Next Article in Journal
Pathogenesis-Guided Biomarker Assessment: A Shift in Prostate Cancer Diagnostics
Previous Article in Journal
Thyrotropin-Releasing Hormone Gene Methylation as a Potential Biomarker for Anal Intraepithelial Neoplasia
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Voltage-Gated Sodium Channel Substitutions Underlying Tetrodotoxin Resistance in Nemerteans: Ecological and Evolutionary Implications

by
Vasiliy G. Kuznetsov
,
Anna E. Vlasenko
and
Timur Yu. Magarlamov
*
A.V. Zhirmunsky National Scientific Center of Marine Biology, Far Eastern Branch, Russian Academy of Sciences, 690041 Vladivostok, Russia
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2025, 26(24), 11785; https://doi.org/10.3390/ijms262411785
Submission received: 29 October 2025 / Revised: 2 December 2025 / Accepted: 4 December 2025 / Published: 5 December 2025

Abstract

Tetrodotoxin (TTX) is an extremely potent neurotoxin, a selective blocker of voltage-gated sodium (NaV) channels, produced by bacteria and accumulated across a wide range of taxa. Several TTX-bearing animals have developed molecular adaptations in their NaV channels that provide TTX resistance, making this toxin one of the factors of molecular evolution. However, the molecular basis of TTX resistance in NaV channels of a significant proportion of tetrodotoxic species remains poorly studied. Nemertea is a phylum of marine worms, comprising both TTX-bearing and non-TTX-bearing species. Here, we analyzed the amino acid sequences of the NaV1 channel regions responsible for TTX binding from 22 species of nemerteans. Substitutions previously characterized as conferring TTX resistance in other taxa were detected in sixteen nemerteans; local clustering was observed within several families. These findings suggest that TTX resistance in nemerteans evolved multiple times independently and may serve as either as an adaptation facilitating TTX accumulation for subsequent use for defense and predation, or as a mechanism allowing consumption of tetrodotoxic prey without toxin accumulation.

1. Introduction

Tetrodotoxin (TTX) is an extremely potent, low-molecular-weight neurotoxin that, along with its analogs (TTXs), is widely distributed among diverse marine and terrestrial taxa, serving both as a predatory weapon and as a defense agent [1,2]. Although the origin of the toxin remains debated, several studies provide evidence supporting its bacterial source [3,4,5]. The variety of tetrodotoxic animals is impressive—from flatworms and gastropods to fishes and newts [6,7].
TTX acts as a selective blocker of voltage-gated sodium (NaV) channels, which are responsible for propagating action potentials [8,9]. NaV channels are large proteins of approximately 2000 amino acids, composed of four homologous domains (DI-DIV) [10]. Each domain contains six transmembrane segments (S1–S6), connected by loops. Segments S1–S4 of each domain function as the voltage-sensing module, while S5 and S6 form the ion-conducting pore. The loops between S5 and S6, known as pore-loops (P-loops), form the selectivity filter and outer vestibule of the channel. TTX binds to the P-loop region of NaV channels, blocking the influx of Na+ ions into the cell. Amino acid (AA) substitutions in the P-loops can affect TTX-binding affinity [11,12,13].
In TTX-bearing species, protection against self-intoxication is presumably achieved through structural modifications of NaV channels, primarily via AA substitutions in their P-loop regions [14]. Both TTX accumulation and the adaptive modifications of NaV channels are thought to have arisen independently across multiple taxa, representing a clear case of convergent evolution [11,12,13,14]. Although AA substitutions in P-loop regions vary widely, the total number of possible variants is thought to be limited by the requirement to maintain normal channel functionality [12,15,16].
Most investigations of TTX resistance in NaV channels have focused on highly toxic taxa, mostly vertebrates, while TTX-bearing invertebrates remain neglected. Nemerteans, or ribbon worms, represent a phylum of mostly marine worms comprising three classes: Palaeonemertea, Hoplonemertea, and Pilidiophora [17,18]. A number of nemertean species from all three classes were found to contain TTXs, even in extremely high concentrations [19,20,21,22]. Recently, it was demonstrated that the low-toxic heteronemertean Kulikovia alborostrata possesses two AA substitutions in the P-loop regions of the NaV1 channel, presumably decreasing TTX binding affinity [23]. However, no other nemertean NaV channels have been investigated to date.
Here, we identify AA substitutions in NaV channels that are potentially associated with TTX resistance and analyze their distribution across the nemertean phylum. We also discuss the potential relationship between TTX levels and structural variations in the P-loop regions of NaV channels.

2. Results

To identify amino acid substitutions potentially conferring TTX resistance in nemertean NaV1 channels, we obtained partial amino acid sequences of the P-loop regions forming the selectivity filter from 20 species (Figure 1 and Table S1). NaV1 sequences from two additional nemertean species were included in the analysis based on previously published data [23].
In all analyzed nemertean species, the selectivity filter exhibited a typical NaV1 structure, consisting of four amino acid residues: D(406), E(760), K(1241), and A(1535). However, the amino acids forming the outer negatively charged ring of the pore (the vestibule; [24]) varied among species and often differed from the canonical EEMD motif (positions 409, 763, 1244, and 1538, respectively) (Figure 1).
Figure 1. Amino acid sequences of the P-loop regions from the four domains (DI–DIV) of NaV1 channels in nonresistant Mya arenaria [25], nemerteans analyzed in this study, and NaV isoforms from TTX-exposed species previously reported to possess substitutions affecting TTX affinity (pufferfishes [26], newts [13,27,28], snakes [12,29], and octopus [30]; references and sequence accession numbers are provided in Table S2). Positions involved in TTX binding are highlighted in gray, and residues associated with TTX resistance reported for the cited species, as well as the corresponding residues in nemerteans, which have not been experimentally validated for TTX resistance, are shown in red. A dot (.) indicates missing data.
Figure 1. Amino acid sequences of the P-loop regions from the four domains (DI–DIV) of NaV1 channels in nonresistant Mya arenaria [25], nemerteans analyzed in this study, and NaV isoforms from TTX-exposed species previously reported to possess substitutions affecting TTX affinity (pufferfishes [26], newts [13,27,28], snakes [12,29], and octopus [30]; references and sequence accession numbers are provided in Table S2). Positions involved in TTX binding are highlighted in gray, and residues associated with TTX resistance reported for the cited species, as well as the corresponding residues in nemerteans, which have not been experimentally validated for TTX resistance, are shown in red. A dot (.) indicates missing data.
Ijms 26 11785 g001

3. Discussion

The results show that nemerteans carry substitutions at positions implicated in TTX binding across all four NaV1 domains. Because no functional studies have evaluated the TTX sensitivity of nemertean NaV channels, our interpretation of these substitutions relies on data from other TTX-resistant taxa [12,13,26,27,28,30]. Figure 1 summarizes these comparative data, incorporating non-resistant Mya arenaria as a reference, species in which P-loop substitutions have been experimentally tested for their effects on TTX sensitivity, and species that possess the same substitutions but have not yet been functionally assessed, including nemerteans.
It should be noted that the contribution of individual substitutions to TTX resistance has been evaluated using a range of experimental approaches, including direct electrophysiological recordings from isolated invertebrate neurons, tissues, or whole animals [12,13,28], as well as expression of mutant channels carrying the substitution of interest followed by voltage-clamp analyses [11,25,26,31,32]. Because direct functional assays of nemertean NaV channel affinity for TTX are currently lacking, our assessment necessarily relies on sequence comparisons, which can only suggest whether these substitutions exert similar effects in nemerteans.
Thus, two types of substitutions were identified at position 407 in DI: Tyr → Cys (Y407C), found in H. ijimai, and Tyr → Ala (Y407A), detected in six species. The Ala residue at this position has also been reported in the newt retina, where whole-cell recordings from spiking neurons demonstrated its contribution to TTX resistance [28]. Subsequent site-directed mutagenesis studies showed that replacing the aromatic residue at this site with a nonaromatic one can cause an extreme, up to 2500-fold decrease in the TTX binding affinity of NaV channels [26,32]. In DII, the Glu → Asp substitution (E763D) was observed in three nemertean species. The same substitution was previously identified in a TTX-resistant population of Mya arenaria, where functional assays demonstrated that it confers approximately a 3000-fold decrease in TTX sensivity in mutant channels [25,32]. It is the only substitution located in DII contributing to TTX resistance that was observed. In DIII, three species were shown to possess the Met → Thr substitution (M1244T). According to Jost and coauthors, the presence of Thr at this position increases TTX resistance by ~15-fold, as shown through site-directed mutagenesis experiments [26]. In some nemertean species studied herein, Ile, Val or Leu residues were found instead of Met, but this type of replacement is not supposed to affect TTX binding to the channel pore since all three AA sidechains provide the same characteristics. In DIV, the Asp → Asn substitution (D1538N) was identified in seven nemertean species. Functional studies have reported differing magnitudes of its effect: Geffeney and coauthors documented a ~40-fold decrease in TTX sensitivity [11], whereas Choudhary and coauthors reported an approximately 300-fold decrease [31]. Both findings were obtained using site-directed mutagenesis. Another variant in the DIV P-loop, found in four nemertean species, involves a double substitution at adjacent positions: Asp, Gly → Ser, Asp (D1538S, G1539D). This combination was previously proposed to underlie an exceptionally high (~30,000-fold) increase in TTX resistance based on intracellular recordings from isolated newt muscle fibers [13]. It should be noted that the newt species tested also carried the D1538N substitution mentioned above, which is supposed to confer much lower in TTX resistance [13].
The substitutions in key AA within the TTX-binding site that reduce TTX sensitivity have arisen independently in multiple taxa, representing a likely example of convergent evolution [12,13,26,33]. Although modifications in NaV channel structure across these lineages result from independent evolutionary events, the recurrence of the identical AA changes at the same P-loop positions suggests that there is a strictly limited set of evolutionary solutions for achieving TTX resistance without impairing channel performance [11,14]. This pattern reflects a functional limitation: only those substitutions within the TTX-binding region that do not affect normal channel operation can be allowed; the changes that lead to channel dysfunction do not persist in the population [12].
These patterns illustrate general trends of convergence across metazoans, while the distribution of substitutions within nemerteans reflects these broader trends but also reveals lineage-specific features. Nemertean substitutions presumed to affect TTX binding are spread throughout the phylum and do not form a universal pattern (Figure 2). Thus, the Y407A replacement (DI) occurs in representatives of two classes—Pilidiophora and Palaeonemertea; in DIII, the M1244T replacement appears to be characteristic of Pilidiophora; and D1538N is the only variant detected across all nemertean classes, including Hoplonemertea. At the same time, some “local clustering” could be distinguished within several nemertean genus—Cephalothrix, Kulikovia and Lineus. Three Cephalothrix species share the same substitutions in DI and DII, three Kulikovia species—in DIV, four Lineus species—another type of replacement in DIV. These patterns suggest that some polymorphisms could have appeared once in the common ancestor of each lineage and then distributed among its members [34].
Figure 2. Phylogenetic distribution of amino acid substitutions in the P-loop regions of the four domains (DI–DIV) of nemertean NaV1 channels associated with TTX resistance. The tree was constructed using concatenated COI, 16S, 18S, and NaV1 gene sequences. Species are categorized as “non-toxic” (no TTX detected), “toxic” (TTX detected, concentration not determined), “moderately toxic” (TTX < 500 ng/g), and “highly toxic” (TTX > 500 ng/g). log2FC values represent the log2-transformed fold change in channel affinity to TTX for each NaV1 domain according to [11,12,13,25,26,28,31,32].
Figure 2. Phylogenetic distribution of amino acid substitutions in the P-loop regions of the four domains (DI–DIV) of nemertean NaV1 channels associated with TTX resistance. The tree was constructed using concatenated COI, 16S, 18S, and NaV1 gene sequences. Species are categorized as “non-toxic” (no TTX detected), “toxic” (TTX detected, concentration not determined), “moderately toxic” (TTX < 500 ng/g), and “highly toxic” (TTX > 500 ng/g). log2FC values represent the log2-transformed fold change in channel affinity to TTX for each NaV1 domain according to [11,12,13,25,26,28,31,32].
Ijms 26 11785 g002
One of the determining factors in the evolution of the TTX-binding site in tetrodotoxic animals is their exposure to TTX. Since TTX levels that can be accumulated in animal bodies vary widely, molecular adaptation of NaV channels differs as well. For example, the population of garter snake Thamnophis sirtalis that preys on the extremely toxic newt Taricha granulosa developed 10–1000 times higher TTX resistance in comparison with other populations, due to different combinations of AA substitutions in the P-loop of NaV1.4 [11,35]. TTXs levels have been quantified for only four nemertean species, and their maximum total toxins concentrations decreased in the following order: C. simula > C. cf. simula > K. manchenkoi > K. alborostrata [19,36,37]. The presumptive resistance level corresponds to their toxicity, being equal for the first two species and then decreasing in the same order.
Some limitations should be taken into account: only 8 out of 22 nemertean species were tested for TTXs [19,21,37,38,39]; moreover, the presence of TTXs is not a permanent characteristic of a species. This means that species considered TTX-free in previous studies may be able to accumulate TTXs under different conditions or in other areas. Also, the study that was shown the toxicity of several nemertean species—L. ruber, L. sanguineus, A. lactifloreus [38] utilized TTX detection methods which provide low reliability [4]. An important notion regarding the influence of P-loop structure on TTX resistance that in silico analysis of TTX binding to NaV channels of several TTX-resistant animals have demonstrated that identical substitutions appearing in distant taxa through convergent evolution do not provide equal TTX resistance, due to differences in other regions of NaV channels structures [40]. Therefore, since no investigations of nemertean NaV channels TTX resistance have been conducted, we cannot argue that all described in the current research substitutions affect the TTX binding at the same level comparing to animals in which they were originally tested. In addition, another mechanism of TTX resistance has been described in several tetrodotoxic animals, involving TTX-binding proteins that are suggested to serve as self-protection against the toxin [41,42,43]. The possible existence of similar substances in nemerteans cannot be ruled out.

4. Materials and Methods

4.1. Bioinformatic Analysis of NaV1 Sequences and Primer Design for the Selectivity Filter Regions

To identify P-loop domains of nemertean NaV1 channels in transcriptome data, we used NaV1 sequences from Notospermus geniculatus (accession number MZ508871) obtained in our previous study [23] and from Lineus longissimus (accession number XM_064765583.1) retrieved from the automatically annotated tnLinLong1.2 genome assembly (NCBI Eukaryotic Genome Annotation Pipeline; BioProject PRJEB45696) [44]. Partial sequences of the four P-loop domains of Kulikovia alborostrata (accession numbers MZ508867–MZ508870) were also obtained from [23].
Nav1 sequences were searched in transcriptome reads from the NCBI Sequence Read Archive (SRA) for the following nemerteans: Lineus lacteus (SRR3581117, SRR3581125), Lineus sanguineus (SRR3581110), Lineus ruber (SRR1324988), Hubrechtella ijimai (SRR1505099, SRR1505100), Tubulanus polymorphus (SRR1611583), Carinoma hamanako (SRR1505092, SRR1505094), Cephalothrix linearis (SRR1273790, SRR1275323, SRR1275178), Amphiprous lactifloreus (SRR11906528), and Malacobdella grossa (SRR1611560, SRR1507002). Genomic reads were also analyzed for Cephalothrix simula (SRR26031763) and C. spiralis (SRR23997129).
The quality of reads was initially assessed using FastQC v0.11.9 https://www.bioinformatics.babraham.ac.uk/projects/fastqc/ (accessed on 15 September 2022) (Babraham Bioinformatics) and cleaned of adapters and low-quality sequences using Trimmomatic v0.39 http://www.usadellab.org/cms/?page=trimmomatic (accessed on 15 September 2022) (The USAdel Lab). Cleaned reads from different runs for the same species were combined, and species-specific databases were constructed using the makeblastdb tool from the NCBI-BLAST+ v2.13.0 package https://ncbiinsights.ncbi.nlm.nih.gov/2022/03/29/blast-2-13-0/ (accessed on 30 September 2022).
Nav1-related reads were identified by aligning these databases with reference Nav1 protein sequences from Notospermus geniculatus (MZ508871) and Lineus longissimus (XM_064765583.1) using the tblastn algorithm. To exclude TTX-resistant NaV2 channels and retain only NaV1 channels, we relied on the invertebrate channel sequences reported by Boullot and colleagues [44]. Identified reads were manually assembled into contigs, which were then scanned for regions corresponding to the P-loop domains.
The P-loop regions of Nav1 from different nemertean species were aligned using MEGA 7 software https://www.megasoftware.net/ (accessed on 10 March 2025) (Table S1). Alignments were used to identify amino acid substitutions potentially affecting TTX affinity and to guide the design of primers for the amplification of Nav1 P-loop domains. Primers were initially selected using the NCBI Primer Design Tool, https://www.ncbi.nlm.nih.gov/tools/primer-blast/ (accessed on 25 May 2025)) and manually edited to produce degenerate primers where necessary.
Partial sequences from previously published work (Kulikovia alborostrata, MZ508867-MZ508870; Lineus sanguineus, Lineus ruber) were also included in the analysis [23].

4.2. Specimens Collection and Identification

Individuals of Parahubrechtia rayi, Kulikovia alborostrata, K. manchenkoi, Cerebratulus orochi, and Micrura bella were collected from the rhizoids of brown algae Saccharina sp. in Vostok Bay and Spokoynaya Bay (Sea of Japan) during July–August 2019–2021 (Figure 3a,b). Specimens were maintained in aquaria with seawater at 18 °C. An individual of Kulikovia cf. montgomeryi was collected in the Sea of Japan (43°22′22.8″ N, 135°20′02.4″ E) near the coast of Primorsky Krai at depths of 450–518 m, identified, and provided by A.V. Chernyshev [45]. A specimen of Heteronemertes longifissa was collected by A.E. Vlasenko in 2021 during the Akademik Mstislav Keldysh 79 (AMK-79) expedition to the Southern Ocean, stage 2 (Expedition ID: 6615_Sigsbee trawl) (61°29′19.0″ S, 45°53′42.6″ W), and a specimen of Parborlasia corrugata was collected by G.V. Malykin in 2022 during the AMK-87 expedition (Expedition ID: 7318bb-14r) (62°59′12.3″ S, 60°34′06.9″ W) (Figure 4a,b).
All specimens were collected in non-protected areas where no research access or field permits were required. Samples were fixed in RNAlater (Thermo Fisher Scientific, Waltham, MA, USA) and stored at −20 °C until further processing. Animal manipulations were performed in accordance with the ARRIVE guidelines (https://arriveguidelines.org/arrive-guidelines, accessed 14 July 2020).
Preliminary identification of all collected nemerteans was based on morphological features. For genetic identification, specimens were sequenced using the cytochrome oxidase 1 (COI) gene in all collected nemerteans, except Cerebratulus orochi, which was identified using 16S and 18S ribosomal RNA genes. For COI amplification, the primers LCO1490 (5′-GGTCAACAAATCATAAAGATATTGG) and HCO2198 (5′-TAAACTTCAGGGTGACCAAAAAATCA) were used [46]. For 16S amplification, the primers Ar-L (5′-CGCCTGTTTATCAAAACAT) and Br-H (5′-CCGGTCTGAACTCAGATCACGT) were used [47]. For 18S amplification, two primer sets were used: TimA (5′-AMCTGGTTGATCCTGCCAG)/1100R (5′-GATCGTCTTCGAACCTCTG) [48]; 3F (5′-GTTCGATTCCGGAGAGGGA)/9R (5′-GATCCTTCCGCAGGTTCACCTAC) [49]; and 18Sbi (5′-GAGTCTCGTTCGTTATCGGA)/18Sa2.0 (5′-ATGGTTGCAAAGCTGAAAC) [50].
PCR amplification was performed using the Encyclo Plus PCR Kit (Evrogen, Moscow, Russia), following the manufacturer’s protocol. Cycling conditions were as follows: COI: 2 min at 95 °C, followed by 38 cycles of 30 s at 95 °C, 25 s at 48 °C, 50 s at 72 °C, and a final extension of 3 min at 72 °C. 16S: 2 min at 95 °C, 38 cycles of 30 s at 95 °C, 25 s at 53 °C, 50 s at 72 °C, and a final extension of 3 min at 72 °C. 18S: 2 min at 95 °C, 40 cycles of 30 s at 95 °C, 25 s at 50 °C, 55 s at 72 °C, and a final extension of 3 min at 72 °C.
PCR products were purified using the Cleanup Standard Kit (Evrogen). Sequencing reactions were performed with forward or reverse primers and 10–20 ng of purified amplicon DNA using the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Waltham, MA, USA), according to the manufacturer’s instructions. Sequencing was carried out on an ABI Prism 3500 Genetic Analyzer (Applied Biosystems, Waltham, MA, USA). Resulting sequences were submitted to the GenBank database (Table 1).

4.3. RNA Isolation and cDNA Synthesis

Total RNA was isolated from ~15 mg of worm tissue using TRIzol reagent (Thermo Fisher Scientific, Waltham, MA, USA) following the manufacturer’s protocol. RNA concentration and purity were measured using a UV5Nano spectrophotometer (Mettler Toledo, Columbus, OH, USA). Samples with an A260/A280 ratio >1.9 were used for cDNA synthesis. Double-stranded cDNA was generated from 1 μg of total RNA using the MINT2 kit (Evrogen) and the included CDS-1 adapter, according to the manufacturer’s instructions.

4.4. PCR Amplification of Selective Filter Regions of the NaV1 Channel Gene

PCR amplification of the NaV1 P-loop domains was performed using primers designed in this study and from [23] (Table 2 and Table 3) with the Encyclo Plus PCR kit (Evrogen). PCR reactions consisted of 36 cycles: 94 °C for 20 s, annealing at primer-specific temperatures for 25 s, and 72 °C for 1 min. Amplicons were visualized on 2.5% agarose gels stained with ethidium bromide using GeneRuler DNA Ladder Mix (Thermo Fisher Scientific). Target bands were excised and purified using a QIAquick Gel Extraction Kit (QIAGEN, Venlo, The Netherlands), and DNA concentration and quality were assessed by UV5Nano spectrophotometry.

4.5. Phylogenetic Tree Construction

To construct a phylogenetic tree of the studied species, COI, 16S, 18S genes and sequences of four P-loop regions of the Nav1 were used (Table 1 and Table S1). The sequences were aligned using the L-INS-i algorithm in MAFFT version 7 [51] https://mafft.cbrc.jp/ (accessed on 23 October 2025). The analysis matrix was constructed by concatenating all three genes using SequenceMatrix [52] http://www.ggvaidya.com/taxondna/ (accessed on 23 October 2025). Phylogenetic tree reconstruction was performed using the maximum likelihood (ML) method in IQ-TREE [53] via the web server http://iqtree.cibiv.univie.ac.at/ (accessed on 23 October 2025) with 10,000 ultrafast bootstrap replicates to assess branch support [54].

5. Conclusions

Our study provides the first analysis of amino acid substitutions in the P-loop regions of the NaV1 channel, presumably responsible for TTX resistance in 22 species of nemerteans. Potential TTX resistance was detected in most of the studied species (16 species), including non-TTX-bearing ones, indicating that multiple evolutionary forces may be involved. Possible explanations include ecological exposure to environmental TTX or dietary interactions with tetrodotoxic prey without TTX accumulation; however, lineage-specific evolutionary changes not driven by TTX exposure cannot be excluded.
The substitutions analyzed here demonstrated no universal pattern across the phylogenetic tree, although some “local clustering” was observed within several nemertean families. These findings establish nemerteans as a valuable model for investigating the convergent molecular evolution of TTX resistance.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms262411785/s1.

Author Contributions

Conceptualization, T.Y.M. and V.G.K.; methodology, V.G.K.; formal analysis, V.G.K. and A.E.V.; investigation, V.G.K.; writing—original draft preparation, V.G.K. and A.E.V.; writing—review and editing, T.Y.M.; visualization, A.E.V.; project administration, T.Y.M.; All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

The study was conducted in accordance with commission on biomedical ethics of A.V. Zhirmunsky National Scientific Center of Marine Biology of the Far Eastern Branch of the Russian Academy of Science (protocol code 1-261224, meeting №22, date of approval 27 October 2025).

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article/Supplementary Materials. Further inquiries can be directed to the corresponding author.

Acknowledgments

The authors are grateful to A.V. Chernyshev for species identification and Maykin G. V. for provided Parborlasia corrugata specimen.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Bane, V.; Lehane, M.; Dikshit, M.; O’Riordan, A.; Furey, A. Tetrodotoxin: Chemistry, toxicity, source, distribution and detection. Toxins 2014, 6, 693–755. [Google Scholar] [CrossRef] [PubMed]
  2. Lago, J.; Rodriguez, L.P.; Blanco, L.; Vieites, J.M.; Cabado, A.G. Tetrodotoxin, an extremely potent marine neurotoxin: Distribution, toxicity, origin and therapeutical uses. Mar. Drugs 2015, 13, 6384–6406. [Google Scholar] [CrossRef] [PubMed]
  3. Zhang, X.; Qiao, K.; Cui, R.; Xu, M.; Cai, S.; Huang, Q.; Liu, Z. Tetrodotoxin: The state-of-the-art progress in characterization, detection, biosynthesis, and transport enrichment. Mar. Drugs 2024, 22, 531. [Google Scholar] [CrossRef] [PubMed]
  4. Magarlamov, T.Y.; Melnikova, D.I.; Chernyshev, A.V. Tetrodotoxin-producing bacteria: Detection, distribution and migration of the toxin in aquatic systems. Toxins 2017, 9, 166. [Google Scholar] [CrossRef]
  5. Wu, Z.; Yang, Y.; Xie, L.; Xia, G.; Hu, J.; Wang, S.; Zhang, R. Toxicity and distribution of tetrodotoxin-producing bacteria in puffer fish Fugu rubripes collected from the Bohai Sea of China. Toxicon 2005, 46, 471–476. [Google Scholar] [CrossRef]
  6. Melnikova, D.I.; Magarlamov, T.Y. An overview of the anatomical distribution of tetrodotoxin in animals. Toxins 2022, 14, 576. [Google Scholar] [CrossRef]
  7. Katikou, P.; Gokbulut, C.; Kosker, A.R.; Campàs, M.; Ozogul, F. An updated review of tetrodotoxin and its peculiarities. Mar. Drugs 2022, 20, 47. [Google Scholar] [CrossRef]
  8. Durán-Riveroll, L.M.; Cembella, A.D. Guanidinium toxins and their interactions with voltage-gated sodium ion channels. Mar. Drugs 2017, 15, 303. [Google Scholar] [CrossRef]
  9. Chen, R.; Chung, S. Mechanism of tetrodotoxin block and resistance in sodium channels. Biochem. Biophys. Res. Commun. 2014, 446, 370–374. [Google Scholar] [CrossRef]
  10. Catterall, W.A. Structure and function of voltage-gated sodium channels at atomic resolution. Exp. Physiol. 2014, 99, 35–51. [Google Scholar] [CrossRef]
  11. Geffeney, S.L.; Fujimoto, E.; Brodie, E.D., III; Brodie, E.D., Jr.; Ruben, P.C. Evolutionary diversification of TTX-resistant sodium channels in a predator–prey interaction. Lett. Nat. 2005, 434, 759–763. [Google Scholar] [CrossRef] [PubMed]
  12. Feldman, C.R.; Brodie, E.D.; Brodie, E.D.; Pfrender, M.E. Constraint shapes convergence in tetrodotoxin-resistant sodium channels of snakes. Proc. Natl. Acad. Sci. USA 2012, 109, 4556–4561. [Google Scholar] [CrossRef] [PubMed]
  13. Hanifin, C.T.; Gilly, W.F. Evolutionary history of a complex adaptation: Tetrodotoxin resistance in salamanders. Evolution 2015, 69, 232–244. [Google Scholar] [CrossRef] [PubMed]
  14. Toledo, G.; Hanifin, C.; Geffeney, S.; Brodie, E.D. Convergent evolution of tetrodotoxin-resistant sodium channels in predators and prey. Curr. Top. Membr. 2016, 78, 87–113. [Google Scholar] [CrossRef]
  15. Catterall, W.A. Voltage-gated sodium channels at 60: Structure, function and pathophysiology. J. Physiol. 2012, 11, 2577–2589. [Google Scholar] [CrossRef]
  16. McGlothlin, J.W.; Kobiela, M.E.; Feldman, C.R.; Castoe, T.A.; Geffeney, S.L.; Hanifin, C.T.; Toledo, G.; Vonk, F.J.; Richardson, M.K.; Brodie, J.E.D.; et al. Historical contingency in a multigene family facilitates adaptive evolution of toxin resistance. Curr. Biol. 2016, 26, 1616–1621. [Google Scholar] [CrossRef]
  17. Kajihara, H.; Chernyshev, A.V.; Sun, S.; Sundberg, P.; Crandall, F.B. Checklist of nemertean genera and species published between 1995 and 2007. Species Divers. 2008, 13, 245–274. [Google Scholar] [CrossRef]
  18. Strand, M.; Norenburg, J.L.; Alfaya, J.E.J.E.; Ángel Fernández-Álvarez, F.; Andersson, H.S.; Andrade, S.C.S.; Bartolomaeus, T.; Beckers, P.; Bigatti, G.; Cherneva, I.; et al. Nemertean taxonomy—Implementing changes in the higher ranks, dismissing Anopla and Enopla. Zool. Scr. 2019, 48, 118–119. [Google Scholar] [CrossRef]
  19. Ali, A.E.; Arakawa, O.; Noguchi, T.; Miyazawa, K.; Shida, Y.; Hashimoto, K. Tetrodotoxin and related substances in a ribbon worm Cephalothrix linearis (Nemertean). Toxicon 1990, 28, 1083–1093. [Google Scholar] [CrossRef]
  20. Turner, A.D.; Fenwick, D.; Powell, A.; Dhanji-Rapkova, M.; Ford, C.; Hatfield, R.G.; Santos, A.; Martinez-Urtaza, J.; Bean, T.P.; Baker-Austin, C.; et al. New invasive nemertean species (Cephalothrix simula) in England with high levels of tetrodotoxin and a microbiome linked to toxin metabolism. Mar. Drugs 2018, 16, 452. [Google Scholar] [CrossRef]
  21. Vlasenko, A.E.; Velansky, P.V.; Chernyshev, A.V.; Kuznetsov, V.G.; Magarlamov, T.Y. Tetrodotoxin and its analogues profile in nemertean species from the Sea of Japan. Toxicon 2018, 156, 48–51. [Google Scholar] [CrossRef] [PubMed]
  22. Malykin, G.V.; Velansky, P.V.; Magarlamov, T.Y. Levels and profile of tetrodotoxins in spawning Cephalothrix mokievskii (Palaeonemertea, Nemertea): Assessing the potential toxic pressure on marine ecosystems. Toxins 2025, 17, 25. [Google Scholar] [CrossRef] [PubMed]
  23. Vlasenko, A.E.; Kuznetsov, V.G.; Malykin, G.V.; Pereverzeva, A.O.; Velansky, P.V.; Yakovlev, K.V.; Magarlamov, T.Y. Tetrodotoxins secretion and voltage-gated sodium channel adaptation in the ribbon worm Kulikovia alborostrata (Takakura, 1898) (Nemertea). Toxins 2021, 13, 606. [Google Scholar] [CrossRef] [PubMed]
  24. Terlau, H.; Heinemann, S.H.; Stfihmer, W.; Pusch, M.; Conti, F.; Imoto, K.; Numa, S. Mapping the site of block by tetrodotoxin and saxitoxin of sodium channel HI. Fed. Eur. Biochem. Soc. 1991, 293, 93–96. [Google Scholar] [CrossRef]
  25. Bricelj, V.M.; Connell, L.; Konoki, K.; MacQuarrie, S.P.; Scheuer, T.; Catterall, W.A.; Trainer, V.L. Sodium channel mutation leading to saxitoxin resistance in clams increases risk of PSP. Nature 2005, 434, 763–767. [Google Scholar] [CrossRef]
  26. Jost, M.C.; Hillis, D.M.; Lu, Y.; Kyle, J.W.; Fozzard, H.A.; Zakon, H.H. Toxin-resistant sodium channels: Parallel adaptive evolution across a complete gene family. Mol. Biol. Evol. 2008, 25, 1016–1024. [Google Scholar] [CrossRef]
  27. Vaelli, P.M.; Theis, K.R.; Williams, J.E.; O’connell, L.A.; Foster, J.A.; Eisthen, H.L. The skin microbiome facilitates adaptive tetrodotoxin production in poisonous newts. Elife 2020, 9, e53898. [Google Scholar] [CrossRef]
  28. Kaneko, Y.; Matsumoto, G.; Hanyu, Y. TTX resistivity of Na+ channel in newt retinal neuron. Biochem. Biophys. Res. Commun. 1997, 240, 651–656. [Google Scholar] [CrossRef]
  29. McGlothlin, J.W.; Chuckalovcak, J.P.; Janes, D.E.; Edwards, S.V.; Feldman, C.R.; Brodie, E.D., Jr.; Pfrender, M.E.; Brodie, E.D., III. Parallel evolution of tetrodotoxin resistance in three voltage-gated sodium channel genes in the garter snake Hamnophis sirtalis. Mol. Biol. Evol. 2014, 31, 2836–2846. [Google Scholar] [CrossRef]
  30. Geffeney, S.L.; Williams, B.L.; Rosenthal, J.J.C.; Birk, M.A.; Felkins, J.; Wisell, C.M.; Curry, E.R.; Hanifin, C.T. Convergent and parallel evolution in a voltage-gated sodium channel underlies TTX-resistance in the greater blue-ringed octopus: Hapalochlaena lunulata. Toxicon 2019, 170, 77–84. [Google Scholar] [CrossRef]
  31. Choudhary, G.; Yotsu-Yamashita, M.; Shang, L.; Yasumoto, T.; Dudley, S.C. Interactions of the C-11 hydroxyl of tetrodotoxin with the sodium channel outer vestibule. Biophys. J. 2003, 84, 287–294. [Google Scholar] [CrossRef]
  32. Venkatesh, B.; Lu, S.Q.; Dandona, N.; See, S.L.; Brenner, S.; Soong, T.W. Genetic basis of tetrodotoxin resistance in pufferfishes. Curr. Biol. 2005, 15, 2069–2072. [Google Scholar] [CrossRef]
  33. van Thiel, J.; Khan, M.A.; Wouters, R.M.; Harris, R.J.; Casewell, N.R.; Fry, B.G.; Kini, R.M.; Mackessy, S.P.; Vonk, F.J.; Wüster, W.; et al. Convergent evolution of toxin resistance in animals. Biol. Rev. 2022, 97, 1823–1843. [Google Scholar] [CrossRef]
  34. Hague, M.T.J.; Feldman, C.R.; Brodie, E.D.; Brodie, E.D. Convergent adaptation to dangerous prey proceeds through the same first-step mutation in the garter snake Thamnophis sirtalis. Evolution 2017, 71, 1504–1518. [Google Scholar] [CrossRef] [PubMed]
  35. Brodie, E.D.; Ridenhour, B.J.; Brodie, E.D. The evolutionary response of predators to dangerous prey: Hotspots and coldspots in the geographic mosaic of coevolution between garter snakes and newts. Evolution 2002, 56, 2067–2082. [Google Scholar] [CrossRef] [PubMed]
  36. Vlasenko, A.E.; Magarlamov, T.Y. Tetrodotoxins in ribbon worms Cephalothrix cf. simula and Kulikovia alborostrata from Peter the Great Bay, Sea of Japan. Toxins 2023, 15, 16. [Google Scholar] [CrossRef] [PubMed]
  37. Vlasenko, A.E.; Pereverzeva, A.O.; Velansky, P.V.; Magarlamov, T.Y. Tetrodotoxins in tissues and cells of different body regions of ribbon worms Kulikovia alborostrata and K. manchenkoi from Spokoynaya Bay, Sea of Japan. Toxins 2024, 16, 186. [Google Scholar] [CrossRef]
  38. Carroll, S.; McEvoy, E.G.; Gibson, R. The production of tetrodotoxin-like substances by nemertean worms in conjunction with bacteria. J. Exp. Mar. Bio. Ecol. 2003, 288, 51–63. [Google Scholar] [CrossRef]
  39. Strand, M.; Hedström, M.; Seth, H.; McEvoy, E.G.; Jacobsson, E.; Göransson, U.; Andersson, H.S.; Sundberg, P. The bacterial (Vibrio alginolyticus) production of tetrodotoxin in the ribbon worm Lineus longissimus—Just a false positive? Mar. Drugs 2016, 14, 63. [Google Scholar] [CrossRef]
  40. Geffeney, S.L.; Cordingley, J.A.; Mitchell, K.; Hanifin, C.T. In silico analysis of tetrodotoxin binding in voltage-gated sodium ion channels from toxin-resistant animal lineages. Mar. Drugs 2022, 20, 723. [Google Scholar] [CrossRef]
  41. Matsui, T.; Yamamori, K.; Furukawa, K.; Kono, M. Purification and some properties of a tetrodotoxin binding protein from the blood plasma of kusafugu, Takifugu niphobles. Toxicon 2000, 38, 463–468. [Google Scholar] [CrossRef]
  42. Nagashima, Y.; Yamamoto, K.; Shimakura, K.; Shiomi, K. A tetrodotoxin-binding protein in the hemolymph of shore crab Hemigrapsus sanguineus: Purification and properties. Toxicon 2002, 40, 753–760. [Google Scholar] [CrossRef]
  43. Hwang, P.A.; Tsai, Y.H.; Lin, H.P.; Hwang, D.F. Tetrodotoxin-binding proteins isolated from five species of toxic gastropods. Food Chem. 2007, 103, 1153–1158. [Google Scholar] [CrossRef]
  44. Kwiatkowski, D.; Blaxter, M. The genome sequence of the bootlace worm, Lineus longissimus (Gunnerus, 1770). Wellcome Open Res. 2021, 6, 272. [Google Scholar] [CrossRef] [PubMed]
  45. Boullot, F.; Castrec, J.; Bidault, A.; Dantas, N.; Payton, L.; Perrigault, M.; Tran, D.; Amzil, Z.; Boudry, P.; Soudant, P.; et al. Molecular characterization of voltage-gated sodium channels and their relations with paralytic shellfish toxin bioaccumulation in the pacific oyster Crassostrea gigas. Mar. Drugs 2017, 15, 21. [Google Scholar] [CrossRef] [PubMed]
  46. Chernyshev, A.V.; Polyakova, N.E. Nemerteans collected in the Bering Sea during the research cruises aboard the R/V Akademik, M.A. Lavrentyev in 2016, 2018, and 2021 with an analysis of deep-sea heteronemertean and hoplonemertean species. Deep. Res. Part II Top. Stud. Oceanogr. 2022, 199, 105081. [Google Scholar] [CrossRef]
  47. Folmer, O.; Black, M.; Hoeh, W.; Lutz, R.; Vrijenhoek, R. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol. Mar. Biol. Biotechnol. 1994, 3, 294–299. [Google Scholar]
  48. Palumbi, S.R.; Martin, A.; Romano, S.; McMillan, W.O.; Stice, L.; Grabowski, G. The Simple Dool’s Guide to PCR; University of Hawaii: Honolulu, HI, USA, 1991. [Google Scholar]
  49. Norén, M.; Ulf, J. Phylogeny of the Prolecithophora (Platyhelminthes) Inferred from 18S rDNA Sequences. Cladistics 1999, 15, 103–112. [Google Scholar] [CrossRef]
  50. Giribet, G.; Carranza, S.; Baguñà, J.; Riutort, M.; Ribera, C. First molecular evidence arthropoda clade for the existence of a tardigrada. Mol. Biol. Evol. 1996, 13, 76–84. [Google Scholar] [CrossRef]
  51. Whiting, M.F.; Carpenter, J.C.; Wheeler, Q.D.; Wheeler, W.C. The Strepsiptera problem: Phylogeny of the holometabolous insect orders inferred from 18S and 28S ribosomal DNA sequences and morphology. Syst. Biol. 1997, 46, 1–68. [Google Scholar] [CrossRef]
  52. Katoh, K.; Standley, D.M. MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef]
  53. Vaidya, G.; Lohman, D.J.; Meier, R. SequenceMatrix: Concatenation software for the fast assembly of multi-gene datasets with character set and codon information. Cladistics 2011, 27, 171–180. [Google Scholar] [CrossRef]
  54. Minh, B.Q.; Nguyen, M.A.T.; Von Haeseler, A. Ultrafast approximation for phylogenetic bootstrap. Mol. Biol. Evol. 2013, 30, 1188–1195. [Google Scholar] [CrossRef]
Figure 3. Sampling localities and live specimens of nemerteans from Spokoynaya Bay, Sea of Japan. (a) Geographical location of the sampling sites (asterisk). (b) Habitat of nemertean species. (c) Parahubrechtia rayi (photo provided by A.V. Chernyshev). (d) Kulikovia alborostrata. (e) Kulikovia manchenkoi. (f) Cerebratulus orochi. (g) Micrura bella. Arrows point to head.
Figure 3. Sampling localities and live specimens of nemerteans from Spokoynaya Bay, Sea of Japan. (a) Geographical location of the sampling sites (asterisk). (b) Habitat of nemertean species. (c) Parahubrechtia rayi (photo provided by A.V. Chernyshev). (d) Kulikovia alborostrata. (e) Kulikovia manchenkoi. (f) Cerebratulus orochi. (g) Micrura bella. Arrows point to head.
Ijms 26 11785 g003
Figure 4. Sampling localities and live specimens of nemerteans from the Southern Ocean. (a) Geographical locations of the sampling sites: Parborlasia corrugata (red asterisk) and Heteronemertes longifissa (yellow asterisk). (b) Research vessel Akademik Mstislav Keldysh during trawling. (c) Heteronemertes longifissa. (d) Parborlasia corrugata. Arrows indicate the head.
Figure 4. Sampling localities and live specimens of nemerteans from the Southern Ocean. (a) Geographical locations of the sampling sites: Parborlasia corrugata (red asterisk) and Heteronemertes longifissa (yellow asterisk). (b) Research vessel Akademik Mstislav Keldysh during trawling. (c) Heteronemertes longifissa. (d) Parborlasia corrugata. Arrows indicate the head.
Ijms 26 11785 g004
Table 1. Nemertean species and genes with GenBank accession numbers used for phylogenetic tree construction.
Table 1. Nemertean species and genes with GenBank accession numbers used for phylogenetic tree construction.
Species16S18SCOI
Cerebratulus orochi-PX464474 *PX472899 *
Heteronemertes longifissusOQ449308OQ449295PX463919 *
Hubrechtella ijimaiKF935470KF935303KY986686
Kulikovia alborostrataLC553790LC553802PX463916 *
Kulikovia manchenkoiKU821490-PX463917 *
Kulikovia cf. montgomeryiKU197411-KU197742
Lineus lacteusKX261708-KX261759
Lineus longissimusMK067321MK076323MK047697
Lineus ruberKX261701KY468933GU733828
Lineus sanguineusMK067331MK076333MK047707
Micrura bellaOQ449312OQ449302OQ450494
Notospermus geniculatusLC625660LC625685LC625629
Parborlasia corrugataEU194791-PX463918 *
Carinoma hamanakoKU197313-KU197661
Cephalothrix linearis--GU726652
Cephalothrix simulaOQ075733-PV984388
Cephalothrix cf. simulaPX559980 *PX586769 *PX526497 *
Cephalothrix spiralisKU197338-GU726648
Parahubrechtia rayi--PX463920 *
Tubulanus polymorphusJF277598JF293061KU197697
Amphiprous lactifloreusMN211511MN211417MN205528
Malacobdella grossaMZ231135MZ231197MZ216519
*: Current paper, -: no available data.
Table 2. List of primers used in this study. Forward primer sequences are shown in bold.
Table 2. List of primers used in this study. Forward primer sequences are shown in bold.
Primer NamePrimer SequenceReference
DI1DIFUniRTGCGCMTTYCGMCTYATGACCurrent study
2DI_ForwardATGCGCCTTTCGCCTTATGAC[23]
3DI_ReverseCGGCGTTCTTCCTCTTCCTTT[23]
4RID_improvedCATTCTGATGGACTTTTTGGCACurrent study
5DIFw_csimGTTTTTCAGTCAATGTTTGGCurrent study
6DIRev_csimCGACACTTACTAACTGATACCurrent study
7DIRUniCGGCGYTCYTCYTCTTCCTTTCurrent study
DII8DIIForwardGTCCTYCGAACATTCAGATTGC[23]
9DII reverseAGATTGGAGATTTTCAGCCCC [23]
10DII reverse v2ATGCTTTCAATCCATTCCCCACurrent study
11DIIFw_csimTTCATATTTGCTGTCGTCGGTCurrent study
12DIIRev_csimCTAACACCAAGTCCCCTCAACCurrent study
DIII13DIII forwardGTCTTCTGGCTCATCTTCAGTATCA[23]
14DIII reverseTCAGCGTGAAGAAAGAACCGA[23]
15DIIIFw_paleoCTGGCTKATCTTTAGYATMATGGGCurrent study
16DIIIRev_paleoTACCCCTCTCATRTCSGTYGCurrent study
DIV17DIV ForwardAACATGCTGCCGGGATAGA[23]
18DIV Forward newCGCTAGCGGTTTCACTTCCTCurrent study
19DIV reverseTTGCCGCAGTTACCCTTGAC[23]
20DIV_F_paleo TCCCTGCCTGCCYTMTTCCurrent study
21DIV_R_paleoGTACTGCGTGGCTTCAGGATCCurrent study
Table 3. Primer combinations used for amplification of the four P-loop regions of the nemertean NaV1 channel.
Table 3. Primer combinations used for amplification of the four P-loop regions of the nemertean NaV1 channel.
DI—Primer CombinationsDII—Primer CombinationsDIII—Primer CombinationsDIV—Primer Combinations
Cerebratulus orochiDIFUni + RID_improved
(Ta 57 °C) len 281bp
DIIForward + DII reverse
(Ta 57 °C) len 431bp
DIII forward + DIII reverse
(Ta 57 °C) len 348bp
N/A
Heteronemertes longifissusDI_Forward + DI_Reverse
(Ta 56 °C) len 233bp
DIIForward + DII reverse
(Ta 57 °C) len 431bp
DIII forward + DIII reverse
(Ta 57 °C) len 348bp
N/A
Kulikovia manchenkoiDI_Forward + DI_Reverse
(Ta 56 °C) len 233bp
DIIForward + DII reverse
(Ta 57 °C) len 431bp
DIII forward + DIII reverse
(Ta 57 °C) len 348bp
DIV Forward + DIV reverse
(Ta 56 °C) len 193bp
Kulikovia cf. montgomeryiDI_Forward+ DI_Reverse
(Ta 56 °C) len 233bp
DIIForward + DII reverse
(Ta 57 °C) len 431bp p
DIII forward + DIII reverse
(Ta 57 °C) len 348bp
DIV Forward + DIV reverse
(Ta 56 °C) len 193bp
Micrura bellaDI_Forward+ DI_Reverse
(Ta 56 °C) len 233bp
N/ADIII forward + DIII reverse
(Ta 57 °C) len 348bp
DIV Forward new + DIV reverse
(Ta 57 °C) len 294bp
Parborlasia corrugataDIFUni +DIRUni
(Ta 56 °C) len 233bp
DIIForward + DII reverse v2
(Ta 56 °C) len 295bp
N/AN/A
Parahubrechtia rayiDIFUni+ DI_Reverse
(Ta 52 °C) len 233bp
DIIForward + DII reverse v2
(Ta 56 °C) len 295bp
DIII forward + DIII reverse
(Ta 57 °C) len 348bp
DIV Forward + DIV reverse
(Ta 56 °C) len 193bp
Cephalothrix cf. simulaDIFw_csim +
DIRev_csim
(Ta 47 °C) len 163bp
DIIFw_csim + DIIRev_csim
(Ta 52 °C) len 334bp
DIIIFw_paleo +
DIIIRev_paleo
(Ta 57 °C) len 270 bp
DIV_F_paleo
DIV_R_paleo
(Ta 53 °C) len 464bp
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Kuznetsov, V.G.; Vlasenko, A.E.; Magarlamov, T.Y. Voltage-Gated Sodium Channel Substitutions Underlying Tetrodotoxin Resistance in Nemerteans: Ecological and Evolutionary Implications. Int. J. Mol. Sci. 2025, 26, 11785. https://doi.org/10.3390/ijms262411785

AMA Style

Kuznetsov VG, Vlasenko AE, Magarlamov TY. Voltage-Gated Sodium Channel Substitutions Underlying Tetrodotoxin Resistance in Nemerteans: Ecological and Evolutionary Implications. International Journal of Molecular Sciences. 2025; 26(24):11785. https://doi.org/10.3390/ijms262411785

Chicago/Turabian Style

Kuznetsov, Vasiliy G., Anna E. Vlasenko, and Timur Yu. Magarlamov. 2025. "Voltage-Gated Sodium Channel Substitutions Underlying Tetrodotoxin Resistance in Nemerteans: Ecological and Evolutionary Implications" International Journal of Molecular Sciences 26, no. 24: 11785. https://doi.org/10.3390/ijms262411785

APA Style

Kuznetsov, V. G., Vlasenko, A. E., & Magarlamov, T. Y. (2025). Voltage-Gated Sodium Channel Substitutions Underlying Tetrodotoxin Resistance in Nemerteans: Ecological and Evolutionary Implications. International Journal of Molecular Sciences, 26(24), 11785. https://doi.org/10.3390/ijms262411785

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop