Oxidative High Mobility Group Box-1 Accelerates Mitochondrial Transfer from Mesenchymal Stem Cells to Colorectal Cancer Cells Providing Cancer Cell Stemness
Abstract
1. Introduction
2. Results
2.1. Effect of HMGB1 on MT
2.2. Effect of CRC Cell Cultured Medium (CM) on BM-MSCs
2.3. Effect of oxHMGB1 on MT
2.4. Effects of NF–κB Suppression on MT
2.5. Significance of MT in CRC Cells
2.6. Effects of MT Inhibition in a Mouse Subcutaneous Tumor Model
2.7. Effect of In Vivo MT on CRC Cells in Miro1-Knockdown Mice
3. Discussion
4. Materials and Methods
4.1. Cell Lines and Reagents
4.2. Mouse BM-MSC (mBM-MSC) Preparation
4.3. Coculture of CRC Cells with BM-MSCs
4.4. Cell Count
4.5. Mitoception
4.6. Sphere Assay
4.7. Mitochondrial Imaging
4.8. Reverse Transcription–PCR (RT–PCR)
4.9. Protein Extraction
4.10. Immunoblot Analysis
4.11. Flow Cytometry
4.12. Animal Model
4.13. Subcutaneous Tumor Model
4.14. Bone Marrow Replacement Model
4.15. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
References
- Wakao, F. CANCER STATISTICS IN JAPAN 2023. Available online: https://ganjoho.jp/public/qa_links/report/statistics/2023_jp.html (accessed on 1 December 2024).
- Pugh, S.A.; Shinkins, B.; Fuller, A.; Mellor, J.; Mant, D.; Primrose, J.N. Site and Stage of Colorectal Cancer Influence the Likelihood and Distribution of Disease Recurrence and Postrecurrence Survival: Data From the FACS Randomized Controlled Trial. Ann. Surg. 2016, 263, 1143–1147. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Maley, C.C.; Aktipis, A.; Graham, T.A.; Sottoriva, A.; Boddy, A.M.; Janiszewska, M.; Silva, A.S.; Gerlinger, M.; Yuan, Y.; Pienta, K.J.; et al. Classifying the evolutionary and ecological features of neoplasms. Nat. Rev. Cancer 2017, 17, 605–619. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kishi, S.; Fujiwara-Tani, R.; Honoki, K.; Sasaki, R.; Mori, S.; Ohmori, H.; Sasaki, T.; Miyagawa, Y.; Kawahara, I.; Kido, A.; et al. Oxidized high mobility group B-1 enhances metastability of colorectal cancer via modification of mesenchymal stem/stromal cells. Cancer Sci. 2022, 113, 2904–2915. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- François, S.; Usunier, B.; Forgue-Lafitte, M.E.; L’Homme, B.; Benderitter, M.; Douay, L.; Gorin, N.C.; Larsen, A.K.; Chapel, A. Mesenchymal Stem Cell Administration Attenuates Colon Cancer Progression by Modulating the Immune Component within the Colorectal Tumor Microenvironment. Stem Cells Transl. Med. 2019, 8, 285–300. [Google Scholar] [CrossRef] [Scilit]
- Hogan, N.M.; Dwyer, R.M.; Joyce, M.R.; Kerin, M.J. Mesenchymal stem cells in the colorectal tumor microenvironment: Recent progress and implications. Int. J. Cancer 2012, 131, 1–7. [Google Scholar] [CrossRef] [Scilit]
- Torralba, D.; Baixauli, F.; Sánchez-Madrid, F. Mitochondria Know No Boundaries: Mechanisms and Functions of Intercellular Mitochondrial Transfer. Front. Cell Dev. Biol. 2016, 4, 107. [Google Scholar] [CrossRef] [Scilit]
- Clemente-Suárez, V.J.; Martín-Rodríguez, A.; Yáñez-Sepúlveda, R.; Tornero-Aguilera, J.F. Mitochondrial Transfer as a Novel Therapeutic Approach in Disease Diagnosis and Treatment. Int. J. Mol. Sci. 2023, 24, 8848. [Google Scholar] [CrossRef] [Scilit]
- Wang, J.; Liu, X.; Qiu, Y.; Shi, Y.; Cai, J.; Wang, B.; Wei, X.; Ke, Q.; Sui, X.; Wang, Y.; et al. Cell adhesion-mediated mitochondria transfer contributes to mesenchymal stem cell-induced chemoresistance on T cell acute lymphoblastic leukemia cells. J. Hematol. Oncol. 2018, 11, 11. [Google Scholar] [CrossRef] [Scilit]
- Mohammadalipour, A.; Dumbali, S.P.; Wenzel, P.L. Mitochondrial Transfer and Regulators of Mesenchymal Stromal Cell Function and Therapeutic Efficacy. Front. Cell Dev. Biol. 2020, 8, 603292. [Google Scholar] [CrossRef] [Scilit]
- Scaffidi, P.; Misteli, T.; Bianchi, M.E. Release of chromatin protein HMGB1 by necrotic cells triggers inflammation. Nature 2002, 418, 191–195. [Google Scholar] [CrossRef] [Scilit]
- Ohmori, H.; Luo, Y.; Kuniyasu, H. Non-histone nuclear factor HMGB1 as a therapeutic target in colorectal cancer. Expert Opin. Ther. Targets 2011, 15, 183–193. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tang, D.; Billiar, T.R.; Lotze, M.T. A Janus tale of two active high mobility group box 1 (HMGB1) redox states. Mol. Med. 2012, 18, 1360–1362. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, H.; Lundbäck, P.; Ottosson, L.; Erlandsson-Harris, H.; Venereau, E.; Bianchi, M.E.; Al-Abed, Y.; Andersson, U.; Tracey, K.J. Redox modifications of cysteine residues regulate the cytokine activity of HMGB1. Mol. Med. 2021, 27, 58. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tang, Y.; Zhao, X.; Antoine, D.; Xiao, X.; Wang, H.; Andersson, U.; Billiar, T.R.; Tracey, K.J.; Lu, B. Regulation of Posttranslational Modifications of HMGB1 During Immune Responses. Antioxid. Redox Signal. 2016, 24, 620–634. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schwarz, T.L. Mitochondrial trafficking in neurons. Cold Spring Harb. Perspect. Biol. 2013, 5, a011304. [Google Scholar] [CrossRef] [Scilit]
- Bonacquisti, E.E.; Nguyen, J. Connexin 43 (Cx43) in cancer: Implications for therapeutic approaches via gap junctions. Cancer Lett. 2019, 442, 439–444. [Google Scholar] [CrossRef] [Scilit]
- Ahmad, T.; Mukherjee, S.; Pattnaik, B.; Kumar, M.; Singh, S.; Kumar, M.; Rehman, R.; Tiwari, B.K.; Jha, K.A.; Barhanpurkar, A.P.; et al. Miro1 regulates intercellular mitochondrial transport & enhances mesenchymal stem cell rescue efficacy. EMBO J. 2014, 33, 994–1010. [Google Scholar] [CrossRef] [Scilit]
- Kwak, M.S.; Kim, H.S.; Lkhamsuren, K.; Kim, Y.H.; Han, M.G.; Shin, J.M.; Park, I.H.; Rhee, W.J.; Lee, S.K.; Rhee, S.G.; et al. Peroxiredoxin-mediated disulfide bond formation is required for nucleocytoplasmic translocation and secretion of HMGB1 in response to inflammatory stimuli. Redox Biol. 2019, 24, 101203. [Google Scholar] [CrossRef] [Scilit]
- Behl, T.; Sharma, E.; Sehgal, A.; Kaur, I.; Kumar, A.; Arora, R.; Pal, G.; Kakkar, M.; Kumar, R.; Bungau, S. Expatiating the molecular approaches of HMGB1 in diabetes mellitus: Highlighting signalling pathways via RAGE and TLRs. Mol. Biol. Rep. 2021, 48, 1869–1881. [Google Scholar] [CrossRef] [Scilit]
- Caicedo, A.; Fritz, V.; Brondello, J.M.; Ayala, M.; Dennemont, I.; Abdellaoui, N.; de Fraipont, F.; Moisan, A.; Prouteau, C.A.; Boukhaddaoui, H.; et al. MitoCeption as a new tool to assess the effects of mesenchymal stem/stromal cell mitochondria on cancer cell metabolism and function. Sci. Rep. 2015, 5, 9073. [Google Scholar] [CrossRef] [Scilit]
- Luo, Y.; Yoneda, J.; Ohmori, H.; Sasaki, T.; Shimbo, K.; Eto, S.; Kato, Y.; Miyano, H.; Kobayashi, T.; Sasahira, T.; et al. Cancer usurps skeletal muscle as an energy repository. Cancer Res. 2014, 74, 330–340. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ozkok, A.; Ravichandran, K.; Wang, Q.; Ljubanovic, D.; Edelstein, C.L. NF-κB transcriptional inhibition ameliorates cisplatin-induced acute kidney injury (AKI). Toxicol. Lett. 2016, 240, 105–113. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sancho, P.; Burgos-Ramos, E.; Tavera, A.; Bou Kheir, T.; Jagust, P.; Schoenhals, M.; Barneda, D.; Sellers, K.; Campos-Olivas, R.; Graña, O.; et al. MYC/PGC-1α Balance Determines the Metabolic Phenotype and Plasticity of Pancreatic Cancer Stem Cells. Cell Metab. 2015, 22, 590–605. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Grasso, D.; Zampieri, L.X.; Capelôa, T.; Van de Velde, J.A.; Sonveaux, P. Mitochondria in cancer. Cell Stress 2020, 4, 114–146. [Google Scholar] [CrossRef] [Scilit]
- Folmes, C.D.; Ma, H.; Mitalipov, S.; Terzic, A. Mitochondria in pluripotent stem cells: Stemness regulators and disease targets. Curr. Opin. Genet Dev. 2016, 38, 1–7. [Google Scholar] [CrossRef] [Scilit]
- Raggi, C.; Taddei, M.L.; Sacco, E.; Navari, N.; Correnti, M.; Piombanti, B.; Pastore, M.; Campani, C.; Pranzini, E.; Iorio, J.; et al. Mitochondrial oxidative metabolism contributes to a cancer stem cell phenotype in cholangiocarcinoma. J. Hepatol. 2021, 74, 1373–1385. [Google Scholar] [CrossRef] [Scilit]
- Carbognin, E.; Betto, R.M.; Soriano, M.E.; Smith, A.G.; Martello, G. Stat3 promotes mitochondrial transcription and oxidative respiration during maintenance and induction of naive pluripotency. EMBO J. 2016, 35, 618–634. [Google Scholar] [CrossRef] [Scilit]
- Döhla, J.; Kuuluvainen, E.; Gebert, N.; Amaral, A.; Englund, J.I.; Gopalakrishnan, S.; Konovalova, S.; Nieminen, A.I.; Salminen, E.S.; Torregrosa Muñumer, R.; et al. Metabolic determination of cell fate through selective inheritance of mitochondria. Nat. Cell Biol. 2022, 24, 148–154. [Google Scholar] [CrossRef] [Scilit]
- Katajisto, P.; Döhla, J.; Chaffer, C.L.; Pentinmikko, N.; Marjanovic, N.; Iqbal, S.; Zoncu, R.; Chen, W.; Weinberg, R.A.; Sabatini, D.M. Stem cells. Asymmetric apportioning of aged mitochondria between daughter cells is required for stemness. Science 2015, 348, 340–343. [Google Scholar] [CrossRef] [Scilit]
- Russo, E.; Lee, J.Y.; Nguyen, H.; Corrao, S.; Anzalone, R.; La Rocca, G.; Borlongan, C.V. Energy Metabolism Analysis of Three Different Mesenchymal Stem Cell Populations of Umbilical Cord Under Normal and Pathologic Conditions. Stem Cell Rev. Rep. 2020, 16, 585–595. [Google Scholar] [CrossRef] [Scilit]
- Zampieri, L.X.; Silva-Almeida, C.; Rondeau, J.D.; Sonveaux, P. Mitochondrial Transfer in Cancer: A Comprehensive Review. Int. J. Mol. Sci. 2021, 22, 3245. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yao, Y.; Fan, X.L.; Jiang, D.; Zhang, Y.; Li, X.; Xu, Z.B.; Fang, S.B.; Chiu, S.; Tse, H.F.; Lian, Q.; et al. Connexin 43-Mediated Mitochondrial Transfer of iPSC-MSCs Alleviates Asthma Inflammation. Stem Cell Rep. 2018, 11, 1120–1135. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Melcher, M.; Danhauser, K.; Seibt, A.; Degistirici, Ö.; Baertling, F.; Kondadi, A.K.; Reichert, A.S.; Koopman, W.J.H.; Willems, P.; Rodenburg, R.J.; et al. Modulation of oxidative phosphorylation and redox homeostasis in mitochondrial NDUFS4 deficiency via mesenchymal stem cells. Stem Cell Res. Ther. 2017, 8, 150. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lin, F.; Xue, D.; Xie, T.; Pan, Z. HMGB1 promotes cellular chemokine synthesis and potentiates mesenchymal stromal cell migration via Rap1 activation. Mol. Med. Rep. 2016, 14, 1283–1289. [Google Scholar] [CrossRef] [Scilit]
- Lin, F.; Zhang, W.; Xue, D.; Zhu, T.; Li, J.; Chen, E.; Yao, X.; Pan, Z. Signaling pathways involved in the effects of HMGB1 on mesenchymal stem cell migration and osteoblastic differentiation. Int. J. Mol. Med. 2016, 37, 789–797. [Google Scholar] [CrossRef] [Scilit]
- Tao, X.; Sun, M.; Chen, M.; Ying, R.; Su, W.; Zhang, J.; Xie, X.; Wei, W.; Meng, X. HMGB1-modified mesenchymal stem cells attenuate radiation-induced vascular injury possibly via their high motility and facilitation of endothelial differentiation. Stem Cell Res. Ther. 2019, 10, 92. [Google Scholar] [CrossRef] [Scilit]
- Janko, C.; Filipović, M.; Munoz, L.E.; Schorn, C.; Schett, G.; Ivanović-Burmazović, I.; Herrmann, M. Redox modulation of HMGB1-related signaling. Antioxid. Redox Signal. 2014, 20, 1075–1085. [Google Scholar] [CrossRef] [Scilit]
- Srinivas, U.S.; Tan, B.W.Q.; Vellayappan, B.A.; Jeyasekharan, A.D. ROS and the DNA damage response in cancer. Redox Biol. 2019, 25, 101084. [Google Scholar] [CrossRef] [Scilit]
- Luo, Y.; Chihara, Y.; Fujimoto, K.; Sasahira, T.; Kuwada, M.; Fujiwara, R.; Fujii, K.; Ohmori, H.; Kuniyasu, H. High mobility group box 1 released from necrotic cells enhances regrowth and metastasis of cancer cells that have survived chemotherapy. Eur. J. Cancer 2013, 49, 741–751. [Google Scholar] [CrossRef] [Scilit]
- Berridge, M.V.; Schneider, R.T.; McConnell, M.J. Mitochondrial Transfer from Astrocytes to Neurons following Ischemic Insult: Guilt by Association? Cell Metab. 2016, 24, 376–378. [Google Scholar] [CrossRef] [Scilit]
- Kitani, T.; Kami, D.; Matoba, S.; Gojo, S. Internalization of isolated functional mitochondria: Involvement of macropinocytosis. J. Cell. Mol. Med. 2014, 18, 1694–1703. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ribeiro-Rodrigues, T.M.; Martins-Marques, T.; Morel, S.; Kwak, B.R.; Girão, H. Role of connexin 43 in different forms of intercellular communication—Gap junctions, extracellular vesicles and tunnelling nanotubes. J. Cell Sci. 2017, 130, 3619–3630. [Google Scholar] [CrossRef] [Scilit]
- Las, G.; Shirihai, O.S. Miro1: New wheels for transferring mitochondria. EMBO J. 2014, 33, 939–941. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Golan, K.; Singh, A.K.; Kollet, O.; Bertagna, M.; Althoff, M.J.; Khatib-Massalha, E.; Petrovich-Kopitman, E.; Wellendorf, A.M.; Massalha, H.; Levin-Zaidman, S.; et al. Bone marrow regeneration requires mitochondrial transfer from donor Cx43-expressing hematopoietic progenitors to stroma. Blood 2020, 136, 2607–2619. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sinclair, K.A.; Yerkovich, S.T.; Hopkins, P.M.; Chambers, D.C. Characterization of intercellular communication and mitochondrial donation by mesenchymal stromal cells derived from the human lung. Stem Cell Res. Ther. 2016, 7, 91. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.; Yu, Z.; Jiang, D.; Liang, X.; Liao, S.; Zhang, Z.; Yue, W.; Li, X.; Chiu, S.M.; Chai, Y.H.; et al. iPSC-MSCs with High Intrinsic MIRO1 and Sensitivity to TNF-α Yield Efficacious Mitochondrial Transfer to Rescue Anthracycline-Induced Cardiomyopathy. Stem Cell Rep. 2016, 7, 749–763. [Google Scholar] [CrossRef] [Scilit]
- Steinle, J.J. Role of HMGB1 signaling in the inflammatory process in diabetic retinopathy. Cell. Signal. 2020, 73, 109687. [Google Scholar] [CrossRef] [Scilit]
- Andersson, U.; Tracey, K.J. HMGB1 is a therapeutic target for sterile inflammation and infection. Annu. Rev. Immunol. 2011, 29, 139–162. [Google Scholar] [CrossRef] [Scilit]
- Meng, X.; Chen, M.; Su, W.; Tao, X.; Sun, M.; Zou, X.; Ying, R.; Wei, W.; Wang, B. The differentiation of mesenchymal stem cells to vascular cells regulated by the HMGB1/RAGE axis: Its application in cell therapy for transplant arteriosclerosis. Stem Cell Res. Ther. 2018, 9, 85. [Google Scholar] [CrossRef] [Scilit]
- Kume, S.; Kato, S.; Yamagishi, S.; Inagaki, Y.; Ueda, S.; Arima, N.; Okawa, T.; Kojiro, M.; Nagata, K. Advanced glycation end-products attenuate human mesenchymal stem cells and prevent cognate differentiation into adipose tissue, cartilage, and bone. J. Bone Miner. Res. 2005, 20, 1647–1658. [Google Scholar] [CrossRef] [Scilit]
- Kuniyasu, H.; Chihara, Y.; Kondo, H. Differential effects between amphoterin and advanced glycation end products on colon cancer cells. Int. J. Cancer 2003, 104, 722–727. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yokoyama, S.; Kawai, T.; Yamamoto, K.; Yibin, H.; Yamamoto, H.; Kakino, A.; Takeshita, H.; Nozato, Y.; Fujimoto, T.; Hongyo, K.; et al. RAGE ligands stimulate angiotensin II type I receptor (AT1) via RAGE/AT1 complex on the cell membrane. Sci. Rep. 2021, 11, 5759. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Soundara Rajan, T.; Gugliandolo, A.; Bramanti, P.; Mazzon, E. Tunneling Nanotubes-Mediated Protection of Mesenchymal Stem Cells: An Update from Preclinical Studies. Int. J. Mol. Sci. 2020, 21, 3481. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Boukelmoune, N.; Chiu, G.S.; Kavelaars, A.; Heijnen, C.J. Mitochondrial transfer from mesenchymal stem cells to neural stem cells protects against the neurotoxic effects of cisplatin. Acta Neuropathol. Commun. 2018, 6, 139. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, Q.; Zhang, X.; Zhu, T.; Xu, Z.; Dong, Y.; Chen, B. Mitochondrial transfer from mesenchymal stem cells: Mechanisms and functions. Mitochondrion 2024, 79, 101950. [Google Scholar] [CrossRef] [Scilit]
- Kuniyasu, H.; Oue, N.; Wakikawa, A.; Shigeishi, H.; Matsutani, N.; Kuraoka, K.; Ito, R.; Yokozaki, H.; Yasui, W. Expression of receptors for advanced glycation end-products (RAGE) is closely associated with the invasive and metastatic activity of gastric cancer. J. Pathol. 2002, 196, 163–170. [Google Scholar] [CrossRef] [Scilit]









| Gene Symbol | Species | Accession ID | Upper | Lower |
|---|---|---|---|---|
| ACTB | Mouse | NM_007393.5 | agccatgtacgtagccatcc | ctctcagctgtggtggtgaa |
| ACTB | Human | NM_001101.3 | ggacttcgagcaagagatgg | agcactgtgttggcgtacag |
| GAPDH | Human | BC025925.1 | gagtcaacggatttggtcgt | ttgattttggagggatctcg |
| GAPDH | Mouse | NM_001289726.1 | aactttggcattgtggaagg | acacattgggggtaggaaca |
| Miro1 | Human | BC125105.1 | cctgtactgcccagaggaga | ctgtcagccacaccatcact |
| miro1 | Mouse | XM_021212699.2 | ccggttacgctgcatgtgca | ggcaaagcccacaactgcga |
| Cx43 | Human | M65188.1 | atgagcagtctgcctttcgt | tctgcttcaagtgcatgtcc |
| cx43 | Mouse | M63801.1 | atcgcgtgaagggaagaagc | ctcgctggcttgcttgttgt |
| Rage | Human | AB036432.1 | gctgtcagcatcagcatcat | attcagttctgcacgctcct |
| Rage | Mouse | L33412.1 | aattgtggatcctgcctctg | aaggtaggatgggtggttcc |
| TLR4 | Human | AB445638.1 | cctgtccctgaaccctatga | ccagaaccaaacgatggact |
| TLR4 | Mouse | AF177767.1 | gctttcacctctgccttcac | gaaactgccatgtttgagca |
| LGR5 | Mouse | NM_010195.2 | cattcacttttggccgtttt | agggccaacaggacacatag |
| LGR5 | Human | AF061444.1 | ctcttcctcaaaccgtctgc | gatcggaggctaagcaactg |
| Sox2 | Human | NM_003106.4 | aaccccaagatgcacaactc | cggggccggtatttataatc |
| CD44 | Human | FJ216964.1 | aaggtggagcaaacacaacc | agctttttcttctgcccaca |
| Klf4 | Human | KJ901962.1 | cccacacaggtgagaaacct | cccacacaggtgagaaacct |
| NS | Mouse | BC037996.1 | atgtggggaaaagcagtgtc | tgggggagttacaaggtgag |
| Antibodies | ||||
| Miro1 | CL1083 | ab188029 | Abcam, Cambridge, MA, USA | |
| NFκBp65 | D14E12 | #8242 | Cell Signaling Technology, Danvers, MA, USA | |
| HMGB1 | 3E8 | 651402 | Biolegend, San Diego, CA, USA | |
| PARP | - | GTX132329 | GeneTex, Irvine, CA, USA | |
| β-actin | C4 | sc-47778 | Santa Cruz Biotechnology, Santa Cruz, CA, USA | |
| GAPDH | 1E6D9 | 60004-1-Ig | Proteintech, Tokyo, Japan | |
| ELISA | ||||
| Target | Species | Catalog number | Company | |
| CD74 | Mouse | ELM-CD74-1 | RayBiotech, Peachtree Corners, GA, USA | |
| SOX2 | Mouse | LS-F14527 | LS Bio, Shirley, MA, USA | |
| 4HNE | - | ab238538 | Abcam, Cambridge, MA, USA | |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sasaki, R.; Luo, Y.; Kishi, S.; Ogata, R.; Nishiguchi, Y.; Sasaki, T.; Ohmori, H.; Fujiwara-Tani, R.; Kuniyasu, H. Oxidative High Mobility Group Box-1 Accelerates Mitochondrial Transfer from Mesenchymal Stem Cells to Colorectal Cancer Cells Providing Cancer Cell Stemness. Int. J. Mol. Sci. 2025, 26, 1192. https://doi.org/10.3390/ijms26031192
Sasaki R, Luo Y, Kishi S, Ogata R, Nishiguchi Y, Sasaki T, Ohmori H, Fujiwara-Tani R, Kuniyasu H. Oxidative High Mobility Group Box-1 Accelerates Mitochondrial Transfer from Mesenchymal Stem Cells to Colorectal Cancer Cells Providing Cancer Cell Stemness. International Journal of Molecular Sciences. 2025; 26(3):1192. https://doi.org/10.3390/ijms26031192
Chicago/Turabian StyleSasaki, Rika, Yi Luo, Shingo Kishi, Ruiko Ogata, Yukiko Nishiguchi, Takamitsu Sasaki, Hitoshi Ohmori, Rina Fujiwara-Tani, and Hiroki Kuniyasu. 2025. "Oxidative High Mobility Group Box-1 Accelerates Mitochondrial Transfer from Mesenchymal Stem Cells to Colorectal Cancer Cells Providing Cancer Cell Stemness" International Journal of Molecular Sciences 26, no. 3: 1192. https://doi.org/10.3390/ijms26031192
APA StyleSasaki, R., Luo, Y., Kishi, S., Ogata, R., Nishiguchi, Y., Sasaki, T., Ohmori, H., Fujiwara-Tani, R., & Kuniyasu, H. (2025). Oxidative High Mobility Group Box-1 Accelerates Mitochondrial Transfer from Mesenchymal Stem Cells to Colorectal Cancer Cells Providing Cancer Cell Stemness. International Journal of Molecular Sciences, 26(3), 1192. https://doi.org/10.3390/ijms26031192

