Next Article in Journal
Measurement of the Infection and Integrity of Monkeypox Virus: A New Method Using PMAxx-ddPCR
Next Article in Special Issue
Mitochondrial Dysfunction in Genetic and Non-Genetic Parkinson’s Disease
Previous Article in Journal
Combinatorial Effects of Cisplatin and PARP Inhibitor Olaparib on Survival, Intestinal Integrity, and Microbiome Modulation in Murine Model
Previous Article in Special Issue
Mass Spectrometry Analysis of Neurotransmitter Shifting during Neurogenesis and Neurodegeneration of PC12 Cells
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Oxidative High Mobility Group Box-1 Accelerates Mitochondrial Transfer from Mesenchymal Stem Cells to Colorectal Cancer Cells Providing Cancer Cell Stemness

1
Department of Molecular Pathology, Nara Medical University, 840 Shijo-cho, Kashihara 634-8521, Nara, Japan
2
Pathology Laboratory, Research Institute, Tokushukai Nozaki Hospital, 2-10-50 Tanigawa, Daito 574-0074, Osaka, Japan
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2025, 26(3), 1192; https://doi.org/10.3390/ijms26031192
Submission received: 25 December 2024 / Revised: 25 January 2025 / Accepted: 28 January 2025 / Published: 30 January 2025
(This article belongs to the Special Issue Mitochondrial Function in Human Health and Disease: 2nd Edition)

Abstract

Mitochondria are important organelles for cell metabolism and tissue survival. Their cell-to-cell transfer is important for the fate of recipient cells. Recently, bone marrow mesenchymal stem cells (BM-MSCs) have been reported to provide mitochondria to cancer cells and rescue mitochondrial dysfunction in cancer cells. However, the details of the mechanism have not yet been fully elucidated. In this study, we investigated the humoral factors inducing mitochondrial transfer (MT) and the mechanisms. BM-MSCs produced MT in colorectal cancer (CRC) cells damaged by 5-fluorouracil (5-FU), but were suppressed by the anti-high mobility group box-1 (HMGB1) antibody. BM-MSCs treated with oxidized HMGB1 had increased expression of MT-associated genes, whereas reduced HMGB1 did not. Inhibition of nuclear factor–κB, a downstream factor of HMGB1 signaling, significantly decreased MT-associated gene expression. CRC cells showed increased stemness and decreased 5-FU sensitivity in correlation with MT levels. In a mouse subcutaneous tumor model of CRC, 5-FU sensitivity decreased and stemness increased by the MT from host mouse BM-MSCs. These results suggest that oxidized HMGB1 induces MTs from MSCs to CRC cells and promotes cancer cell stemness. Targeting of oxidized HMGB1 may attenuate stemness of CRCs.

1. Introduction

Colorectal cancer (CRC) ranks second and first in cancer mortality among Japanese men and women, respectively [1]. A five year survival rate for CRC patients is about 70% [1], with a particularly high mortality rate after relapse [2]. In patients with recurrent CRC, therapeutic agents targeting only tumor cells have limitations and new treatment strategies are needed. Tumor development and recurrence depend on the interaction of tumor cells and normal cells in the tumor microenvironment (TME) [3]. Within the TME, mesenchymal stem cells (MSCs) are recruited into the tumors by tumor-derived factors [4]. Moreover, physical contact between MSCs and tumor cells provides intercellular signaling, leading to tumor stromal formation and tumor cell growth [5]. Therefore, therapies targeting the interaction between MSCs and tumor cells may be relevant.
In recent years, many studies have elucidated the cell-to-cell interaction via mitochondrial migration between MSCs and tumor cells [6]. MSC-derived mitochondria migrate into tumor cells through tunneling nanotubes (TNT) by the actin filament-forming cytoskeletal system, which is named mitochondrial transfer (MT) [7]. MT occurs in many cancers [8], and it plays a role in cancer cell evasion from the immune system and provides drug resistance in tumor cells [9,10]. However, there are few studies on the mechanisms of MT between MSCs and CRC cells, and the impact of MT in CRCs remains unclear.
HMGB1 is released extracellularly from necrotic tumor cells and induces nuclear factor–κB (nuclear factor–kappa-light-chain-enhancer of activated B cells) activation and cytokine production via the receptor’s receptor for glycation end products (RAGE) and toll-like receptor 4 (TLR4) expressed on tumor cells, promoting tumor growth, survival, invasion and metastasis [11,12]. HMGB1 has three cysteine residues, Cys23, Cys45, and Cys106, and modifications of these cysteines determine the biological activity of extracellular HMGB1 [13]. The disulfide bond between Cys23 and Cys45 in the HMGB1 protein (disulfide HMGB1; oxidized HMGB1) causes inflammatory cytokine-stimulating activity [14]. In contrast, reduction in all cysteine residues (reduced HMGB1) results in chemotaxis-mediated activity [14]. When all cysteine residues are oxidized, HMGB1 is inactivated [15].
Moreover, redox modifications of HMGB1 play an important role in MSC-tumor cell communication [4]. Reduced HMGB1 promotes MSC chemotaxis and differentiation, while oxidized HMGB1 increases MSC stemness and proliferation [4]. MSCs treated with oxidized HMGB1 also increase cancer cell stemness and promote metastasis [4]. Thus, different forms of HMGB1 (oxidized or reduced) have different effects on MSCs and may have a different impact on cancer cells within TME; however, the mechanism is not completely elucidated.
Therefore, in this study, to elucidate the mechanism by which MSCs influence CRC growth promotion, we examined MT between MSCs and CRC cells and the effect of MT on CRC cells. We also examined the role of HMGB1 in MT and its redox modification.

2. Results

2.1. Effect of HMGB1 on MT

Assessing the relationship between CRC cancer cells and bone marrow BM-MSCs, CRC and MSCs were cocultured in unattached or attached conditions (Figure 1A,B). In the unattached condition, HT29 and CT26 CRC cells showed cell growth at the same levels to those in non-cocultured cells, whereas both CRC cells showed enhanced cell growth in the attached condition. CRC cells treated with 5-FU increased the secretion of HMGB1 into the cultured medium (Figure 1C). To confirm MT from BM-MSCs to CRC cells, CRC cells (PKH67 labeled) and BM-MSCs (mitochondria labeled with Mito Deep red) were cocultured (Figure 1D,E). Under 5FU treatment, mBM-MSCs elongated TNT to the CT26 CRC cell. Mitochondria of mBM-MSCs were transferred to the CT26 cell through the TNT (Figure 1D). The mMSC TNT reached the CT26 cell at 20 s. The mMSC mitochondria entered into the TNT at 30 s. The mMSC mitochondria reached the CT26 cell cytoplasm. The hBM-MSCs attached to the HT29 CRC cell. Mitochondria of hBM-MSCs were transferred to the HT29 cell temporally (Figure 1E).
MCS mitochondria-transferred CRC cells were found in both CRC cells. MT from BM-MSCs to both CRC cells were significantly increased after coculture under 5-FU exposure, which was abrogated by anti-HMGB1 antibody treatment (Figure 2A–C). Similar to MT, TNT formation was also promoted by 5FU treatment, and the promoting effect of 5FU was suppressed by treatment with anti-HMGB1 antibody (Figure 2D,E). Thus, MT from MSCs to CRC cells occurred, which was enhanced by 5-FU. Since 5-FU increased HMGB1 secretion, HMGB1 might be associated with MT between CRC cells and MSCs.
Next, oxidative stress and mitochondrial membrane potential (TMRE) were examined (Figure 2F,G). Mitochondrial hydroxyradical (mtSOX) levels were increased by 5-FU treatment, which were abrogated by coculture with BM-MSCs. Mitochondrial membrane potentials (MMP) were decreased by 5-FU treatment, which were abrogated by coculture with BM-MSCs. In contrast, anti-HMGB1 antibody treatment diminished the effects of BM-MSCs on mtSOX and MMP.

2.2. Effect of CRC Cell Cultured Medium (CM) on BM-MSCs

Mitochondrial Rho GTPase 1 (Miro1), attaching the mitochondria to the motor/adaptor complex [16] and connexin 43 (Cx43), a gap junction protein [17], are involved in TNT formation. Their expression is induced during MT, but their decrease suppresses MT [18]. We analyzed the effect of anti-HMGB1 antibody on expression of Miro1 and Cx43 in human BM-MSCs (hBM-MSCs) and mouse BM-MSCs (mBM-MSC) (Figure 3A,B). BM-MSCs exposed to CM of 5-FU-treated CRC cells increased mRNA expression of Miro1 and Cx43, and protein levels of Miro1 and Cx43 compared to 5-FU untreated CM. In contrast, anti-HMGB1 antibody decreased mRNA expression of Miro1 and Cx43, and protein levels of Miro1 and Cx43 compared to untreated CMs. This suggests that HMGB1 promotes the formation of TNT required for MT.

2.3. Effect of oxHMGB1 on MT

The above results suggest that HMGB1 promotes MT. To confirm this, we treated MSCs with recombinant HMGB1 (rHMGB1) and examined the expression of TNT formation-related factors (Figure 4). HMGB1 formed different protein construct by posttranscriptional modification, especially oxidation [18]. We then compared oxidized HMGB1 (oxHMGB1) and reduced HMGB1 (redHMGB1) on MT (Figure 3). The former is usually predominant in extracellular HMGB1 [19]. When rHMGB1 was treated with H2O2, all rHMGB1 was converted to oxHMGB1 (Figure 4A). In contrast, rHMGB1 treated with 2-mercaptoethanol turned all rHMGB1 into redHMGB1. We examined the effect of redox modification of HMGB1 on MT and TNT formation (Figure 4B). MT and TNT formation was promoted by oxHMGB1, but was inhibited by redHMGB1. We compared the effect of oxHMGB1 with redHMGB1 on mRNA and protein expression of Miro1 and Cx43 in BM-MSCs. oxHMGB1 significantly increased both Miro1 and Cx43 mRNA levels (Figure 4C). In contrast to oxHMGB1, redHMGB1 did not increase Miro1 and Cx43 mRNAs. oxHMGB1, but not redHMGB1, increased protein levels of Miro1 and Cx43 in BM-MSCs (Figure 4D). Thus, our results suggest that oxHMGB1, but not redHMGB1, promotes MT.

2.4. Effects of NF–κB Suppression on MT

HMGB1 is known to activate nuclear factor NF–κB via RAGE and TLR4 [12,20]. Therefore, we evaluated the effect of NF–κB on MT in 5-FU-treated CRC cells (Figure 5). First, we examined the mRNA expression of RAGE and TLR4 in BM-MSCs (Figure 4A). Human and mouse BM-MSCs expressed RAGE and TLR4. Next, we examined the effect of cocultured BM-MSCs on MtSOX and MMP in HT29 and CT26 cells (Figure 5B,C). When cocultured cells were treated with JSH-23, an NF–κB inhibitor, 5-FU induced mitochondrial reactive oxygen species (ROS) increase and MMP decrease became further pronounced to 5-FU alone. Next, we examined the involvement of NF–κB in the mRNA expression of Miro1 and Cx43 in BM-MSCs (Figure 5D). BM-MSCs exposed to CM from 5-FU treated CRC cells increased the expression of Miro1 and Cx43, which was suppressed by JSH-23. Thus, our results suggest that NF–κB activation is required for induction of MT by HMGB1.

2.5. Significance of MT in CRC Cells

We next investigated the effect of MT from BM-MSCs on CRC cells (Figure 6). Using the mitoception method [21], mitochondria extracted from hBM-MSCs were artificially introduced into 5-FU-treated HT29 cells (Figure 6A). By mitoception, BM-MSC-mitochondria were transferred to HT29 cells in a dose-dependent manner. When we examined 5-FU sensitivity, HT29 cells that transferred hBM-MSC mitochondria showed enhanced 5-FU resistance, as well as cocultured HT29 cells with hBM-MSC compared to control cells (Figure 6B). Sensitivities to 5-FU and cisplatinum (CDDP) of hBM-MSCs-cocultured HT29 cells were also decreased (Figure 6C). Mitoception decreased mitochondrial ROS and increased MMP compared to those in control cells in a dose-dependent manner (Figure 6D). Oxidative phosphorylation was also enhanced by mitoception (Figure 6E).
Since stemness has been emphasized as a cause of chemotherapy resistance [10], we investigated the effect of MT on stemness (Figure 7). hBM-MSC mitochondria-transferred HT29 cells showed enhanced sphere formation, even under 5-FU (Figure 7A). When mRNA expression of stemness-associated genes in mitochondria-transferred HT29 was examined, expression of SRY-box transcription factor 2 (Sox2), CD44, leucine-rich repeat-containing G-protein coupled receptor 5 (LGR5), and Krüppel-like factor 4 (KLF4) were all increased (Figure 7B). Untreated and mitocepted HT29 cells were inoculated subcutaneously into the back of nude mice (10 mice each) (Figure 7C). There was no difference between control cells and mitocepted cells at inoculation with 1 × 107 cells. In contrast, mitocepted cells showed higher tumorigenesis when inoculated with 1 × 103 to 1 × 106 cells compared to control cells. Thus, cancer cells transfected with BM-MSC mitochondria showed enhanced stemness and increased chemotherapy resistance.

2.6. Effects of MT Inhibition in a Mouse Subcutaneous Tumor Model

To examine the in vivo effects of MT, CT26 cells were inoculated subcutaneously in syngeneic BALB/c mice and treated with a HMGB1 neutralizing antibody or NF–κB inhibitor (JSH-23) with or without 5-FU (Figure 8A). Tumor growth in time course (Figure 8B) and tumor volume at 4 weeks after inoculation (Figure 8C) showed that MT inhibition suppressed tumor growth, especially HMGB1 antibody treatment. The tumor suppressive effect of 5-FU was enhanced by MT inhibition. For evaluating MSC migration into the tumors, MSC marker CD74- or sex determining region Y box 2 (SOX2)-positive cells in tumor tissues were detected by immunohistochemistry (Figure 8D). The anti-HMGB1 antibody strongly inhibited the infiltration of CD74- or SOX2-positive MSCs into tumors, whereas the NFκB inhibitor had a weak effect. For confirmation, MSC-associated protein levels of CD74 and SOX2 in tumor tissues were examined. CD74 was reduced only with HMGB1 antibody treatment (Figure 8E). A stemness marker SOX2 protein decreased by both anti-HMGB1 antibody and NFκB inhibitor (Figure 8F). ROS levels were increased by MT inhibition (Figure 8G). Thus, MT inhibition suppressed stemness and increased 5-FU sensitivity.

2.7. Effect of In Vivo MT on CRC Cells in Miro1-Knockdown Mice

To examine the effect of in vivo MT on CRC cells, CT26 cells were inoculated subcutaneously into mice transplanted with Miro1-knockdown (KD) and mitochondria-labeled bone marrow (BM)(KD-mice) or mice transplanted with mitochondria-labeled BM (C-mice). CT26 cells isolated from subcutaneous tumors were cultured in regular medium (Figure 9A). Tumor size was decreased by Miro1 KD (KD-mice) (Figure 9B). Next, mitochondrial fluorescence was compared between CT26 cells from KD-mice and CT26 cells from C-mice (Figure 9C, left panels). In semi-quantitated fluorescence intensities with reference of mitochondria-labeled BM cells, CT26 cells from C-mice showed 15% intensity of labeled BM, whereas CT26 cells from KD-mice showed only 1%, which suggested Miro1-KD reduced in vivo MT. CT26 cells from tumors in C-mice showed increased expression of nucleostemin and Lgr5 in comparison with parent CT26 cells and CT26 cells from tumors in KD-mice (Figure 9D). CT26 cells from tumors in C-mice showed decreased apoptosis (Figure 9F), increased sphere forming ability (Figure 9F), 5-FU resistance (Figure 9G), and enhanced tumorigenicity (Figure 9H). However, these alterations were abrogated in CT26 cells from tumors in KD-mice. Thus, in vivo MT from host BM-MSCs to cancer cells was suggested to increase cancer cell stemness.

3. Discussion

In the present study, we elucidated a novel mechanism that MT from BM-MSC is responsible for enhanced stemness in CRC cells. HMGB1 released from CRC cells in response to chemotherapy-induced damage promotes MT of BM-MSCs to CRC cells, resulting in enhanced stemness and anticancer drug resistance in CRC cells. Furthermore, among the HMGB1 redox modifications, we revealed that oxHMGB1, but not redHMGB1, provides an intracellular signal via NF–κB in BM-MSCs that triggers MT from BM-MSCs.
In this study, mechanical introduction of mitochondria into CRC cells by mitoception resulted in enhanced sphere formation and increased expression of stem cell markers and resistance to 5-FU, which are associated with enhanced stemness in CRC cells. The results suggest that extrinsic mitochondria might enhance cancer stemness. Energy metabolism in cancer stem cells is dependent on oxidative phosphorylation (OXPHOS) in comparison with differentiated cancer cells [24]. In this study, it appears that oxidative phosphorylation, ROS generation, and energy production were normalized in cancer cells that received normal mitochondria from MSCs. Mitochondria are not only powerhouses in cancer cells, but also regulators of cell survival, cell death, proliferation, motility, and stemness [25,26]. Mitochondrial biogenesis enhances the expression of markers for sphere formation, stemness, pluripotency, and epithelial–mesenchymal transition [27]. Furthermore, promotion of mitochondrial biogenesis and OXPHOS are associated with increased stemness at transition from a primed state to a naive state of embryonal stem cells [28]. However, the detailed mechanisms by which mitochondria enhance stemness remain unclear.
In this study, we used BM-MSCs as mitochondrial donors in MT. Stem cells maintain their lineage through asymmetric cell division. Interestingly, mitochondria are also distributed asymmetrically during cell division [29,30]; new mitochondria are selectively distributed in stem cell lineage, which have low OXPHOS activity. In contrast, old mitochondria are distributed in differentiating cells, and these have high OXPHOS activity. Umbilical cord MSCs exhibit energy metabolism via OXPHOS, but high stemness correlates with relatively low OXPHOS activity [31]. In our study, the increase in OXPHOS in mitocepted CRC cells was at low levels. MSCs as mitochondrial donors endow cancer cells with stemness by transferring their own mitochondria associated with high stemness to cancer cells. Since MT enhances stemness, MT may enhance not only chemotherapy resistance but also cancer metastasis [32].
Damage to mitochondria by anticancer drugs induces cell death, but at the same time induces adaptation of cancer cells to the anticancer drugs in terms of energy metabolism and redox balance, thereby inducing drug resistance [33]. Our data suggest that anticancer drug-induced MT enhances anticancer drug resistance through promotion of stemness and suppression of ROS production in cancer cells. Along with MT-induced stemness enhancement, mitochondrial ROS reduction due to introduction of normal mitochondria by MT is thought to be important in the acquisition of anticancer drug resistance [34]. Our data also show that mitochondrial transfer normalizes MMP in CRC cells and suppresses the induction of excessive ROS production by 5-FU. In Jurkat cells, injured mitochondria by chemotherapy are transferred to MSCs, thereby decreasing intracellular ROS and acquiring anticancer drug resistance [9]. In our results, cancer cells are supplied with normal mitochondria from BM-MSCs rather than excreting the impaired mitochondria into MSCs. However, both of these processes reduce ROS in cancer cells, leading to resistance to anticancer drugs.
HMGB1 is known as a migration factor for BM-MSCs [35]. oxHMGB1 plays roles in migration and retaining stemness of BM-MSCs [4]. BM-MSCs that have migrated into cancer tissues promote the stemness of cancer cells and enhance their metastatic potential [4]. Interestingly, this effect requires cell-to-cell adhesion [4]. In our data, attached coculture, but not unattached coculture, increased cell growth.
In contrast to oxHMGB1, redHMGB1 confers stronger migration ability to MSCs while promoting their differentiation into bone and endothelial cells [36,37]. This difference in the action of oxHMGB1 and redHMGB1 on cancer cells may be attributed to their differential action in MT. High levels of ROS are known to oxidize HMGB1 and release oxHMGB1 to the outside of cells [38]. It is well known that anticancer drugs induce intracellular ROS, which injure DNA to provide cell death [39]. This suggests that oxHMGB1 is released from cancer cells by anticancer drugs [40]. In other words, chemotherapy may promote the release of oxHMGB1 from cancer cells and induce MT from BM-MSCs.
In this study, we focused on Cx43 and Miro1 as factors responsible for MT in BM-MSCs. MT can be achieved by endocytosis [41], macropinocytosis [42], or TNTs containing a kinesin translocation system [43]. Cx43 and Miro1 are proteins that control TNT formation [44,45]. In a mouse model of acute lung injury, BM-MSCs regulate TNT formation and transferring mitochondria to alveolar cells via Cx43 [46]. Overexpression of Miro1 significantly improves MT efficiency in induced-pluripotent-stem-cell-derived-MSCs [47]. We showed that NF–κB induces Miro1 gene expression. NF–κB is located downstream of RAGE and TLR4 signals, which are activated by HMGB1 to induce inflammatory responses [48]. HMGB1 is known to be released from necrotic cells [11], and HMGB1 is also a marker of tissue damage [49]. These are thought to be mechanisms by which tissue damage markers activate MSCs and promote tissue protection and regeneration. This mechanism represents feedback in normal tissues and is linked to cancer cell viability and treatment resistance.
Our results suggest that NF–κB plays an important role in promoting MT. NF–κB is activated by various intracellular signals including RAGE. RAGE expression was confirmed in the MSCs we used. The redHMGB1–RAGE axis induces MSC differentiation [50], whereas AGE, also a RAGE ligand, suppresses differentiation [51]. We have also reported that HMGB1 and AGE express different effects through RAGE [52]. Furthermore, redHMGB1, oxHMGB1, and glycated HMGB1 have different activation effects on RAGE and provide different phenotypes [4]. Nuclear translocation of the NF–κB p65 is also at high levels in oxHMGB1 and at low levels in redHMGB1 [14]. Regarding the diversity of intracellular signals in RAGE, complex formation between RAGE, one of G protein-coupled receptors (GPCRs), and other GPCRs such as the angiotensin receptor (AT1) has been pointed out [53]. When RAGE forms a complex with AT1, it activates Gi and NF–κB. This suggests that the diversity of G protein subunits that mediate RAGE signals results in the diversity of RAGE signals.
In our in vitro studies, hBM-MSCs were cultured in DMEM, mBM-MSCs in stem cell medium, and DMEM was used for coculture with CRC cells. This may lead to changes in phenotypes in mouse MSCs. In fact, TNT formation is affected by various factors such as the cellular environment and stress conditions [54]. In addition, MTs change depending on the health of MSCs [55], and the culture environment can regulate the mitochondrial transplantation ability [56]. For this reason, MSCs cultured in DMEM may not show their original stemness. It is important to consider the extent to which BM-MSCs maintain stemness after leaving the bone marrow niche and migrating into cancer tissues or peripheral tissues. Because the oxHMGB1 we examined in this study has the effect of maintaining the stem cell stemness of BM-MSCs [4], it is possible that oxHMGB1 confers resistance to environmental changes on MSCs and helps maintain the activity of MSCs in non-bone marrow tissues.
When BM-MSCs were cocultured with CRC cells damaged by 5-FU, MT from BM-MSCs was promoted by oxHMGB1 released from cancer cells. As a result, CRC cells acquired stemness and drug resistance. These results suggest that targeting oxHMGB1 may serve as a new therapeutic strategy to suppress the malignant phenotypes of CRCs and increase therapeutic efficacy.

4. Materials and Methods

4.1. Cell Lines and Reagents

HT29 human carcinoma cell line was purchased from Dainihon Pharmacy Co. (Tokyo, Japan). CT26 murine colon carcinoma cell line was gifted by Professor I. J. Fidler (MD Anderson Cancer Center, Houston, TX, USA). UE7T-13 human bone marrow-derived MSC line (hBM-MSC) was obtained from the Health Science Research Resources Bank (JCRB1154; Japan Health Sciences Foundation, Tokyo, Japan). Cells were cultured in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum (FBS, Sigma Chemical Co., St. Louis, MO, USA) at 37 °C in 5% CO2. HT29 cells and CT26 cells were surface-labeled with PKH67 (Sigma) according to the manufacturer’s instructions.
In coculture of CRC cells with BM-MSCs (Figure 1), UniWells (Fuji Film, Osaka, Japan) was used for unattached coculture; CytoSelect (Cosmo-Bio, Tokyo, Japan) was used for attached coculture. In both coculture systems, CRC cells (5 × 103) and BM-MSCs (5 × 103) were seeded on culture wells according to the manufacturer’s instructions.
For oxidization of HMGB1, recombinant human HMGB1 (Biolegend, San Diego, CA, USA) was incubated with 50 μM H2O2 (Wako) on ice for 1 h. For reduction in HMGB1, recombinant human HMGB1 (Biolegend) was incubated with 50 mM 2-mercaptoethanol (Sigma) on ice for 1 h.
HT29 and CT26 cells were treated with 5-fluorouracil (5-FU, 1.5 μg/mL and 0.5 μg/mL for 48 h, Sigma) or co-treated with 5-FU (1.5 μg/mL and 0.5 μg/mL for 48 h, Sigma) and antihuman HMGB1 antibody (10 μg/mL for 48 h, Biolegend). MSCs were treated with oxHMGB1 (100 μg/mL for 48 h, Biolegend) or the specific NF–κB inhibitor JSH-23 (20 μM for 48 h) (MedChemExpress, Monmouth Junction, NJ, USA).

4.2. Mouse BM-MSC (mBM-MSC) Preparation

BALB/c mice (5-week old, male, SLC Japan, Shizuoka, Japan) were euthanized by cervical dislocation under anesthesia, and bone marrow cells were harvested by flushing the bone marrow from the femur with regular DMEM (WAKO). After centrifugation at 1500 rpm for 5 min, the pellet was suspended in PBS (WAKO). Red blood cells were lysed with RBC lysis buffer (PluriSerect Life Science, Leipzig, Germany), followed by gentle vortexing at room temperature. Centrifugation was repeated at 1500 rpm for 5 min, and the pellet was resuspended and cultured in MSC culture medium (MesenCult-ACF Plus, Veritas, Tokyo, Japan) for 3 days. Floating cells were carefully removed by PBS washing.

4.3. Coculture of CRC Cells with BM-MSCs

PKH67-labeled HT29 cells and CT26 cells (5 × 105 cells/well) were cultured in 6 wells for 48 h with 5-FU (1.5 μg/mL and 0.5 μg/mL, Sigma) or cotreated with 5-FU (1.5 μg/mL and 0.5 μg/mL, Sigma) and anti-HMGB1 antibody (10 μg/mL for 48 h, Biolegend). Then, cells were cocultured with half the number of Mito Deep Red-labeled BM-MSCs. The images were captured with a BZ-X710 All-in-One fluorescence microscope (KEYENCE, Osaka, Japan) and analyzed on a computer. The fluorescence intensity was measured using NIH ImageJ software (version 1.52, Bethesda, MD, USA).

4.4. Cell Count

To count MT and TNT, 20 microscopic fields by 40× magnification and 50 cells in each field were screened. The captured images were analyzed on a computer, and the number of cells was counted using ImageJ software (version 1.52; NIH, Bethesda, MD, USA).

4.5. Mitoception

Mitochondria were isolated from hBM-MSCs using the Mitochondria Isolation Kit for Tissue (ThermoFisher Scientific, Waltham, MA, USA), according to the manufacturer’s instructions. To obtain a mitochondria pellet with low contamination from other compounds, centrifugation was performed at 3000× g for 15 min. Typical mitochondria yield is 100 μg per million BM-MSCs. The mitochondria preparation was resuspended in DMEM on ice and used immediately for the artificial transfer. HT29 cells were seeded 5 × 105 cells per 6-well dish and treated with or without 5-FU (1.5 μg/mL for 24 h, Sigma) the day before the artificial transfer. Cells were counted and the additional amounts of mitochondria were adjusted accordingly. The amounts show hBM-MSC mitochondria (μg of proteins) for 1 × 105 HT29 cells. The mitochondria suspension was added slowly and close to the bottom of the well. The well was centrifuged at 1500× g for 15 min at 4 °C. The following day, cells were washed with PBS and analyzed.

4.6. Sphere Assay

CRC cells (1 × 106) were cultured with 5-FU (1.5 μg/mL for 48 h, Sigma) and mitocepted with hBM-MSCs mitochondria. The following day, cells were seeded onto uncoated bacteriological 35 mm dishes (Coning Inc., Corning, NY, USA) in 3D Tumorsphere Medium XF (Sigma). After 7 days of culture, images of the spheres were acquired using a BZ-X710 All-in-One fluorescence microscope (KEYENCE, Osaka, Japan).

4.7. Mitochondrial Imaging

Mitochondrial functions were examined using fluorescent probes. Cells were incubated with the probes for 30 min at 37 °C and then imaged using a BZ-X710 All-in-One fluorescence microscope (KEYENCE, Osaka, Japan). We used MitoROS (superoxide, 10 μM, AAT Bioquest Inc., Sunnyvale, CA, USA) to assess oxidative stress, MitoTrackerTM Deep Red FM (Thermo Fisher Scientific, Tokyo, Japan) and MitoBright LT Green (Dojindo, Kumamoto, Japan) to assess mitochondrial volume, and tetramethylrhodamine ethyl ester (TMRE) (200 nM, Sigma) to assess mitochondrial membrane potential. The captured images were analyzed on a computer, and the fluorescence intensity was measured using NIH ImageJ software (version 1.52, Bethesda, MD, USA).

4.8. Reverse Transcription–PCR (RT–PCR)

To assess mRNA expression, RT–PCR was performed with 2 µg total RNA extracted from cells using TRI REAGENT (Molecular Research Center, Inc., Cincinnati, OH, USA) according to the manufacturer’s protocol. cDNA was synthesized with 0.5 µg total RNA using a High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Waltham, MA, USA). The primer sets are listed in Table 1 and were synthesized by Sigma Genosys (Ishikari, Japan). PCR products were electrophoresed on a 2% agarose gel and stained with ethidium bromide. β-actin, GAPDH and α-tubulin mRNA was also amplified for use as an internal control. Images were captured on a computer and the signal strength was measured using NIH ImageJ software (version 1.52, Bethesda, MD, USA).

4.9. Protein Extraction

To prepare whole cell lysates, cells were washed twice with cold PBS, harvested, and lysed with RIPA buffer containing 0.1% sodium dodecyl sulfate (SDS) (Thermo Fisher) [57]. Cell fractions were extracted by processing the cells with a Cell Fractionation Kit (Abcam, Cambridge, UK), according to the manufacturer’s instructions. Protein assays were performed using a Protein Assay Rapid Kit (Wako, Osaka, Japan).

4.10. Immunoblot Analysis

Whole cell lysates were prepared as previously described [57]. Lysates (50 μg) were subjected to immunoblot analysis using 12.5% SDS–polyacrylamide gels, followed by electrotransfer onto nitrocellulose membranes (Bio-Rad, Hercules, CA, USA). The membranes were incubated with primary antibodies and then with peroxidase-conjugated IgG secondary antibodies (MBL, Nagoya, Japan). Antibodies against Miro1 (Abcam, Cambridge, UK), and HMGB1 (Abcam, Cambridge, UK) were used for primary antibodies. Antibodies against β-actin (Oncogene Research Products, Cambridge, MA, USA) and GAPDH (Proteintech, Tokyo, Japan) were used to assess protein loading. Binding of the immune complex was visualized using a CSA system (DAKO, Carpinteria, CA, USA). Images were captured on a computer and the signal strength was measured using NIH ImageJ software.

4.11. Flow Cytometry

Fluorescence Activated Cell Sorting (FACS) experiments were performed using a Moxi GO II (AS ONE, Osaka, Japan). Data are expressed with the mean fluorescence intensity (MFI) values.

4.12. Animal Model

BALB/c mice (4-week old, male) were purchased from SLC. The animals were maintained in a pathogen-free animal facility at 23 °C and 50% humidity, under a 12 h light/dark cycle. The animal study was conducted in accordance with the institutional guidelines approved by the Committee for Animal Experimentation of Nara Medical University, Kashihara, Japan, following current regulations and standards of the Japanese Ministry of Health, Labor and Welfare (approval nos. 11528, 11569, 11596, 11725, 11716, 12777).

4.13. Subcutaneous Tumor Model

CT26 cells (1 × 107 per mouse) were inoculated into the scapular subcutaneous tissues of 30 BALB/c mice (5-week old, male). They were divided to 6 groups each 5 mice; group 1, no treatment (None); group 2, 5-FU (10 mg/kg BW ip, Sigma); group 3, anti-HMGB1 antibody (0.5 mg/kg BW ip, Biolegend); group 4, anti-HMGB1 antibody + 5-FU; group 5, NFκB inhibitor (JSH-23, 20 mg/kg BW ip, MedChemExpress); group 6, NFκB inhibitor + 5-FU. In each group, drugs were administered twice a week (total 8 times). Tumor size was measured each week by a caliper. Tumor volume was calculated by height × major axis × minor axis × π/6. Mice were euthanized at 4 weeks after inoculation and subjected to histological examination.

4.14. Bone Marrow Replacement Model

BALB/c (5-week old, male, SLC) were euthanized by cervical dislocation. Bone marrow cells were harvested by flushing the bone marrow from the femur with regular DMEM (WAKO). Cells were resuspended in DMEM and pretreated with siMiro1 (10 nM, Sigma) or siControl (10 nM, Sigma) for 48 h according to manufacturer’s instructions. Bone marrow cells were then labeled with MitoLite Green EX488 (AAT Bioquest, Pleasanton, CA, USA), according to manufacturer’s instructions. The labeled cells were resuspended in HBSS (WAKO) at a volume of 1 × 107 cells/0.25 mL. Subsequently, BALB/c (4-week old, male, SLC) recipient mice underwent 10 Gy of whole-body irradiation. In F-mice group, 5 mice were injected resuspended bone marrow cells (1 × 107 per mouse) pretreated with siMiro1 from the tail vein. In C-mice group, 5 mice were injected bone marrow cells pretreated with siControl. CT26 cells (5 × 107 per mouse) were inoculated into the scapular subcutaneous tissues at a week after bone marrow transplantation. Inoculated tumors were harvested from mice after euthanasia with anesthesia. Tumor tissues were cut into small pieces with a scalpel, treated with collagenase (Sigma) and DNAase (Sigma), and the isolated cells were transferred to a culture system with regular medium. Subsequently, the cultured cells were subjected to examinations.

4.15. Statistical Analysis

Statistical significance was calculated using a two-tailed Fisher’s exact test or an ordinary analysis of variance (ANOVA), using InStat software (GraphPad, Los Angeles, CA, USA). Correlations were tested using Pearson’s correlation test. A two-sided p value of <0.05 was considered to indicate statistical significance.

Author Contributions

Study concept and design: H.K. Data investigation: R.S., Y.L., R.O. and T.S. Data analysis: R.S., Y.L., S.K., Y.N., H.O. and R.F.-T. Drafting of the manuscript: R.S. and Y.L. Editing of the manuscript: H.K. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by MEXT KAKENHI Grant Numbers, 19K16564 (R.F.-T.), 23K10481 (H.O.), 22K11396 (T.S.), 22K11396 (Y.N.), 21K06926 (Y.L.), 23K19900 (R.O.), 20K21659 (H.K.).

Institutional Review Board Statement

Animal experiments were performed at the Animal Laboratory at Nara Medical University in accordance with the institutional guidelines approved by the Committee for Animal Experimentation of Nara Medical University, Kashihara, Japan, following current regulations and standards of the Japanese Ministry of Health, Labor and Welfare (approval no. 12777, 20 April 2020).

Informed Consent Statement

Not applicable.

Data Availability Statement

Data are contained within the article.

Acknowledgments

The authors thank Tomomi Nitta for expert assistance with the preparation of this manuscript.

Conflicts of Interest

The authors have no conflicts of interest to declare.

Abbreviations

BM: bone marrow; MSC: mesenchymal stem cell; MT: mitochondrial transfer; CRC: colorectal cancer; 5-FU: 5-fluorouracil; HMGB1: anti-high mobility group box-1; rHMGB1: recombinant HMGB1; oxHMGB1: oxidized HMGB1; redHMGB1: reduced HMGB1; NF–κB: nuclear factor–κB, TME: tumor microenvironment; TNT: tunneling nanotubes; MMP: mitochondrial membrane potential; Miro1: mitochondrial Rho GTPase 1; Cx43: connexin 43; KD: knockdown; OXPHOS: oxidative phosphorylation.

References

  1. Wakao, F. CANCER STATISTICS IN JAPAN 2023. Available online: https://ganjoho.jp/public/qa_links/report/statistics/2023_jp.html (accessed on 1 December 2024).
  2. Pugh, S.A.; Shinkins, B.; Fuller, A.; Mellor, J.; Mant, D.; Primrose, J.N. Site and Stage of Colorectal Cancer Influence the Likelihood and Distribution of Disease Recurrence and Postrecurrence Survival: Data From the FACS Randomized Controlled Trial. Ann. Surg. 2016, 263, 1143–1147. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Maley, C.C.; Aktipis, A.; Graham, T.A.; Sottoriva, A.; Boddy, A.M.; Janiszewska, M.; Silva, A.S.; Gerlinger, M.; Yuan, Y.; Pienta, K.J.; et al. Classifying the evolutionary and ecological features of neoplasms. Nat. Rev. Cancer 2017, 17, 605–619. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Kishi, S.; Fujiwara-Tani, R.; Honoki, K.; Sasaki, R.; Mori, S.; Ohmori, H.; Sasaki, T.; Miyagawa, Y.; Kawahara, I.; Kido, A.; et al. Oxidized high mobility group B-1 enhances metastability of colorectal cancer via modification of mesenchymal stem/stromal cells. Cancer Sci. 2022, 113, 2904–2915. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  5. François, S.; Usunier, B.; Forgue-Lafitte, M.E.; L’Homme, B.; Benderitter, M.; Douay, L.; Gorin, N.C.; Larsen, A.K.; Chapel, A. Mesenchymal Stem Cell Administration Attenuates Colon Cancer Progression by Modulating the Immune Component within the Colorectal Tumor Microenvironment. Stem Cells Transl. Med. 2019, 8, 285–300. [Google Scholar] [CrossRef] [Scilit]
  6. Hogan, N.M.; Dwyer, R.M.; Joyce, M.R.; Kerin, M.J. Mesenchymal stem cells in the colorectal tumor microenvironment: Recent progress and implications. Int. J. Cancer 2012, 131, 1–7. [Google Scholar] [CrossRef] [Scilit]
  7. Torralba, D.; Baixauli, F.; Sánchez-Madrid, F. Mitochondria Know No Boundaries: Mechanisms and Functions of Intercellular Mitochondrial Transfer. Front. Cell Dev. Biol. 2016, 4, 107. [Google Scholar] [CrossRef] [Scilit]
  8. Clemente-Suárez, V.J.; Martín-Rodríguez, A.; Yáñez-Sepúlveda, R.; Tornero-Aguilera, J.F. Mitochondrial Transfer as a Novel Therapeutic Approach in Disease Diagnosis and Treatment. Int. J. Mol. Sci. 2023, 24, 8848. [Google Scholar] [CrossRef] [Scilit]
  9. Wang, J.; Liu, X.; Qiu, Y.; Shi, Y.; Cai, J.; Wang, B.; Wei, X.; Ke, Q.; Sui, X.; Wang, Y.; et al. Cell adhesion-mediated mitochondria transfer contributes to mesenchymal stem cell-induced chemoresistance on T cell acute lymphoblastic leukemia cells. J. Hematol. Oncol. 2018, 11, 11. [Google Scholar] [CrossRef] [Scilit]
  10. Mohammadalipour, A.; Dumbali, S.P.; Wenzel, P.L. Mitochondrial Transfer and Regulators of Mesenchymal Stromal Cell Function and Therapeutic Efficacy. Front. Cell Dev. Biol. 2020, 8, 603292. [Google Scholar] [CrossRef] [Scilit]
  11. Scaffidi, P.; Misteli, T.; Bianchi, M.E. Release of chromatin protein HMGB1 by necrotic cells triggers inflammation. Nature 2002, 418, 191–195. [Google Scholar] [CrossRef] [Scilit]
  12. Ohmori, H.; Luo, Y.; Kuniyasu, H. Non-histone nuclear factor HMGB1 as a therapeutic target in colorectal cancer. Expert Opin. Ther. Targets 2011, 15, 183–193. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Tang, D.; Billiar, T.R.; Lotze, M.T. A Janus tale of two active high mobility group box 1 (HMGB1) redox states. Mol. Med. 2012, 18, 1360–1362. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Yang, H.; Lundbäck, P.; Ottosson, L.; Erlandsson-Harris, H.; Venereau, E.; Bianchi, M.E.; Al-Abed, Y.; Andersson, U.; Tracey, K.J. Redox modifications of cysteine residues regulate the cytokine activity of HMGB1. Mol. Med. 2021, 27, 58. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Tang, Y.; Zhao, X.; Antoine, D.; Xiao, X.; Wang, H.; Andersson, U.; Billiar, T.R.; Tracey, K.J.; Lu, B. Regulation of Posttranslational Modifications of HMGB1 During Immune Responses. Antioxid. Redox Signal. 2016, 24, 620–634. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  16. Schwarz, T.L. Mitochondrial trafficking in neurons. Cold Spring Harb. Perspect. Biol. 2013, 5, a011304. [Google Scholar] [CrossRef] [Scilit]
  17. Bonacquisti, E.E.; Nguyen, J. Connexin 43 (Cx43) in cancer: Implications for therapeutic approaches via gap junctions. Cancer Lett. 2019, 442, 439–444. [Google Scholar] [CrossRef] [Scilit]
  18. Ahmad, T.; Mukherjee, S.; Pattnaik, B.; Kumar, M.; Singh, S.; Kumar, M.; Rehman, R.; Tiwari, B.K.; Jha, K.A.; Barhanpurkar, A.P.; et al. Miro1 regulates intercellular mitochondrial transport & enhances mesenchymal stem cell rescue efficacy. EMBO J. 2014, 33, 994–1010. [Google Scholar] [CrossRef] [Scilit]
  19. Kwak, M.S.; Kim, H.S.; Lkhamsuren, K.; Kim, Y.H.; Han, M.G.; Shin, J.M.; Park, I.H.; Rhee, W.J.; Lee, S.K.; Rhee, S.G.; et al. Peroxiredoxin-mediated disulfide bond formation is required for nucleocytoplasmic translocation and secretion of HMGB1 in response to inflammatory stimuli. Redox Biol. 2019, 24, 101203. [Google Scholar] [CrossRef] [Scilit]
  20. Behl, T.; Sharma, E.; Sehgal, A.; Kaur, I.; Kumar, A.; Arora, R.; Pal, G.; Kakkar, M.; Kumar, R.; Bungau, S. Expatiating the molecular approaches of HMGB1 in diabetes mellitus: Highlighting signalling pathways via RAGE and TLRs. Mol. Biol. Rep. 2021, 48, 1869–1881. [Google Scholar] [CrossRef] [Scilit]
  21. Caicedo, A.; Fritz, V.; Brondello, J.M.; Ayala, M.; Dennemont, I.; Abdellaoui, N.; de Fraipont, F.; Moisan, A.; Prouteau, C.A.; Boukhaddaoui, H.; et al. MitoCeption as a new tool to assess the effects of mesenchymal stem/stromal cell mitochondria on cancer cell metabolism and function. Sci. Rep. 2015, 5, 9073. [Google Scholar] [CrossRef] [Scilit]
  22. Luo, Y.; Yoneda, J.; Ohmori, H.; Sasaki, T.; Shimbo, K.; Eto, S.; Kato, Y.; Miyano, H.; Kobayashi, T.; Sasahira, T.; et al. Cancer usurps skeletal muscle as an energy repository. Cancer Res. 2014, 74, 330–340. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Ozkok, A.; Ravichandran, K.; Wang, Q.; Ljubanovic, D.; Edelstein, C.L. NF-κB transcriptional inhibition ameliorates cisplatin-induced acute kidney injury (AKI). Toxicol. Lett. 2016, 240, 105–113. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Sancho, P.; Burgos-Ramos, E.; Tavera, A.; Bou Kheir, T.; Jagust, P.; Schoenhals, M.; Barneda, D.; Sellers, K.; Campos-Olivas, R.; Graña, O.; et al. MYC/PGC-1α Balance Determines the Metabolic Phenotype and Plasticity of Pancreatic Cancer Stem Cells. Cell Metab. 2015, 22, 590–605. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Grasso, D.; Zampieri, L.X.; Capelôa, T.; Van de Velde, J.A.; Sonveaux, P. Mitochondria in cancer. Cell Stress 2020, 4, 114–146. [Google Scholar] [CrossRef] [Scilit]
  26. Folmes, C.D.; Ma, H.; Mitalipov, S.; Terzic, A. Mitochondria in pluripotent stem cells: Stemness regulators and disease targets. Curr. Opin. Genet Dev. 2016, 38, 1–7. [Google Scholar] [CrossRef] [Scilit]
  27. Raggi, C.; Taddei, M.L.; Sacco, E.; Navari, N.; Correnti, M.; Piombanti, B.; Pastore, M.; Campani, C.; Pranzini, E.; Iorio, J.; et al. Mitochondrial oxidative metabolism contributes to a cancer stem cell phenotype in cholangiocarcinoma. J. Hepatol. 2021, 74, 1373–1385. [Google Scholar] [CrossRef] [Scilit]
  28. Carbognin, E.; Betto, R.M.; Soriano, M.E.; Smith, A.G.; Martello, G. Stat3 promotes mitochondrial transcription and oxidative respiration during maintenance and induction of naive pluripotency. EMBO J. 2016, 35, 618–634. [Google Scholar] [CrossRef] [Scilit]
  29. Döhla, J.; Kuuluvainen, E.; Gebert, N.; Amaral, A.; Englund, J.I.; Gopalakrishnan, S.; Konovalova, S.; Nieminen, A.I.; Salminen, E.S.; Torregrosa Muñumer, R.; et al. Metabolic determination of cell fate through selective inheritance of mitochondria. Nat. Cell Biol. 2022, 24, 148–154. [Google Scholar] [CrossRef] [Scilit]
  30. Katajisto, P.; Döhla, J.; Chaffer, C.L.; Pentinmikko, N.; Marjanovic, N.; Iqbal, S.; Zoncu, R.; Chen, W.; Weinberg, R.A.; Sabatini, D.M. Stem cells. Asymmetric apportioning of aged mitochondria between daughter cells is required for stemness. Science 2015, 348, 340–343. [Google Scholar] [CrossRef] [Scilit]
  31. Russo, E.; Lee, J.Y.; Nguyen, H.; Corrao, S.; Anzalone, R.; La Rocca, G.; Borlongan, C.V. Energy Metabolism Analysis of Three Different Mesenchymal Stem Cell Populations of Umbilical Cord Under Normal and Pathologic Conditions. Stem Cell Rev. Rep. 2020, 16, 585–595. [Google Scholar] [CrossRef] [Scilit]
  32. Zampieri, L.X.; Silva-Almeida, C.; Rondeau, J.D.; Sonveaux, P. Mitochondrial Transfer in Cancer: A Comprehensive Review. Int. J. Mol. Sci. 2021, 22, 3245. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  33. Yao, Y.; Fan, X.L.; Jiang, D.; Zhang, Y.; Li, X.; Xu, Z.B.; Fang, S.B.; Chiu, S.; Tse, H.F.; Lian, Q.; et al. Connexin 43-Mediated Mitochondrial Transfer of iPSC-MSCs Alleviates Asthma Inflammation. Stem Cell Rep. 2018, 11, 1120–1135. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Melcher, M.; Danhauser, K.; Seibt, A.; Degistirici, Ö.; Baertling, F.; Kondadi, A.K.; Reichert, A.S.; Koopman, W.J.H.; Willems, P.; Rodenburg, R.J.; et al. Modulation of oxidative phosphorylation and redox homeostasis in mitochondrial NDUFS4 deficiency via mesenchymal stem cells. Stem Cell Res. Ther. 2017, 8, 150. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. Lin, F.; Xue, D.; Xie, T.; Pan, Z. HMGB1 promotes cellular chemokine synthesis and potentiates mesenchymal stromal cell migration via Rap1 activation. Mol. Med. Rep. 2016, 14, 1283–1289. [Google Scholar] [CrossRef] [Scilit]
  36. Lin, F.; Zhang, W.; Xue, D.; Zhu, T.; Li, J.; Chen, E.; Yao, X.; Pan, Z. Signaling pathways involved in the effects of HMGB1 on mesenchymal stem cell migration and osteoblastic differentiation. Int. J. Mol. Med. 2016, 37, 789–797. [Google Scholar] [CrossRef] [Scilit]
  37. Tao, X.; Sun, M.; Chen, M.; Ying, R.; Su, W.; Zhang, J.; Xie, X.; Wei, W.; Meng, X. HMGB1-modified mesenchymal stem cells attenuate radiation-induced vascular injury possibly via their high motility and facilitation of endothelial differentiation. Stem Cell Res. Ther. 2019, 10, 92. [Google Scholar] [CrossRef] [Scilit]
  38. Janko, C.; Filipović, M.; Munoz, L.E.; Schorn, C.; Schett, G.; Ivanović-Burmazović, I.; Herrmann, M. Redox modulation of HMGB1-related signaling. Antioxid. Redox Signal. 2014, 20, 1075–1085. [Google Scholar] [CrossRef] [Scilit]
  39. Srinivas, U.S.; Tan, B.W.Q.; Vellayappan, B.A.; Jeyasekharan, A.D. ROS and the DNA damage response in cancer. Redox Biol. 2019, 25, 101084. [Google Scholar] [CrossRef] [Scilit]
  40. Luo, Y.; Chihara, Y.; Fujimoto, K.; Sasahira, T.; Kuwada, M.; Fujiwara, R.; Fujii, K.; Ohmori, H.; Kuniyasu, H. High mobility group box 1 released from necrotic cells enhances regrowth and metastasis of cancer cells that have survived chemotherapy. Eur. J. Cancer 2013, 49, 741–751. [Google Scholar] [CrossRef] [Scilit]
  41. Berridge, M.V.; Schneider, R.T.; McConnell, M.J. Mitochondrial Transfer from Astrocytes to Neurons following Ischemic Insult: Guilt by Association? Cell Metab. 2016, 24, 376–378. [Google Scholar] [CrossRef] [Scilit]
  42. Kitani, T.; Kami, D.; Matoba, S.; Gojo, S. Internalization of isolated functional mitochondria: Involvement of macropinocytosis. J. Cell. Mol. Med. 2014, 18, 1694–1703. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  43. Ribeiro-Rodrigues, T.M.; Martins-Marques, T.; Morel, S.; Kwak, B.R.; Girão, H. Role of connexin 43 in different forms of intercellular communication—Gap junctions, extracellular vesicles and tunnelling nanotubes. J. Cell Sci. 2017, 130, 3619–3630. [Google Scholar] [CrossRef] [Scilit]
  44. Las, G.; Shirihai, O.S. Miro1: New wheels for transferring mitochondria. EMBO J. 2014, 33, 939–941. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  45. Golan, K.; Singh, A.K.; Kollet, O.; Bertagna, M.; Althoff, M.J.; Khatib-Massalha, E.; Petrovich-Kopitman, E.; Wellendorf, A.M.; Massalha, H.; Levin-Zaidman, S.; et al. Bone marrow regeneration requires mitochondrial transfer from donor Cx43-expressing hematopoietic progenitors to stroma. Blood 2020, 136, 2607–2619. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  46. Sinclair, K.A.; Yerkovich, S.T.; Hopkins, P.M.; Chambers, D.C. Characterization of intercellular communication and mitochondrial donation by mesenchymal stromal cells derived from the human lung. Stem Cell Res. Ther. 2016, 7, 91. [Google Scholar] [CrossRef] [Scilit]
  47. Zhang, Y.; Yu, Z.; Jiang, D.; Liang, X.; Liao, S.; Zhang, Z.; Yue, W.; Li, X.; Chiu, S.M.; Chai, Y.H.; et al. iPSC-MSCs with High Intrinsic MIRO1 and Sensitivity to TNF-α Yield Efficacious Mitochondrial Transfer to Rescue Anthracycline-Induced Cardiomyopathy. Stem Cell Rep. 2016, 7, 749–763. [Google Scholar] [CrossRef] [Scilit]
  48. Steinle, J.J. Role of HMGB1 signaling in the inflammatory process in diabetic retinopathy. Cell. Signal. 2020, 73, 109687. [Google Scholar] [CrossRef] [Scilit]
  49. Andersson, U.; Tracey, K.J. HMGB1 is a therapeutic target for sterile inflammation and infection. Annu. Rev. Immunol. 2011, 29, 139–162. [Google Scholar] [CrossRef] [Scilit]
  50. Meng, X.; Chen, M.; Su, W.; Tao, X.; Sun, M.; Zou, X.; Ying, R.; Wei, W.; Wang, B. The differentiation of mesenchymal stem cells to vascular cells regulated by the HMGB1/RAGE axis: Its application in cell therapy for transplant arteriosclerosis. Stem Cell Res. Ther. 2018, 9, 85. [Google Scholar] [CrossRef] [Scilit]
  51. Kume, S.; Kato, S.; Yamagishi, S.; Inagaki, Y.; Ueda, S.; Arima, N.; Okawa, T.; Kojiro, M.; Nagata, K. Advanced glycation end-products attenuate human mesenchymal stem cells and prevent cognate differentiation into adipose tissue, cartilage, and bone. J. Bone Miner. Res. 2005, 20, 1647–1658. [Google Scholar] [CrossRef] [Scilit]
  52. Kuniyasu, H.; Chihara, Y.; Kondo, H. Differential effects between amphoterin and advanced glycation end products on colon cancer cells. Int. J. Cancer 2003, 104, 722–727. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  53. Yokoyama, S.; Kawai, T.; Yamamoto, K.; Yibin, H.; Yamamoto, H.; Kakino, A.; Takeshita, H.; Nozato, Y.; Fujimoto, T.; Hongyo, K.; et al. RAGE ligands stimulate angiotensin II type I receptor (AT1) via RAGE/AT1 complex on the cell membrane. Sci. Rep. 2021, 11, 5759. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  54. Soundara Rajan, T.; Gugliandolo, A.; Bramanti, P.; Mazzon, E. Tunneling Nanotubes-Mediated Protection of Mesenchymal Stem Cells: An Update from Preclinical Studies. Int. J. Mol. Sci. 2020, 21, 3481. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  55. Boukelmoune, N.; Chiu, G.S.; Kavelaars, A.; Heijnen, C.J. Mitochondrial transfer from mesenchymal stem cells to neural stem cells protects against the neurotoxic effects of cisplatin. Acta Neuropathol. Commun. 2018, 6, 139. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  56. Liu, Q.; Zhang, X.; Zhu, T.; Xu, Z.; Dong, Y.; Chen, B. Mitochondrial transfer from mesenchymal stem cells: Mechanisms and functions. Mitochondrion 2024, 79, 101950. [Google Scholar] [CrossRef] [Scilit]
  57. Kuniyasu, H.; Oue, N.; Wakikawa, A.; Shigeishi, H.; Matsutani, N.; Kuraoka, K.; Ito, R.; Yokozaki, H.; Yasui, W. Expression of receptors for advanced glycation end-products (RAGE) is closely associated with the invasive and metastatic activity of gastric cancer. J. Pathol. 2002, 196, 163–170. [Google Scholar] [CrossRef] [Scilit]
Figure 1. TNT formation and MT between MSCs and CRC cells. (A) Effect of coculture of HT29 and hBM-MSCs with attached or unattached conditions. (B) Effect of coculture of CT26 and mBM-MSCs with attached or unattached conditions. (C) HMGB1 concentration in medium of 5-FU-trated CRC cells. (D,E) MSCs were cocultured with 5-FU (1.5 μg/mL)-treated CRC cells with attached condition. Green color, CT26 cells; red color, mitochondria of BM-MSCs. (D) Timelapse analysis of TNT formation of mMSC to 5FU treated-mouse CT26 CRC cell. The 10 s to 120 s panels expand the range indicated by the white square in the 0 s panel. White arrow, TNT; yellow arrow, MSC’s mitochondria in TNT; red arrow, MSC’s mitochondria in CT2t cell. (E) Timelapse analysis of MT between hMSCs and HT29 human CRC cell treated with 5FU. Right panel, temporal change in HT29 cell number containing hMSC mitochondria; i.e., mitochondrial transferred HT29 cell number. Scale bar, 10 μm. Error bar, standard deviation from three independent trials. Statistical significance was calculated by an ordinary ANOVA test. TNT: tunneling nanotube; MT: mitochondrial transfer; CRC: colorectal cancer; hMSCs: human bone marrow-derived mesenchymal stem cells; mBM-MSCs: mouse bone marrow-derived mesenchymal stem cells; 5-FU: 5-fluorouracil.
Figure 1. TNT formation and MT between MSCs and CRC cells. (A) Effect of coculture of HT29 and hBM-MSCs with attached or unattached conditions. (B) Effect of coculture of CT26 and mBM-MSCs with attached or unattached conditions. (C) HMGB1 concentration in medium of 5-FU-trated CRC cells. (D,E) MSCs were cocultured with 5-FU (1.5 μg/mL)-treated CRC cells with attached condition. Green color, CT26 cells; red color, mitochondria of BM-MSCs. (D) Timelapse analysis of TNT formation of mMSC to 5FU treated-mouse CT26 CRC cell. The 10 s to 120 s panels expand the range indicated by the white square in the 0 s panel. White arrow, TNT; yellow arrow, MSC’s mitochondria in TNT; red arrow, MSC’s mitochondria in CT2t cell. (E) Timelapse analysis of MT between hMSCs and HT29 human CRC cell treated with 5FU. Right panel, temporal change in HT29 cell number containing hMSC mitochondria; i.e., mitochondrial transferred HT29 cell number. Scale bar, 10 μm. Error bar, standard deviation from three independent trials. Statistical significance was calculated by an ordinary ANOVA test. TNT: tunneling nanotube; MT: mitochondrial transfer; CRC: colorectal cancer; hMSCs: human bone marrow-derived mesenchymal stem cells; mBM-MSCs: mouse bone marrow-derived mesenchymal stem cells; 5-FU: 5-fluorouracil.
Ijms 26 01192 g001
Figure 2. Effect of HMGB1 on mitochondrial transfer from BM-MSCs to CRC cells. (A) Fluorescence image of mitochondrial transfer from hBM-MSCs to HT29 cells and mBM-MSCs to CT26 cells. Scale bar, 50 μm. (Left) Mito Deep Red-labeled hBM-MSCs were cocultured with PKH67-labeled HT29 cells. (Right) hBM-MSC mitochondria were transferred from hBM-MSCs to PKH67-labeled HT29 cells. (B,C) The percentage of Mito Deep Red-positive CRC cells relative to all CRC cells. (D,E) TNT number in 1000 CRC cells. CRC cells were pretreated with 5-FU (1.5 μg/mL) or co-treated with 5-FU (1.5 μg/mL) and anti-HMGB1 antibody (αHMGB1, 10 μg/mL) for 48 h. CRC cells were cocultured with Mito Deep Red-labeled BM-MSCs for 6, 12, and 24 h. (F,G) Effects of coculture with BM-MSCs with 5-FU (1.5 μg/mL) and/or αHMGB1 (10 μg/mL) for 48 h on mitochondrial hydroxyradical (mtSOX) (G) and mitochondrial membrane potential (TMRE). Scale bar, 50 μm. Right panels, semi-quantification of fluorescent intensities of mtSOX and TMRE. Error bar, standard deviation from three independent trials. Statistical significance was calculated by an ordinary ANOVA test. hBM-MSCs: human bone marrow-derived mesenchymal stem cells; mBM-MSCs: mouse bone marrow-derived mesenchymal stem cells; HMGB1: high mobility group B-1; 5-FU: 5-fluorouracil; MMP: mitochondrial membrane potential; TNT: tunneling nanotube.
Figure 2. Effect of HMGB1 on mitochondrial transfer from BM-MSCs to CRC cells. (A) Fluorescence image of mitochondrial transfer from hBM-MSCs to HT29 cells and mBM-MSCs to CT26 cells. Scale bar, 50 μm. (Left) Mito Deep Red-labeled hBM-MSCs were cocultured with PKH67-labeled HT29 cells. (Right) hBM-MSC mitochondria were transferred from hBM-MSCs to PKH67-labeled HT29 cells. (B,C) The percentage of Mito Deep Red-positive CRC cells relative to all CRC cells. (D,E) TNT number in 1000 CRC cells. CRC cells were pretreated with 5-FU (1.5 μg/mL) or co-treated with 5-FU (1.5 μg/mL) and anti-HMGB1 antibody (αHMGB1, 10 μg/mL) for 48 h. CRC cells were cocultured with Mito Deep Red-labeled BM-MSCs for 6, 12, and 24 h. (F,G) Effects of coculture with BM-MSCs with 5-FU (1.5 μg/mL) and/or αHMGB1 (10 μg/mL) for 48 h on mitochondrial hydroxyradical (mtSOX) (G) and mitochondrial membrane potential (TMRE). Scale bar, 50 μm. Right panels, semi-quantification of fluorescent intensities of mtSOX and TMRE. Error bar, standard deviation from three independent trials. Statistical significance was calculated by an ordinary ANOVA test. hBM-MSCs: human bone marrow-derived mesenchymal stem cells; mBM-MSCs: mouse bone marrow-derived mesenchymal stem cells; HMGB1: high mobility group B-1; 5-FU: 5-fluorouracil; MMP: mitochondrial membrane potential; TNT: tunneling nanotube.
Ijms 26 01192 g002
Figure 3. Effect of culture supernatant on mitochondrial-transfer associated factors in BM-MSCs. (A) Expression of genes associated with mitochondria transfer (Miro1 and Cx43) in BM-MSCs. BM-MSCs were exposed to culture medium of CRC cells with or without αHMGB1 (10 μg/mL) for 48 h. CRC cells were pretreated with 5-FU (1.5 μg/mL). ACTB was used as a loading control. Right panels, semi-quantification of the signal densities in RT–PCR standardized with ACTB signal intensity. (B) Protein levels of Miro1 and Cx43 in BM-MSCs treated with same protocols. ACTB was used as a loading control. Right panels, semi-quantification of the signal densities in western blot standardized with ACTB signal intensity. Error bar, standard deviation from three independent trials. Statistical significance was calculated by an ordinary ANOVA test. hBM-MSCs: human bone marrow-derived mesenchymal stem cells; mBM-MSCs: mouse bone marrow-derived mesenchymal stem cells; 5-FU: 5-fluorouracil; CM: culture medium; HMGB1: high mobility group B-1; αHMGB1: anti-HMGB1 antibody; Miro1: mitochondrial Rho GTPase 1; Cx43: connexin43; ACTB: β-actin.
Figure 3. Effect of culture supernatant on mitochondrial-transfer associated factors in BM-MSCs. (A) Expression of genes associated with mitochondria transfer (Miro1 and Cx43) in BM-MSCs. BM-MSCs were exposed to culture medium of CRC cells with or without αHMGB1 (10 μg/mL) for 48 h. CRC cells were pretreated with 5-FU (1.5 μg/mL). ACTB was used as a loading control. Right panels, semi-quantification of the signal densities in RT–PCR standardized with ACTB signal intensity. (B) Protein levels of Miro1 and Cx43 in BM-MSCs treated with same protocols. ACTB was used as a loading control. Right panels, semi-quantification of the signal densities in western blot standardized with ACTB signal intensity. Error bar, standard deviation from three independent trials. Statistical significance was calculated by an ordinary ANOVA test. hBM-MSCs: human bone marrow-derived mesenchymal stem cells; mBM-MSCs: mouse bone marrow-derived mesenchymal stem cells; 5-FU: 5-fluorouracil; CM: culture medium; HMGB1: high mobility group B-1; αHMGB1: anti-HMGB1 antibody; Miro1: mitochondrial Rho GTPase 1; Cx43: connexin43; ACTB: β-actin.
Ijms 26 01192 g003
Figure 4. Effect of oxidized HMGB1 on mitochondrial transfer associated factors of BM-MSCs. (A) Western blotting of H2O2-treated rHMGB1 (oxHMGB1) and 2-merucaptoethanol-treated rHMGB1 (redHMGB1). (B) Effect of redox modification of HMGB1 (100 ng/mL) on MT and TNT formation in coculture of MSCs and CRC cells. (C) Expression of mitochondria transfer-associated genes (Miro1 and Cx43) in BM-MSCs treated with or without oxHMGB1 (100 ng/mL) for 48 h. ACTB was used as a loading control. Right panels, semi-quantification of the signal intensities in RT–PCR standardized with ACTB signal intensity. (D) Protein levels of Miro1 and Cx43. ACTB was used as a loading control. Right panels, semi-quantification of the signal intensities in western blot standardized with ACTB signal intensity. Error bar, standard deviation from three independent trials. Statistical significance was calculated by an ordinary ANOVA test. MSC: mesenchymal stem cell; MT: mitochondrial transfer; TNT: tunneling nanotube; hBM-MSCs: human bone marrow-derived mesenchymal stem cells; mBM-MSCs: mouse bone marrow-derived mesenchymal stem cells; HMGB1: high mobility group B-1; rHMGB1: recombinant HMGB1; oxHMGB1: oxidized HMGB1; redHMGB1: reduced HMGB1; Miro1: mitochondrial Rho GTPase 1; Cx43: connexin43; ACTB: β-actin.
Figure 4. Effect of oxidized HMGB1 on mitochondrial transfer associated factors of BM-MSCs. (A) Western blotting of H2O2-treated rHMGB1 (oxHMGB1) and 2-merucaptoethanol-treated rHMGB1 (redHMGB1). (B) Effect of redox modification of HMGB1 (100 ng/mL) on MT and TNT formation in coculture of MSCs and CRC cells. (C) Expression of mitochondria transfer-associated genes (Miro1 and Cx43) in BM-MSCs treated with or without oxHMGB1 (100 ng/mL) for 48 h. ACTB was used as a loading control. Right panels, semi-quantification of the signal intensities in RT–PCR standardized with ACTB signal intensity. (D) Protein levels of Miro1 and Cx43. ACTB was used as a loading control. Right panels, semi-quantification of the signal intensities in western blot standardized with ACTB signal intensity. Error bar, standard deviation from three independent trials. Statistical significance was calculated by an ordinary ANOVA test. MSC: mesenchymal stem cell; MT: mitochondrial transfer; TNT: tunneling nanotube; hBM-MSCs: human bone marrow-derived mesenchymal stem cells; mBM-MSCs: mouse bone marrow-derived mesenchymal stem cells; HMGB1: high mobility group B-1; rHMGB1: recombinant HMGB1; oxHMGB1: oxidized HMGB1; redHMGB1: reduced HMGB1; Miro1: mitochondrial Rho GTPase 1; Cx43: connexin43; ACTB: β-actin.
Ijms 26 01192 g004
Figure 5. Effects of NF–κB inhibitor on mitochondrial function in CRC cells and mitochondrial transfer associated factors in BM-MSCs. (A) RT–PCR of RAGE and TLR4 as receptors for HMGB1 in BM-MSCs. (B,C) MtROS (B) and MMP (C) of CRC cells were examined. CRC cells were pretreated with or without 5-FU (1.5 μg/mL) for 48 h and cocultured with hBM-MSCs and then treated with or without a NF–κB inhibitor, JSH-23 (20 μM) for 24 h. (D,E) Expression of mitochondria transfer-associated genes (Miro1 and Cx43) in BM-MSCs. hBM-MSCs (D) and mBM-MSCs (E). BM-MSCs were exposed to culture medium of 5-FU (1.5 μg/mL)-pretreated CRC cells and treated with or without JSH-23 (20 μM) for 48 h. GAPDH was used as a loading control. Right panels, Semi-quantification of the signal densities in RT–PCR standardized with GAPDH signal intensity. Error bar, standard deviation from three independent trials. Statistical significance was calculated by an ordinary ANOVA test. hBM-MSCs: human bone marrow-derived mesenchymal stem cells; mBM-MSCs: mouse bone marrow-derived mesenchymal stem cells; RAGE: receptor for advanced glycation end products; TLR4: toll-like receptor 4; mtROS: mitochondrial reactive oxidative species; mtSOX: mitochondrial hydroxyradical; MMP: mitochondrial membrane potential; TMRE: tetramethyl rhodamine; 5-FU: 5-fluorouracil; GAPDH: glyceraldehyde-3-phosphate dehydrogenase.
Figure 5. Effects of NF–κB inhibitor on mitochondrial function in CRC cells and mitochondrial transfer associated factors in BM-MSCs. (A) RT–PCR of RAGE and TLR4 as receptors for HMGB1 in BM-MSCs. (B,C) MtROS (B) and MMP (C) of CRC cells were examined. CRC cells were pretreated with or without 5-FU (1.5 μg/mL) for 48 h and cocultured with hBM-MSCs and then treated with or without a NF–κB inhibitor, JSH-23 (20 μM) for 24 h. (D,E) Expression of mitochondria transfer-associated genes (Miro1 and Cx43) in BM-MSCs. hBM-MSCs (D) and mBM-MSCs (E). BM-MSCs were exposed to culture medium of 5-FU (1.5 μg/mL)-pretreated CRC cells and treated with or without JSH-23 (20 μM) for 48 h. GAPDH was used as a loading control. Right panels, Semi-quantification of the signal densities in RT–PCR standardized with GAPDH signal intensity. Error bar, standard deviation from three independent trials. Statistical significance was calculated by an ordinary ANOVA test. hBM-MSCs: human bone marrow-derived mesenchymal stem cells; mBM-MSCs: mouse bone marrow-derived mesenchymal stem cells; RAGE: receptor for advanced glycation end products; TLR4: toll-like receptor 4; mtROS: mitochondrial reactive oxidative species; mtSOX: mitochondrial hydroxyradical; MMP: mitochondrial membrane potential; TMRE: tetramethyl rhodamine; 5-FU: 5-fluorouracil; GAPDH: glyceraldehyde-3-phosphate dehydrogenase.
Ijms 26 01192 g005
Figure 6. Effect of artificial mitochondria transfer (mitoception) on metabolism of CRC cells. (A) FACS analysis of HT29 cells mitocepted with increasing amounts of hBM-MSCs-derived mitochondria. hBM-MSCs mitochondria were labeled with MitoBright LT Green. Right panel, relationship between loaded mitochondrial amounts and transferred mitochondrial fluorescent intensities. (B) Effect of hBM-MSCs coculture or mitoception on 5-FU sensitivity of HT29 cells. (C) Sensitivities to 5FU and CDDP of HT29 cells cocultured with hMSCs. Cell viability was determined by counting the number of cells after treatment with different concentrations of 5-FU or CDDP for 48 h (B,C). Insert, MT-positive cell (%). (D) Effect of mitoception on mtROS and MMP. Right panel, semi-quantification of fluorescent intensities. (E) Effect of mitoception on OXPHOS. Error bar, standard deviation from three independent trials. Statistical significance was calculated by an ordinary ANOVA test. FACS: fluorescence-activated cell sorting; MFI: mean fluorescence intensity; hBM-MSCs: human bone marrow-derived mesenchymal stem cells; 5-FU: 5-fluorouracil; ROS: reactive oxidative species; mtSOX: mitochondrial hydroxyradical; MMP: mitochondrial membrane potential; TMRE: tetramethyl rhodamine; OXPHOS: oxidative stress; OCR: oxygen consumption rate; Max: maximum; CDDP: cisplatin; MT: mitotransfer; hMSC: human bone marrow mesenchymal stem cells.
Figure 6. Effect of artificial mitochondria transfer (mitoception) on metabolism of CRC cells. (A) FACS analysis of HT29 cells mitocepted with increasing amounts of hBM-MSCs-derived mitochondria. hBM-MSCs mitochondria were labeled with MitoBright LT Green. Right panel, relationship between loaded mitochondrial amounts and transferred mitochondrial fluorescent intensities. (B) Effect of hBM-MSCs coculture or mitoception on 5-FU sensitivity of HT29 cells. (C) Sensitivities to 5FU and CDDP of HT29 cells cocultured with hMSCs. Cell viability was determined by counting the number of cells after treatment with different concentrations of 5-FU or CDDP for 48 h (B,C). Insert, MT-positive cell (%). (D) Effect of mitoception on mtROS and MMP. Right panel, semi-quantification of fluorescent intensities. (E) Effect of mitoception on OXPHOS. Error bar, standard deviation from three independent trials. Statistical significance was calculated by an ordinary ANOVA test. FACS: fluorescence-activated cell sorting; MFI: mean fluorescence intensity; hBM-MSCs: human bone marrow-derived mesenchymal stem cells; 5-FU: 5-fluorouracil; ROS: reactive oxidative species; mtSOX: mitochondrial hydroxyradical; MMP: mitochondrial membrane potential; TMRE: tetramethyl rhodamine; OXPHOS: oxidative stress; OCR: oxygen consumption rate; Max: maximum; CDDP: cisplatin; MT: mitotransfer; hMSC: human bone marrow mesenchymal stem cells.
Ijms 26 01192 g006
Figure 7. Effect of artificial mitochondria transfer (mitoception) on stemness of CRC cells. (A) Effect of mitoception on sphere formation in HT29 cells. Sphere formation was examined in 10,000 cells for 7 days. Pictures were images of phase-contrast microscopy. Scale bar, 300 μm. Right panel, number of spheres was counted with microscopy at 7 days. (B) Expression of stemness-associated genes (Sox2, CD44, LGR5, and KLF4). GAPDH expression was used as a loading control. Right panel, semi-quantification of the signal densities in RT–PCR standardized with GAPDH signal intensity. (C) Tumorigenicity of HT29 cells with mitoception. Cells were inoculated subcutaneously in mice. Error bar, standard deviation from three independent trials. Statistical differences were calculated by an ordinary ANOVA test with Bonferroni correlation from five mice. hBM-MSCs: human bone marrow-derived mesenchymal stem cells; 5-FU: 5-fluorouracil; GAPDH: glyceraldehyde-3-phosphate dehydrogenase, SOX2: sex determining region Y box 2; LGR5: leucine-rich repeat-containing G-protein coupled receptor 5; KLF4: Krüppel-like factor 4.
Figure 7. Effect of artificial mitochondria transfer (mitoception) on stemness of CRC cells. (A) Effect of mitoception on sphere formation in HT29 cells. Sphere formation was examined in 10,000 cells for 7 days. Pictures were images of phase-contrast microscopy. Scale bar, 300 μm. Right panel, number of spheres was counted with microscopy at 7 days. (B) Expression of stemness-associated genes (Sox2, CD44, LGR5, and KLF4). GAPDH expression was used as a loading control. Right panel, semi-quantification of the signal densities in RT–PCR standardized with GAPDH signal intensity. (C) Tumorigenicity of HT29 cells with mitoception. Cells were inoculated subcutaneously in mice. Error bar, standard deviation from three independent trials. Statistical differences were calculated by an ordinary ANOVA test with Bonferroni correlation from five mice. hBM-MSCs: human bone marrow-derived mesenchymal stem cells; 5-FU: 5-fluorouracil; GAPDH: glyceraldehyde-3-phosphate dehydrogenase, SOX2: sex determining region Y box 2; LGR5: leucine-rich repeat-containing G-protein coupled receptor 5; KLF4: Krüppel-like factor 4.
Ijms 26 01192 g007
Figure 8. Effect of inhibition of MT in mouse subcutaneous tumor model. (A) Experimental protocol. 5-FU (30 mg/kg BW), and αHMGB1 (5 μg/mouse) [22] or NF–κB-I (JSH-23, 20 mg/kg BW) [23] were administered intraperitoneally twice a week. (B,C) Effect of MT inhibition on tumor growth; time course (B) and tumor volume at 4 weeks after inoculation (C) Right panel, loupe images of the maximum cut surface of representative tumors stained with hematoxylin and eosin. Scale bar, 1 cm. (D) Immunohistochemistry of CD73 and SOX2 in tumors. Scale bar, 50 μm. (E,F) Contents of mBM-MSC-related proteins, CD73 (E) and SOX (F) in tumor tissues. (G) Contents of ROS levels (4HNE). s. Error bar, standard deviation from five mice. Statistical differences were calculated by an ordinary ANOVA test with Bonferroni correlation. Miro1: mitochondrial Rho GTPase 1; SOX2: sex determining region Y box 2; MT: mitochondrial transfer; 4HNE: 4-hydroxynonenal; αHMGB1: anti-high mobility group box-1 antibody; 5-FU: 5-fluorouracil; NF–κB-I: nuclear factor–κB inhibitor, JSH-23.
Figure 8. Effect of inhibition of MT in mouse subcutaneous tumor model. (A) Experimental protocol. 5-FU (30 mg/kg BW), and αHMGB1 (5 μg/mouse) [22] or NF–κB-I (JSH-23, 20 mg/kg BW) [23] were administered intraperitoneally twice a week. (B,C) Effect of MT inhibition on tumor growth; time course (B) and tumor volume at 4 weeks after inoculation (C) Right panel, loupe images of the maximum cut surface of representative tumors stained with hematoxylin and eosin. Scale bar, 1 cm. (D) Immunohistochemistry of CD73 and SOX2 in tumors. Scale bar, 50 μm. (E,F) Contents of mBM-MSC-related proteins, CD73 (E) and SOX (F) in tumor tissues. (G) Contents of ROS levels (4HNE). s. Error bar, standard deviation from five mice. Statistical differences were calculated by an ordinary ANOVA test with Bonferroni correlation. Miro1: mitochondrial Rho GTPase 1; SOX2: sex determining region Y box 2; MT: mitochondrial transfer; 4HNE: 4-hydroxynonenal; αHMGB1: anti-high mobility group box-1 antibody; 5-FU: 5-fluorouracil; NF–κB-I: nuclear factor–κB inhibitor, JSH-23.
Ijms 26 01192 g008
Figure 9. Effect of in vivo MT on CT26 cells in mice with Miro1-knockdown. (A) Experimental protocol. BALB/c mice were transplanted with Miro1-KD and mitochondria labeled BM cells (KD-mice) or mitochondria labeled BM cells (C-mice). CT26 cells were inoculated subcutaneously into KD- or C-mice. From the tumors, CT26 cells were isolated at 4 weeks after inoculation. (B) Effect of Miro1-KD on tumor growth. Left panel, loupe images of the maximum cut surface of representative tumors in each group (hematoxylin and eosin staining). Scale bar, 1 cm. (C) Fluorescent intensity in transplanted BM cells, CT26 cells isolated from KD- or c-mice in comparison with those in parental CT26 cells. Left panels, representative fluorescence images of CT26 tumors. Scale bar, 50 μm. (DH) Effect of Miro1-KD on stem cell phenotypes in CT26 cells isolated from KD- or c-mice. Expression of stemness-associated genes, NS and Lgr5 (D), apoptosis; Right panel, PARP cleavage by western blot analysis, (E), sphere formation (F), 5-FU sensitivity (G), and tumorigenicity (H). Right panel, loupe images of the maximum cut surface of representative tumors in 1 × 104-inoculated group stained with hematoxylin and eosin. Scale bar, 1 cm. Error bar, standard deviation from five mice. Statistical differences were calculated by an ordinary ANOVA test with Bonferroni correlation. BM: bone marrow; C-mice: mice whose BM replaced with mitochondria labeled BM cells; KD-mice: mice whose BM replaced with Miro1-KD and mitochondria labeled BM cells; MSC: mesenchymal stem cells; Miro1: mitochondrial Rho GTPase 1; NS: nucleostemin; Lgr5: leucine-rich repeat-containing G-protein coupled receptor 5; KD: knockdown by siRNA; parent: parental CT26 cells without inoculation.
Figure 9. Effect of in vivo MT on CT26 cells in mice with Miro1-knockdown. (A) Experimental protocol. BALB/c mice were transplanted with Miro1-KD and mitochondria labeled BM cells (KD-mice) or mitochondria labeled BM cells (C-mice). CT26 cells were inoculated subcutaneously into KD- or C-mice. From the tumors, CT26 cells were isolated at 4 weeks after inoculation. (B) Effect of Miro1-KD on tumor growth. Left panel, loupe images of the maximum cut surface of representative tumors in each group (hematoxylin and eosin staining). Scale bar, 1 cm. (C) Fluorescent intensity in transplanted BM cells, CT26 cells isolated from KD- or c-mice in comparison with those in parental CT26 cells. Left panels, representative fluorescence images of CT26 tumors. Scale bar, 50 μm. (DH) Effect of Miro1-KD on stem cell phenotypes in CT26 cells isolated from KD- or c-mice. Expression of stemness-associated genes, NS and Lgr5 (D), apoptosis; Right panel, PARP cleavage by western blot analysis, (E), sphere formation (F), 5-FU sensitivity (G), and tumorigenicity (H). Right panel, loupe images of the maximum cut surface of representative tumors in 1 × 104-inoculated group stained with hematoxylin and eosin. Scale bar, 1 cm. Error bar, standard deviation from five mice. Statistical differences were calculated by an ordinary ANOVA test with Bonferroni correlation. BM: bone marrow; C-mice: mice whose BM replaced with mitochondria labeled BM cells; KD-mice: mice whose BM replaced with Miro1-KD and mitochondria labeled BM cells; MSC: mesenchymal stem cells; Miro1: mitochondrial Rho GTPase 1; NS: nucleostemin; Lgr5: leucine-rich repeat-containing G-protein coupled receptor 5; KD: knockdown by siRNA; parent: parental CT26 cells without inoculation.
Ijms 26 01192 g009
Table 1. Primer sets, antibodies, and ELISA kits.
Table 1. Primer sets, antibodies, and ELISA kits.
Gene SymbolSpeciesAccession IDUpperLower
ACTBMouseNM_007393.5agccatgtacgtagccatccctctcagctgtggtggtgaa
ACTBHumanNM_001101.3ggacttcgagcaagagatggagcactgtgttggcgtacag
GAPDHHumanBC025925.1gagtcaacggatttggtcgtttgattttggagggatctcg
GAPDHMouseNM_001289726.1aactttggcattgtggaaggacacattgggggtaggaaca
Miro1HumanBC125105.1cctgtactgcccagaggagactgtcagccacaccatcact
miro1MouseXM_021212699.2ccggttacgctgcatgtgcaggcaaagcccacaactgcga
Cx43HumanM65188.1atgagcagtctgcctttcgttctgcttcaagtgcatgtcc
cx43MouseM63801.1atcgcgtgaagggaagaagcctcgctggcttgcttgttgt
RageHumanAB036432.1gctgtcagcatcagcatcatattcagttctgcacgctcct
RageMouseL33412.1aattgtggatcctgcctctgaaggtaggatgggtggttcc
TLR4HumanAB445638.1cctgtccctgaaccctatgaccagaaccaaacgatggact
TLR4MouseAF177767.1gctttcacctctgccttcacgaaactgccatgtttgagca
LGR5MouseNM_010195.2cattcacttttggccgttttagggccaacaggacacatag
LGR5HumanAF061444.1ctcttcctcaaaccgtctgcgatcggaggctaagcaactg
Sox2HumanNM_003106.4aaccccaagatgcacaactccggggccggtatttataatc
CD44HumanFJ216964.1aaggtggagcaaacacaaccagctttttcttctgcccaca
Klf4HumanKJ901962.1cccacacaggtgagaaacctcccacacaggtgagaaacct
NSMouseBC037996.1atgtggggaaaagcagtgtctgggggagttacaaggtgag
Antibodies
Miro1CL1083ab188029Abcam, Cambridge, MA, USA
NFκBp65D14E12#8242Cell Signaling Technology, Danvers, MA, USA
HMGB13E8651402Biolegend, San Diego, CA, USA
PARP-GTX132329GeneTex, Irvine, CA, USA
β-actinC4sc-47778Santa Cruz Biotechnology, Santa Cruz, CA, USA
GAPDH1E6D960004-1-IgProteintech, Tokyo, Japan
ELISA
TargetSpeciesCatalog numberCompany
CD74MouseELM-CD74-1RayBiotech, Peachtree Corners, GA, USA
SOX2MouseLS-F14527LS Bio, Shirley, MA, USA
4HNE-ab238538Abcam, Cambridge, MA, USA
ACTB: β-actin; RAGE: receptor for advanced end products; TLR4: toll-like receptor 4; Miro1: mitochondrial Rho GTPase 1; Cx43: connexin 43; Sox2: sex determining region Y box 2; LGR5: leucine-rich repeat-containing G-protein coupled receptor 5; KLF4: Krüppel-like factor 4; GAPDH: glyceraldehyde 3-phosphate dehydrogenase; HMGB1: high mobility group box-1; PARP: poly ADP–ribose polymerase; NFκB: nuclear factor–κB; 4HNE: 4-hydroxynonenal.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Sasaki, R.; Luo, Y.; Kishi, S.; Ogata, R.; Nishiguchi, Y.; Sasaki, T.; Ohmori, H.; Fujiwara-Tani, R.; Kuniyasu, H. Oxidative High Mobility Group Box-1 Accelerates Mitochondrial Transfer from Mesenchymal Stem Cells to Colorectal Cancer Cells Providing Cancer Cell Stemness. Int. J. Mol. Sci. 2025, 26, 1192. https://doi.org/10.3390/ijms26031192

AMA Style

Sasaki R, Luo Y, Kishi S, Ogata R, Nishiguchi Y, Sasaki T, Ohmori H, Fujiwara-Tani R, Kuniyasu H. Oxidative High Mobility Group Box-1 Accelerates Mitochondrial Transfer from Mesenchymal Stem Cells to Colorectal Cancer Cells Providing Cancer Cell Stemness. International Journal of Molecular Sciences. 2025; 26(3):1192. https://doi.org/10.3390/ijms26031192

Chicago/Turabian Style

Sasaki, Rika, Yi Luo, Shingo Kishi, Ruiko Ogata, Yukiko Nishiguchi, Takamitsu Sasaki, Hitoshi Ohmori, Rina Fujiwara-Tani, and Hiroki Kuniyasu. 2025. "Oxidative High Mobility Group Box-1 Accelerates Mitochondrial Transfer from Mesenchymal Stem Cells to Colorectal Cancer Cells Providing Cancer Cell Stemness" International Journal of Molecular Sciences 26, no. 3: 1192. https://doi.org/10.3390/ijms26031192

APA Style

Sasaki, R., Luo, Y., Kishi, S., Ogata, R., Nishiguchi, Y., Sasaki, T., Ohmori, H., Fujiwara-Tani, R., & Kuniyasu, H. (2025). Oxidative High Mobility Group Box-1 Accelerates Mitochondrial Transfer from Mesenchymal Stem Cells to Colorectal Cancer Cells Providing Cancer Cell Stemness. International Journal of Molecular Sciences, 26(3), 1192. https://doi.org/10.3390/ijms26031192

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop