The Antidepressant Effect of Resveratrol Is Related to Neuroplasticity Mediated by the ELAVL4-Bdnf mRNA Pathway
Abstract
1. Introduction
2. Results
2.1. Resveratrol Ameliorates Depressive-like Behaviors, Cognitive Impairment, and Social Deficits in the Chronic Unpredictable Mild Stress (CUMS) Rats
2.2. Resveratrol Relieves the Hippocampal Neuroplasticity Damage Induced by CUMS
2.3. ELAVL4 Acts as a Pivotal Role in the Antidepressant Action of Resveratrol
2.4. Bdnf Is the Potential Target Gene of ELAVL4
3. Discussion
4. Materials and Methods
4.1. Animals
4.2. Experimental Grouping and Design
4.3. Stressors and Operational Processes of CUMS and Drug Intervention
4.4. Behavioral Testing
4.4.1. Body Weight (BW)
4.4.2. SPT
4.4.3. OFT
4.4.4. FST
4.4.5. NOR
4.4.6. SIT
4.5. Proteomic Assays
4.6. Analysis of the Potential Neuroplasticity-Related Target mRNAs of ELAVL4
4.7. Structure Prediction of the Interaction Between ELAVL4 and BDNF mRNA
4.8. WB
4.9. qPCR
4.10. IF
4.11. Nissl Staining and Golgi Staining
4.12. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Anderson, E.; Crawford, C.M.; Fava, M.; Ingelfinger, J.; Nikayin, S.; Sanacora, G.; Scott-Vernaglia, S.; Teel, J. Depression—Understanding, Identifying, and Diagnosing. New Engl. J. Med. 2024, 390, e41. [Google Scholar] [CrossRef] [PubMed]
- Monroe, S.M.; Harkness, K.L. Major Depression and Its Recurrences: Life Course Matters. Annu. Rev. Clin. Psychol. 2022, 18, 329–357. [Google Scholar] [CrossRef] [PubMed]
- Schramm, E.; Klein, D.N.; Elsaesser, M.; Furukawa, T.A.; Domschke, K. Review of dysthymia and persistent depressive disorder: History, correlates, and clinical implications. Lancet. Psychiatry 2020, 7, 801–812. [Google Scholar] [CrossRef]
- Ortega, M.A.; Fraile-Martínez, Ó.; García-Montero, C.; Alvarez-Mon, M.A.; Lahera, G.; Monserrat, J.; Llavero-Valero, M.; Gutiérrez-Rojas, L.; Molina, R.; Rodríguez-Jimenez, R.; et al. Biological Role of Nutrients, Food and Dietary Patterns in the Prevention and Clinical Management of Major Depressive Disorder. Nutrients 2022, 14, 3099. [Google Scholar] [CrossRef]
- Rothenberg, D.O.N.; Zhang, L. Mechanisms Underlying the Anti-Depressive Effects of Regular Tea Consumption. Nutrients 2019, 11, 1361. [Google Scholar] [CrossRef]
- Hall, S.; Desbrow, B.; Anoopkumar-Dukie, S.; Davey, A.K.; Arora, D.; McDermott, C.; Schubert, M.M.; Perkins, A.V.; Kiefel, M.J.; Grant, G.D. A review of the bioactivity of coffee, caffeine and key coffee constituents on inflammatory responses linked to depression. Food Res. Int. 2015, 76 Pt 3, 626–636. [Google Scholar] [CrossRef]
- Finnell, J.E.; Lombard, C.M.; Melson, M.N.; Singh, N.P.; Nagarkatti, M.; Nagarkatti, P.; Fadel, J.R.; Wood, C.S.; Wood, S.K. The protective effects of resveratrol on social stress-induced cytokine release and depressive-like behavior. Brain Behav. Immun. 2017, 59, 147–157. [Google Scholar] [CrossRef]
- Piao, J.; Wang, Y.; Zhang, T.; Zhao, J.; Lv, Q.; Ruan, M.; Yu, Q.; Li, B. Antidepressant-like Effects of Representative Types of Food and Their Possible Mechanisms. Molecules 2023, 28, 6992. [Google Scholar] [CrossRef]
- Pastor, R.F.; Restani, P.; Di Lorenzo, C.; Orgiu, F.; Teissedre, P.-L.; Stockley, C.; Ruf, J.C.; Quini, C.I.; Garcìa Tejedor, N.; Gargantini, R.; et al. Resveratrol, human health and winemaking perspectives. Crit. Rev. Food Sci. Nutr. 2019, 59, 1237–1255. [Google Scholar] [CrossRef]
- Shayganfard, M. Molecular and biological functions of resveratrol in psychiatric disorders: A review of recent evidence. Cell Biosci. 2020, 10, 128. [Google Scholar] [CrossRef]
- Li, Y.; Yu, L.; Zhao, L.; Zeng, F.; Liu, Q.-S. Resveratrol modulates cocaine-induced inhibitory synaptic plasticity in VTA dopamine neurons by inhibiting phosphodiesterases (PDEs). Sci. Rep. 2017, 7, 15657. [Google Scholar] [CrossRef] [PubMed]
- Shi, D.-D.; Dong, C.M.; Ho, L.C.; Lam, C.T.W.; Zhou, X.-D.; Wu, E.X.; Zhou, Z.-J.; Wang, X.-M.; Zhang, Z.-J. Resveratrol, a natural polyphenol, prevents chemotherapy-induced cognitive impairment: Involvement of cytokine modulation and neuroprotection. Neurobiol. Dis. 2018, 114, 164–173. [Google Scholar] [CrossRef] [PubMed]
- Tong, J.; Gao, J.; Liu, Q.; He, C.; Zhao, X.; Qi, Y.; Yuan, T.; Li, P.; Niu, M.; Wang, D.; et al. Resveratrol derivative excited postsynaptic potentiation specifically via PKCβ-NMDA receptor mediation. Pharmacol. Res. 2020, 152, 104618. [Google Scholar] [CrossRef] [PubMed]
- Herring, B.E.; Nicoll, R.A. Long-Term Potentiation: From CaMKII to AMPA Receptor Trafficking. Annu. Rev. Physiol. 2016, 78, 351–365. [Google Scholar] [CrossRef]
- Liu, J.-H.; Zhang, M.; Wang, Q.; Wu, D.-Y.; Jie, W.; Hu, N.-Y.; Lan, J.-Z.; Zeng, K.; Li, S.-J.; Li, X.-W.; et al. Distinct roles of astroglia and neurons in synaptic plasticity and memory. Mol. Psychiatry 2022, 27, 873–885. [Google Scholar] [CrossRef]
- Price, R.B.; Duman, R. Neuroplasticity in cognitive and psychological mechanisms of depression: An integrative model. Mol. Psychiatry 2020, 25, 530–543. [Google Scholar] [CrossRef]
- Fries, G.R.; Saldana, V.A.; Finnstein, J.; Rein, T. Molecular pathways of major depressive disorder converge on the synapse. Mol. Psychiatry 2023, 28, 284–297. [Google Scholar] [CrossRef]
- Boku, S.; Nakagawa, S.; Toda, H.; Hishimoto, A. Neural basis of major depressive disorder: Beyond monoamine hypothesis. Psychiatry Clin. Neurosci. 2018, 72, 3–12. [Google Scholar] [CrossRef]
- Ruggiero, R.N.; Rossignoli, M.T.; Marques, D.B.; de Sousa, B.M.; Romcy-Pereira, R.N.; Lopes-Aguiar, C.; Leite, J.P. Neuromodulation of Hippocampal-Prefrontal Cortical Synaptic Plasticity and Functional Connectivity: Implications for Neuropsychiatric Disorders. Front. Cell. Neurosci. 2021, 15, 732360. [Google Scholar] [CrossRef]
- Tartt, A.N.; Mariani, M.B.; Hen, R.; Mann, J.J.; Boldrini, M. Dysregulation of adult hippocampal neuroplasticity in major depression: Pathogenesis and therapeutic implications. Mol. Psychiatry 2022, 27, 2689–2699. [Google Scholar] [CrossRef]
- Duman, R.S.; Aghajanian, G.K.; Sanacora, G.; Krystal, J.H. Synaptic plasticity and depression: New insights from stress and rapid-acting antidepressants. Nat. Med. 2016, 22, 238–249. [Google Scholar] [CrossRef] [PubMed]
- Good, P.J. A conserved family of elav-like genes in vertebrates. Proc. Natl. Acad. Sci. USA 1995, 92, 4557–4561. [Google Scholar] [CrossRef]
- Jung, M.; Lee, E.K. RNA-Binding Protein HuD as a Versatile Factor in Neuronal and Non-Neuronal Systems. Biology 2021, 10, 361. [Google Scholar] [CrossRef]
- Chen, C.-Y.A.; Shyu, A.-B. HuD stimulates translation via eIF4A. Mol. Cell 2009, 36, 920–921. [Google Scholar] [CrossRef] [PubMed]
- Abdelmohsen, K.; Hutchison, E.R.; Lee, E.K.; Kuwano, Y.; Kim, M.M.; Masuda, K.; Srikantan, S.; Subaran, S.S.; Marasa, B.S.; Mattson, M.P.; et al. miR-375 inhibits differentiation of neurites by lowering HuD levels. Mol. Cell. Biol. 2010, 30, 4197–4210. [Google Scholar] [CrossRef]
- Lim, C.S.; Alkon, D.L. Protein kinase C stimulates HuD-mediated mRNA stability and protein expression of neurotrophic factors and enhances dendritic maturation of hippocampal neurons in culture. Hippocampus 2012, 22, 2303–2319. [Google Scholar] [CrossRef]
- Bolognani, F.; Tanner, D.C.; Merhege, M.; Deschênes-Furry, J.; Jasmin, B.; Perrone-Bizzozero, N.I. In vivo post-transcriptional regulation of GAP-43 mRNA by overexpression of the RNA-binding protein HuD. J. Neurochem. 2006, 96, 790–801. [Google Scholar] [CrossRef]
- Akten, B.; Kye, M.J.; Hao, L.T.; Wertz, M.H.; Singh, S.; Nie, D.; Huang, J.; Merianda, T.T.; Twiss, J.L.; Beattie, C.E.; et al. Interaction of survival of motor neuron (SMN) and HuD proteins with mRNA cpg15 rescues motor neuron axonal deficits. Proc. Natl. Acad. Sci. USA 2011, 108, 10337–10342. [Google Scholar] [CrossRef]
- Fabbri, C.; Crisafulli, C.; Gurwitz, D.; Stingl, J.; Calati, R.; Albani, D.; Forloni, G.; Calabrò, M.; Martines, R.; Kasper, S.; et al. Neuronal cell adhesion genes and antidepressant response in three independent samples. Pharmacogenomics J. 2015, 15, 538–548. [Google Scholar] [CrossRef]
- Wang, F.; Tidei, J.J.; Polich, E.D.; Gao, Y.; Zhao, H.; Perrone-Bizzozero, N.I.; Guo, W.; Zhao, X. Positive feedback between RNA-binding protein HuD and transcription factor SATB1 promotes neurogenesis. Proc. Natl. Acad. Sci. USA 2015, 112, E4995–E5004. [Google Scholar] [CrossRef]
- Moore, A.; Beidler, J.; Hong, M.Y. Resveratrol and Depression in Animal Models: A Systematic Review of the Biological Mechanisms. Molecules 2018, 23, 2197. [Google Scholar] [CrossRef] [PubMed]
- Zanos, P.; Gould, T.D. Mechanisms of ketamine action as an antidepressant. Mol. Psychiatry 2018, 23, 801–811. [Google Scholar] [CrossRef] [PubMed]
- Parekh, P.K.; Johnson, S.B.; Liston, C. Synaptic Mechanisms Regulating Mood State Transitions in Depression. Annu. Rev. Neurosci. 2022, 45, 581–601. [Google Scholar] [CrossRef] [PubMed]
- Moliner, R.; Girych, M.; Brunello, C.A.; Kovaleva, V.; Biojone, C.; Enkavi, G.; Antenucci, L.; Kot, E.F.; Goncharuk, S.A.; Kaurinkoski, K.; et al. Psychedelics promote plasticity by directly binding to BDNF receptor TrkB. Nat. Neurosci. 2023, 26, 1032–1041. [Google Scholar] [CrossRef] [PubMed]
- Borgonetti, V.; Galeotti, N. Posttranscriptional Regulation of Gene Expression Participates in the Myelin Restoration in Mouse Models of Multiple Sclerosis: Antisense Modulation of HuR and HuD ELAV RNA Binding Protein. Mol. Neurobiol. 2023, 60, 2661–2677. [Google Scholar] [CrossRef]
- Silvestri, B.; Mochi, M.; Garone, M.G.; Rosa, A. Emerging Roles for the RNA-Binding Protein HuD (ELAVL4) in Nervous System Diseases. Int. J. Mol. Sci. 2022, 23, 14606. [Google Scholar] [CrossRef]
- Sanna, M.D.; Peroni, D.; Mello, T.; Ghelardini, C.; Quattrone, A.; Galeotti, N. Increase of neurofilament-H protein in sensory neurons in antiretroviral neuropathy: Evidence for a neuroprotective response mediated by the RNA-binding protein HuD. Pharmacol. Res. 2016, 111, 23–33. [Google Scholar] [CrossRef]
- Zhu, X.; Li, W.; Li, Y.; Xu, W.; Yuan, Y.; Zheng, V.; Zhang, H.; O’Donnell, J.M.; Xu, Y.; Yin, X. The antidepressant- and anxiolytic-like effects of resveratrol: Involvement of phosphodiesterase-4D inhibition. Neuropharmacology 2019, 153, 20–31. [Google Scholar] [CrossRef]
- Liu, D.; Zhang, Q.; Gu, J.; Wang, X.; Xie, K.; Xian, X.; Wang, J.; Jiang, H.; Wang, Z. Resveratrol prevents impaired cognition induced by chronic unpredictable mild stress in rats. Prog. Neuro-Psychopharmacol. Biol. Psychiatry 2014, 49, 21–29. [Google Scholar] [CrossRef]
- Autry, A.E.; Monteggia, L.M. Brain-derived neurotrophic factor and neuropsychiatric disorders. Pharmacol. Rev. 2012, 64, 238–258. [Google Scholar] [CrossRef]
- Korpi, E.R.; den Hollander, B.; Farooq, U.; Vashchinkina, E.; Rajkumar, R.; Nutt, D.J.; Hyytiä, P.; Dawe, G.S. Mechanisms of Action and Persistent Neuroplasticity by Drugs of Abuse. Pharmacol. Rev. 2015, 67, 872–1004. [Google Scholar]
- Tabassum, S.; Misrani, A.; Huang, H.-X.; Zhang, Z.-Y.; Li, Q.-W.; Long, C. Resveratrol Attenuates Chronic Unpredictable Mild Stress-Induced Alterations in the SIRT1/PGC1α/SIRT3 Pathway and Associated Mitochondrial Dysfunction in Mice. Mol. Neurobiol. 2023, 60, 5102–5116. [Google Scholar] [CrossRef]




| Gene | Forward Primer | Reverse Primer |
|---|---|---|
| NRN1 | tcttacggattgccaggaag | gctaaagctgccgagagaga |
| GAP43 | ggctctgctactaccgatgc | gacggcgagttatcagtggt |
| BDNF | tacctggatgccgcaaacat | tggccttttgataccgggac |
| NGF | acctcttcggacactctgga | gtccgtggctgtggtcttat |
| GAPDH | tgatgggtgtgaaccacgag | agtgatggcatggactgtgg |
| F (DFn, DFd) | p Value | |
|---|---|---|
| Figure 1C | F (3, 36) = 20.38 | p < 0.0001 |
| Figure 1D | F (3, 36) = 21.19 | p < 0.0001 |
| Figure 1E | F (3, 36) = 15.35 | p < 0.0001 |
| Figure 1F | F (3, 36) = 10.92 | p < 0.0001 |
| Figure 1G | F (3, 36) = 9.649 | p < 0.0001 |
| Figure 1H | F (3, 20) = 16.24 | p < 0.0001 |
| Figure 1I | F (3, 20) = 10.76 | p = 0.0002 |
| Figure 2F | F (3, 8) = 18.52 | p = 0.0006 |
| Figure 2H | F (3, 8) = 19.07 | p = 0.0005 |
| Figure 2I | F (3, 8) = 16.70 | p = 0.0008 |
| Figure 2K | F (3, 8) = 10.65 | p = 0.0036 |
| Figure 3F | F (3, 8) = 23.59 | p = 0.0003 |
| Figure 4E | F (3, 20) = 46.37 | p < 0.0001 |
| Figure 4G | F (3, 8) = 35.77 | p < 0.0001 |
| Figure 4I | F (3, 8) = 33.59 | p < 0.0001 |
| Figure 4J | F (3, 8) = 7.780 | p = 0.0093 |
| Figure 4L | F (3, 8) = 25.38 | p = 0.0002 |
| Figure 4M | F (3, 8) = 28.92 | p = 0.0001 |
| Figure S1A | F (3, 36) = 1.820 | p = 0.1609 |
| Figure S1B | F (3, 36) = 0.9385 | p = 0.4322 |
| Figure S1C | F (3, 36) = 1.056 | p = 0.3800 |
| Figure S1D | F (3, 36) = 0.4159 | p = 0.7426 |
| Figure S2A | F (3, 20) = 7.547 | p = 0.0014 |
| Figure S2B | F (3, 20) = 15.76 | p < 0.0001 |
| Figure S2C (groups) | F (1.748, 8.742) = 117.8 | p < 0.0001 |
| Figure S2C (genes) | F (1.250, 6.250) = 12.28 | p = 0.0100 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ge, H.; Si, L.; Li, C.; Huang, J.; Sun, L.; Wu, L.; Xie, Y.; Xiao, L.; Wang, G. The Antidepressant Effect of Resveratrol Is Related to Neuroplasticity Mediated by the ELAVL4-Bdnf mRNA Pathway. Int. J. Mol. Sci. 2025, 26, 1113. https://doi.org/10.3390/ijms26031113
Ge H, Si L, Li C, Huang J, Sun L, Wu L, Xie Y, Xiao L, Wang G. The Antidepressant Effect of Resveratrol Is Related to Neuroplasticity Mediated by the ELAVL4-Bdnf mRNA Pathway. International Journal of Molecular Sciences. 2025; 26(3):1113. https://doi.org/10.3390/ijms26031113
Chicago/Turabian StyleGe, Hailong, Lujia Si, Chen Li, Junjie Huang, Limin Sun, Lan Wu, Yinping Xie, Ling Xiao, and Gaohua Wang. 2025. "The Antidepressant Effect of Resveratrol Is Related to Neuroplasticity Mediated by the ELAVL4-Bdnf mRNA Pathway" International Journal of Molecular Sciences 26, no. 3: 1113. https://doi.org/10.3390/ijms26031113
APA StyleGe, H., Si, L., Li, C., Huang, J., Sun, L., Wu, L., Xie, Y., Xiao, L., & Wang, G. (2025). The Antidepressant Effect of Resveratrol Is Related to Neuroplasticity Mediated by the ELAVL4-Bdnf mRNA Pathway. International Journal of Molecular Sciences, 26(3), 1113. https://doi.org/10.3390/ijms26031113
