbon metabolism in cancer | Cell cycle |
15 | mTOR signaling pathway | mTOR signaling pathway | Spinocerebellar ataxia |
16 | Thyroid hormone signaling pathway | Spinocerebellar ataxia | Synaptic vesicle cycle |
17 | Insulin resistance | Non-small cell lung cancer | Notch signaling pathway |
18 | Biosynthesis of amino acids | Hepatocellular carcinoma | Lysosome |
19 | DNA replication | Hepatitis B | Longevity regulating pathway |
20 | Hepatocellular carcinoma | p53 signaling pathway | Bladder cancer |
Gene Name | Prime Sequence (5′-3′) | Gene Name | Prime Sequence (5′-3′) | Gene Name | Prime Sequence (5′-3′) |
---|---|---|---|---|---|
GAPDH-F | TCAAGCTCATTTCCTGGTATGACA | GAPDH-R | GGGTCTTACTCCTTGGAGGC | GAPDH-P | TGGTGGACCTCATGGCCCACA |
JUNB-F | CGACCACCATCAGCTACCTC | JUNB-R | GTCTGCGGTTCCTCCTTGAA | JUNB-P | CTTCGCCGGTGGCCACCC |
ARC-F | GGCCCCTCAGCTCCAGT | ARC-R | GACAGCTGATGGTGGGGTC | ARC-P | GGCAGCAGCTGGCACCATCA |
EGR3-F | CGCGGTGGGAGAGAGAATG | EGR3-R | GTTGGAAGGGGAGTCGAAGG | EGR3-P | CCCCCGGCAACAAGACCGTG |
DUSP5-F | AGCTTATGACCAGGGTGGC | DUSP5-R | GTCGGGAGACATTCAGCAGG | DUSP5-P | CGAGTTCCTCGCCAACCTGCA |
CTGF-F | GGAGTGGGTGTGTGACGAG | CTGF-R | CTTCCAGTCGGTAAGCCGC | CTGF-P | AAACCGTGGTTGGGCCTGCC |
ZFP36-F | TGACTGCCATCTACGAGAGCC | ZFP36-R | GTCCCTCCATGGTCGGATGG | ZFP36-P | GTCGCTGAGCCCTGACGTGC |
GPR3-F | GTGACTCACGCCGCTTCT | GPR3-R | CCACATCATGGTACCGCTCA | GPR3-P | GCTTCTCGGGGTCCACGCAC |
NR4A1-F | GACCCCGGAAAGCGGG | NR4A1-R | TGGATACAGGGCATCTCACTCTG | NR4A1-P | GGCAGCCTGGCTCCTTCTGC |
TNFRSF12A-F | AGAGAGAAGTTCACCACCCC | TNFRSF12A-R | GCACATTGTCACTGGATCAGC | TNFRSF12A-P | GAGGAGACCGGCGGAGAGGG |
ETV5-F | AACCGGAAGAGGTTGCTCG | ETV5-R | GGCATCTGGGTCACAGACAA | ETV5-P | GCGCTGGGGCATCCAGAAGA |
TAF11L11-F | TGGCACAGCAGAAACACAGAA | TAF11L11-R | TGAGATTCCAGTCTGCTCCG | TAF11L11-P | TCGAACCACCCCAGCCAGAACT |
ETV4-F | CGCCTACGACTCAGATGTCA | ETV4-R | GGTTTCTCATAGCCATAGCCCA | ETV4-P | CTCTCCAGGTGACGGGGCCA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, Z.; Jiang, Y.; Cui, J.; Li, W.; Han, W.; Liu, G. Elucidating the Mechanism of VVTT Infection Through Machine Learning and Transcriptome Analysis. Int. J. Mol. Sci. 2025, 26, 1203. https://doi.org/10.3390/ijms26031203
Chen Z, Jiang Y, Cui J, Li W, Han W, Liu G. Elucidating the Mechanism of VVTT Infection Through Machine Learning and Transcriptome Analysis. International Journal of Molecular Sciences. 2025; 26(3):1203. https://doi.org/10.3390/ijms26031203
Chicago/Turabian StyleChen, Zhili, Yongxin Jiang, Jiazhen Cui, Wannan Li, Weiwei Han, and Gang Liu. 2025. "Elucidating the Mechanism of VVTT Infection Through Machine Learning and Transcriptome Analysis" International Journal of Molecular Sciences 26, no. 3: 1203. https://doi.org/10.3390/ijms26031203
APA StyleChen, Z., Jiang, Y., Cui, J., Li, W., Han, W., & Liu, G. (2025). Elucidating the Mechanism of VVTT Infection Through Machine Learning and Transcriptome Analysis. International Journal of Molecular Sciences, 26(3), 1203. https://doi.org/10.3390/ijms26031203