Assessment of Migration of the Urethral Bulking Agent Zhoabex G® from the Urethral Injection Site to the Distant Organs in a Rabbit Model
Abstract
1. Introduction
2. Results
2.1. Gene Expression Analysis of Hyaluronan-Related Genes
2.2. Hyaluronic Acid Concentration Analysis
| Organ | Group | Mean HA Concentration (ng/mL) | ±SD | p-Value (ANOVA) | Significance |
|---|---|---|---|---|---|
| Kidney | Control | 121.8 | 5.2 | 0.577 | Non-significant |
| Sham | 120.5 | 5.2 | |||
| Experimental | 119.2 | 5.2 | |||
| Lung | Control | 99.2 | 4.8 | 0.576 | Non-significant |
| Sham | 98.0 | 4.8 | |||
| Experimental | 96.8 | 4.8 | |||
| Spleen | Control | 109.05 | 5.77 | 0.165 | Non-significant |
| Sham | 105.12 | 5.84 | |||
| Experimental | 104.21 | 4.92 | |||
| Liver | Control | 2.8 | 0.3 | 0.378 | Non-significant |
| Sham | 2.7 | 0.3 | |||
| Experimental | 2.6 | 0.3 |

3. Discussion
4. Materials and Methods
4.1. Experimental Design
4.2. Evaluation of the Migration of Zhoabex G into Distant Organs
4.2.1. RNA Extraction
4.2.2. cDNA Synthesis
4.2.3. Evaluation of the Expression of Hyaluronan Synthase (HAS) Genes in Distant Organs Using Quantitative RT-PCR
4.3. Estimation of Hyaluronic Acid (HA) Concentrations in Distant Organs Using the ELISA Method
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Carroll, T.F.; Christie, A.; Foreman, M.; Kuprasertkul, A.; Khatri, G.; Zimmern, P.E. Formative Macroplastice volume and configuration effect in women with stress urinary incontinence secondary to intrinsic sphincter deficiency: Retrospective review. Low. Urin. Tract. Symptoms 2021, 13, 335–340. [Google Scholar] [CrossRef]
- Potu, B.K.; Rizk, D.; Nasr El-Din, W.A.; Rashid, A.; Marwani, A.M.; Salvatore, S. Microarchitectural changes in the urethral wall after injecting hyaluronic acid based bulking agent (Zhoabex G): An experimental study in New Zealand white female rabbits. Transl. Res. Anat. 2025, 41, 100438. [Google Scholar] [CrossRef]
- Pannek, J.; Brands, F.H.; Senge, T. Particle migration after transurethral needle injection of carbon-coated beads for stress urinary incontinence. J. Urol. 2021, 166, 1350–1353. [Google Scholar] [CrossRef]
- Lee, P.E.; Kung, R.C.; Drutz, H.P. Periurethral autologous fat injection as a treatment for female stress urinary incontinence: Randomized double-blind controlled trial. J. Urol. 2008, 165, 153–158. [Google Scholar] [CrossRef] [PubMed]
- Itano, N.; Chanmee, C.H.; Kimata, T. Hyaluronan synthase 1-3 (HAS1-3). In Handbook of Glycosyltransferases and Related Genes; Taniguchi, N., Honke, K., Fukuda, M., Narimatsu, H., Yamaguchi, Y., Angata, T., Eds.; Springer: Tokyo, Japan, 2014; pp. 605–616. [Google Scholar]
- Wang, J.; Wu, Z.; Cao, L.; Long, F. Differential regulation by hyaluronan acid synthase isoforms in mammalian cells. Biomolecules 2024, 14, 1567. [Google Scholar] [CrossRef]
- Cowman, M.K.; Lee, H.G.; Schwertfeger, K.L.; McCarthy, J.B.; Turley, E.A. The content and size of hyaluronic acid in biological fluids and tissues. Front. Immunol. 2015, 6, 261. [Google Scholar] [CrossRef] [PubMed]
- Stern, R.; Maibach, H.I. Hyaluronan in skin: Aspects and its pharmacological modulation in aging. Clin. Dermatol. 2008, 26, 106–112. [Google Scholar] [CrossRef]
- Armstrong, S.E.; Bell, D.R. Measurement of hyaluronic acid molecular weight in solid tissue using agarose gel electrophoresis methods. Anal. Biochem. 2002, 308, 255–262. [Google Scholar] [CrossRef]
- Fraser, J.R.; Laurent, T.C.; Laurent, U.B. Hyaluronan: Its nature, distribution, functions, and turnover. J. Intern. Med. 1997, 297, 27–33. [Google Scholar] [CrossRef]
- De Boulle, K.; Glogau, R.; Kono, T.; Nathan, M.; Tezel, A.; Roca-Martinez, J.-X.; Paliwal, S.; Stroumpoulis, D. Review of the metabolism of 1,4-butanediol diglycidyl ether-crosslinked hyaluronic acid dermal fillers in tissue engineering. Dermatol. Surg. 2013, 39, 1758–1766. [Google Scholar] [CrossRef] [PubMed]
- Hoe, V.; Haller, B.; Yao, H.H.; O’Connell, H.E. Urethral bulking agents for the treatment of stress urinary incontinence in women: A systematic review. Neurourol. Urodyn. 2021, 40, 1349–1388. [Google Scholar] [CrossRef] [PubMed]
- Chapple, C.; Dmochowski, R. Particulate Versus Non-Particulate Bulking Agents in the Treatment of Stress Urinary Incontinence. Res. Rep. Urol. 2019, 11, 299–310. [Google Scholar] [CrossRef]
- Hussain, S.M.; Bray, R. Urethral bulking agents for female stress urinary incontinence. Neurourol. Urodyn. 2019, 38, 887–892. [Google Scholar] [CrossRef]
- Kirchin, V.; Page, T.; Keegan, P.E.; Atiemo, K.O.; Cody, J.D.; McClinton, S.; Aluko, P. Urethral injection therapy for urinary incontinence in women. Cochrane Database Syst. Rev. 2017, 7, CD003881. [Google Scholar] [CrossRef]
- Peltokallio, N.M.M.; Noël, S.; Bolen, G.; Kuure, S.; Raussi-Lehto, E.; Reyes, G.; Ajdary, R.; Kuula, J.; Hamaide, A.; Laitinen-Vapaavuori, O.M. In vivo biocompatibility and long-term durability of nanofibrillated cellulose as a urethral bulking agent in rats and Beagle dogs. PLoS ONE 2025, 20, e0317859. [Google Scholar] [CrossRef]
- Mann-Gow, T.K.; Blaivas, J.G.; King, B.J.; El-Ghannam, A.; Knabe, C.; Lam, M.K.; Kida, M.; Sikavi, C.S.; Plante, M.K.; Krhut, J.; et al. Rat animal model for preclinical testing of microparticle urethral bulking agents. Int. J. Urol. 2015, 22, 416–420. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Tan, X.; Li, G.; Li, C.; Kong, C.; Li, H.; Wu, S. Animal models, treatment options, and biomaterials for female stress urinary incontinence. Front. Bioeng. Biotechnol. 2024, 12, 1414323. [Google Scholar] [CrossRef]
- Malizia, A.A.; Reiman, H.M., Jr.; Myers, R.P.; Sande, J.R.; Barham, S.S.; Benson, R.C.; Dewanjee, M.K., Jr.; Utz, W.J. Migration and granulomatous reaction after periurethral injection of polytef (Teflon). JAMA 1984, 251, 3277–3281. [Google Scholar] [CrossRef]
- Henly, D.R.; Barrett, D.M.; Weiland, T.L.; O’Connor, M.K.; Malizia, A.A.; Wein, A.J. Particulate silicone for use in periurethral injections: Local tissue effects and search for migration. J. Urol. 1995, 153, 2039–2043. [Google Scholar] [CrossRef]
- Lightner, D.; Rovner, E.; Corcos, J.; Payne, C.; Brubaker, L.; Drutz, H.; Steinhoff, G.; Zuidex Study Group. Randomized controlled multisite trial of injected bulking agents for women with intrinsic sphincter deficiency: Mid-urethral injection of Zuidex via the Implacer versus proximal urethral injection of Contigen cystoscopically. Urology 2009, 74, 771–775. [Google Scholar] [CrossRef]
- ZHOABEX Biocompatibility Summary. Rev.1 of 13/12/2021; P 1-8: P 7.
- Serati, M.; Braga, A.; Salvatore, S.; Torella, M.; Di Dedda, M.C.; Scancarello, C.; Cimmino, C.; De Rosa, A.; Frigerio, M.; Candiani, M.; et al. Up-to-Date Procedures in Female Stress Urinary Incontinence Surgery: A Concise Review on Bulking Agents Procedures. Medicina 2022, 58, 775. [Google Scholar] [CrossRef] [PubMed]
- Zheng, Y.; Rovner, E. Update on Urethral Bulking for Stress Urinary Incontinence in Women. Curr. Urol. Rep. 2022, 23, 203–209. [Google Scholar] [CrossRef] [PubMed]

| Organ | Group | HAS1 | HAS2 | HAS3 | HYAL2 | p-Value | Significance |
|---|---|---|---|---|---|---|---|
| Kidney | Control | 1.062 ± 0.193 | 1.034 ± 0.106 | 1.153 ± 0.280 | 1.112 ± 0.206 | 0.175–0.882 | Non-significant |
| Sham | 1.000 ± 0.000 | 1.000 ± 0.000 | 1.000 ± 0.000 | 1.000 ± 0.000 | |||
| Experimental | 1.040 ± 0.309 | 0.987 ± 0.071 | 1.005 ± 0.118 | 1.031 ± 0.138 | |||
| Lung | Control | 0.926 ± 0.173 | 0.887 ± 0.097 | 0.886 ± 0.095 | 0.889 ± 0.096 | 0.166–0.892 | Non-significant |
| Sham | 0.825 ± 0.000 | 0.825 ± 0.000 | 0.825 ± 0.000 | 0.825 ± 0.000 | |||
| Experimental | 0.878 ± 0.149 | 0.895 ± 0.295 | 0.936 ± 0.091 | 0.968 ± 0.110 | |||
| Liver | Control | 0.015 ± 0.007 | 0.013 ± 0.002 | 0.014 ± 0.015 | 0.014 ± 0.007 | 0.316–0.997 | Non-significant |
| Sham | 0.015 ± 0.000 | 0.015 ± 0.000 | 0.015 ± 0.000 | 0.015 ± 0.000 | |||
| Experimental | 0.015 ± 0.004 | 0.016 ± 0.004 | 0.015 ± 0.008 | 0.015 ± 0.004 | |||
| Spleen | Control | 1.007 ± 0.145 | 0.951 ± 0.109 | 0.941 ± 0.094 | 0.984 ± 0.123 | 0.256–0.914 | Non-significant |
| Sham | 0.913 ± 0.000 | 0.913 ± 0.000 | 0.913 ± 0.000 | 0.913 ± 0.000 | |||
| Experimental | 1.014 ± 0.093 | 0.931 ± 0.105 | 1.031 ± 0.087 | 0.993 ± 0.068 |
| Sequence (5′->3′) | Template Strand | Tm | GC% | Product Length |
|---|---|---|---|---|
| HAS1 Forward | GGAGAAGGAGAAGCCAGGATTGG | 62.58 | 56.52 | 71 bp |
| HAS1 Reverse | CACCAGACAGACTCCCTTCCC | 61.78 | 61.90 | |
| HAS2 Forward | TTTGGGTGTGTCCAGTGCAT | 60.11 | 50.00 | 154 bp |
| HAS2 Reverse | CCAGACTCAGCACTCGGTTT | 59.97 | 55.00 | |
| HAS3 Forward | GTGCCAGTCCTACTTTGGCT | 59.96 | 55.00 | 164 bp |
| HAS3 Reverse | GACTCAGGACTCGGTTGGTG | 60.04 | 60.00 | |
| HYAL2 Forward | ACGTGGTCAATGTGTCCTGG | 60.25 | 55.00 | 103 bp |
| HYAL 2 Reverse | TGCAGGAAGGTATTGGCGTT | 59.96 | 50.00 | |
| GAPDH Forward | CCGAGACACGATGGTGAAGG | 60.46 | 60.00 | 185 bp |
| GAPDH Reverse | TGATGGCGACAACATCCACT | 59.68 | 50.00 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Potu, B.K.; Rizk, D.; Aljishi, M.; Sultan, A.; Nasr El-Din, W.A.; Salvatore, S.; Taha, S. Assessment of Migration of the Urethral Bulking Agent Zhoabex G® from the Urethral Injection Site to the Distant Organs in a Rabbit Model. Int. J. Mol. Sci. 2025, 26, 10286. https://doi.org/10.3390/ijms262110286
Potu BK, Rizk D, Aljishi M, Sultan A, Nasr El-Din WA, Salvatore S, Taha S. Assessment of Migration of the Urethral Bulking Agent Zhoabex G® from the Urethral Injection Site to the Distant Organs in a Rabbit Model. International Journal of Molecular Sciences. 2025; 26(21):10286. https://doi.org/10.3390/ijms262110286
Chicago/Turabian StylePotu, Bhagath Kumar, Diaa Rizk, Muna Aljishi, Ameera Sultan, Wael Amin Nasr El-Din, Stefano Salvatore, and Safa Taha. 2025. "Assessment of Migration of the Urethral Bulking Agent Zhoabex G® from the Urethral Injection Site to the Distant Organs in a Rabbit Model" International Journal of Molecular Sciences 26, no. 21: 10286. https://doi.org/10.3390/ijms262110286
APA StylePotu, B. K., Rizk, D., Aljishi, M., Sultan, A., Nasr El-Din, W. A., Salvatore, S., & Taha, S. (2025). Assessment of Migration of the Urethral Bulking Agent Zhoabex G® from the Urethral Injection Site to the Distant Organs in a Rabbit Model. International Journal of Molecular Sciences, 26(21), 10286. https://doi.org/10.3390/ijms262110286

