Hibiscus syriacus Bud ‘Pyeonghwa’ Water Extract Inhibits Adipocyte Differentiation and Mitigates High-Fat-Diet-Induced Obesity In Vivo
Abstract
1. Introduction
2. Results
2.1. HPWE Suppresses Lipid Accumulation in 3T3-L1 Cells
2.2. HPWE Attenuates the Expression of Molecular Markers Associated with Adipocyte Differentiation in 3T3-L1 Cells
2.3. HPWE Inhibits Body Weight Gain in Mice Fed a High-Fat Diet
2.4. HPWE Decreases Epididymal White Adipose Tissue in Subjects Fed a High-Fat Diet
2.5. LC-MS Profiling of Saponarin in HPWE
3. Discussion
4. Materials and Methods
4.1. Preparation of HPWE
4.2. Reagents and Antibodies
4.3. Cell Culture
4.4. Cell Viability Assay
4.5. Oil Red O Staining
4.6. RNA Isolation and Reverse Transcription-Quantitative Polymerase Chain Reaction (RT-qPCR)
4.7. Western Blotting
4.8. Animal Experiments
4.9. ARRIVE Guidelines
4.10. Morphology of Adipose Tissue Samples
4.11. Microcomputed Tomography (Micro-CT)
4.12. Haematoxylin and Eosin Staining
4.13. Liquid Chromatography-Mass Spectrometry (LC-MS/MS)
4.14. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- WHO. Obesity and Overweight. Available online: https://www.who.int/news-room/fact-sheets/detail/obesity-and-overweight (accessed on 8 August 2024).
- Adesina, A.F.; Peterside, O.; Anochie, I.; Akani, N.A. Weight status of adolescents in secondary schools in port Harcourt using Body Mass Index (BMI). Ital. J. Pediatr. 2012, 38, 31. [Google Scholar] [CrossRef]
- Caballero, B. Humans against Obesity: Who Will Win? Adv. Nutr. 2019, 10, S4–S9. [Google Scholar] [CrossRef] [PubMed]
- Purnell, J.Q. Definitions, Classification, and Epidemiology of Obesity. In Endotext; Feingold, K.R., Anawalt, B., Blackman, M.R., Boyce, A., Chrousos, G., Corpas, E., de Herder, W.W., Dhatariya, K., Dungan, K., Hofland, J., et al., Eds.; MDText.com, Inc.: Dartmouth, MA, USA, 2000. [Google Scholar]
- Bluher, M. Obesity: Global epidemiology and pathogenesis. Nat. Rev. Endocrinol. 2019, 15, 288–298. [Google Scholar] [CrossRef] [PubMed]
- Collaboration, N.C.D.R.F. Worldwide trends in body-mass index, underweight, overweight, and obesity from 1975 to 2016: A pooled analysis of 2416 population-based measurement studies in 128.9 million children, adolescents, and adults. Lancet 2017, 390, 2627–2642. [Google Scholar] [CrossRef]
- Censin, J.C.; Peters, S.A.E.; Bovijn, J.; Ferreira, T.; Pulit, S.L.; Magi, R.; Mahajan, A.; Holmes, M.V.; Lindgren, C.M. Causal relationships between obesity and the leading causes of death in women and men. PLoS Genet. 2019, 15, e1008405. [Google Scholar] [CrossRef]
- Vliora, M.; Ravelli, C.; Grillo, E.; Corsini, M.; Flouris, A.D.; Mitola, S. The impact of adipokines on vascular networks in adipose tissue. Cytokine Growth Factor Rev. 2023, 69, 61–72. [Google Scholar] [CrossRef]
- Hall, K.D.; Kahan, S. Maintenance of Lost Weight and Long-Term Management of Obesity. Med. Clin. N. Am. 2018, 102, 183–197. [Google Scholar] [CrossRef]
- Aaseth, J.; Ellefsen, S.; Alehagen, U.; Sundfor, T.M.; Alexander, J. Diets and drugs for weight loss and health in obesity—An update. Biomed. Pharmacother. 2021, 140, 111789. [Google Scholar] [CrossRef]
- Jakab, J.; Miskic, B.; Miksic, S.; Juranic, B.; Cosic, V.; Schwarz, D.; Vcev, A. Adipogenesis as a Potential Anti-Obesity Target: A Review of Pharmacological Treatment and Natural Products. Diabetes Metab. Syndr. Obes. 2021, 14, 67–83. [Google Scholar] [CrossRef]
- Tang, Q.Q.; Lane, M.D. Adipogenesis: From stem cell to adipocyte. Annu. Rev. Biochem. 2012, 81, 715–736. [Google Scholar] [CrossRef]
- Matsushita, K.; Dzau, V.J. Mesenchymal stem cells in obesity: Insights for translational applications. Lab. Investig. 2017, 97, 1158–1166. [Google Scholar] [CrossRef]
- Li, S.; Raza, S.H.A.; Zhao, C.; Cheng, G.; Zan, L. Overexpression of PLIN1 Promotes Lipid Metabolism in Bovine Adipocytes. Animals 2020, 10, 1944. [Google Scholar] [CrossRef]
- Robert, A.W.; Marcon, B.H.; Dallagiovanna, B.; Shigunov, P. Adipogenesis, Osteogenesis, and Chondrogenesis of Human Mesenchymal Stem/Stromal Cells: A Comparative Transcriptome Approach. Front. Cell Dev. Biol. 2020, 8, 561. [Google Scholar] [CrossRef]
- Cable, J.C.; Tan, G.D.; Alexander, S.P.; O’Sullivan, S.E. The effects of obesity, diabetes and metabolic syndrome on the hydrolytic enzymes of the endocannabinoid system in animal and human adipocytes. Lipids Health Dis. 2014, 13, 43. [Google Scholar] [CrossRef]
- Zhuang, H.; Zhang, X.; Zhu, C.; Tang, X.; Yu, F.; Shang, G.W.; Cai, X. Molecular Mechanisms of PPAR-gamma Governing MSC Osteogenic and Adipogenic Differentiation. Curr. Stem Cell Res. Ther. 2016, 11, 255–264. [Google Scholar] [CrossRef] [PubMed]
- Jeon, H.; Lee, C.G.; Jeong, H.; Yun, S.H.; Kim, J.; Uprety, L.P.; Oh, K.I.; Singh, S.; Yoo, J.; Park, E.; et al. Inhibitory Effects of Loganin on Adipogenesis In Vitro and In Vivo. Int. J. Mol. Sci. 2023, 24, 4752. [Google Scholar] [CrossRef] [PubMed]
- Cave, E.; Crowther, N.J. The Use of 3T3-L1 Murine Preadipocytes as a Model of Adipogenesis. Methods Mol. Biol. 2019, 1916, 263–272. [Google Scholar] [CrossRef] [PubMed]
- Speakman, J.R. Use of high-fat diets to study rodent obesity as a model of human obesity. Int. J. Obes. 2019, 43, 1491–1492. [Google Scholar] [CrossRef]
- He, M.Q.; Wang, J.Y.; Wang, Y.; Sui, J.; Zhang, M.; Ding, X.; Zhao, Y.; Chen, Z.Y.; Ren, X.X.; Shi, B.Y. High-fat diet-induced adipose tissue expansion occurs prior to insulin resistance in C57BL/6J mice. Chronic Dis. Transl. Med. 2020, 6, 198–207. [Google Scholar] [CrossRef]
- Moreno-Indias, I.; Tinahones, F.J. Impaired adipose tissue expandability and lipogenic capacities as ones of the main causes of metabolic disorders. J. Diabetes Res. 2015, 2015, 970375. [Google Scholar] [CrossRef]
- Saullo, C.; Cruz, L.L.D.; Damasceno, D.C.; Volpato, G.T.; Sinzato, Y.K.; Karki, B.; Gallego, F.Q.; Vesentini, G. Effects of a maternal high-fat diet on adipose tissue in murine offspring: A systematic review and meta-analysis. Biochimie 2022, 201, 18–32. [Google Scholar] [CrossRef]
- Yuan, H.; Ma, Q.; Ye, L.; Piao, G. The Traditional Medicine and Modern Medicine from Natural Products. Molecules 2016, 21, 559. [Google Scholar] [CrossRef]
- Park, Y.; Kwon, S.H.; Jang, Y.L.; Lee, D.H.; Yang, S.O.; Eo, H.J.; Park, G.H.; Kwon, H.Y. Nutritional composition and phytochemical screening in different parts of Hibiscus syriacus L. Food Sci. Nutr. 2022, 10, 3034–3042. [Google Scholar] [CrossRef]
- Matsuda, H.; Nakamura, S.; Morikawa, T.; Muraoka, O.; Yoshikawa, M. New biofunctional effects of the flower buds of Camellia sinensis and its bioactive acylated oleanane-type triterpene oligoglycosides. J. Nat. Med. 2016, 70, 689–701. [Google Scholar] [CrossRef] [PubMed]
- Zhang, S.; Chen, C.; Lu, W.; Wei, L. Phytochemistry, pharmacology, and clinical use of Panax notoginseng flowers buds. Phytother. Res. 2018, 32, 2155–2163. [Google Scholar] [CrossRef] [PubMed]
- Ojulari, O.V.; Lee, S.G.; Nam, J.O. Beneficial Effects of Natural Bioactive Compounds from Hibiscus sabdariffa L. on Obesity. Molecules 2019, 24, 210. [Google Scholar] [CrossRef]
- Carvajal-Zarrabal, O.; Hayward-Jones, P.M.; Orta-Flores, Z.; Nolasco-Hipolito, C.; Barradas-Dermitz, D.M.; Aguilar-Uscanga, M.G.; Pedroza-Hernandez, M.F. Effect of Hibiscus sabdariffa L. dried calyx ethanol extract on fat absorption-excretion, and body weight implication in rats. J. Biotechnol. Biomed. 2009, 2009, 394592. [Google Scholar] [CrossRef]
- Chang, H.C.; Peng, C.H.; Yeh, D.M.; Kao, E.S.; Wang, C.J. Hibiscus sabdariffa extract inhibits obesity and fat accumulation, and improves liver steatosis in humans. Food Funct. 2014, 5, 734–739. [Google Scholar] [CrossRef]
- Donno, D.; Beccaro, G.L.; Cerutti, A.K.; Mellano, M.G.; Bounous, G. Bud Extracts as New Phytochemical Source for Herbal Preparations—Quality Control and Standardization by Analytical Fingerprint. In Phytochemicals-Isolation, Characterisation and Role in Human Health; IntechOpen: London, UK, 2015. [Google Scholar] [CrossRef]
- Farmer, S.R. Transcriptional control of adipocyte formation. Cell Metab. 2006, 4, 263–273. [Google Scholar] [CrossRef]
- Rosen, E.D.; Sarraf, P.; Troy, A.E.; Bradwin, G.; Moore, K.; Milstone, D.S.; Spiegelman, B.M.; Mortensen, R.M. PPAR gamma is required for the differentiation of adipose tissue in vivo and in vitro. Mol. Cell 1999, 4, 611–617. [Google Scholar] [CrossRef]
- Rosen, E.D.; Hsu, C.H.; Wang, X.; Sakai, S.; Freeman, M.W.; Gonzalez, F.J.; Spiegelman, B.M. C/EBPalpha induces adipogenesis through PPARgamma: A unified pathway. Genes Dev. 2002, 16, 22–26. [Google Scholar] [CrossRef]
- Kim, M.S.; Kim, J.K.; Kim, H.J.; Moon, S.R.; Shin, B.C.; Park, K.W.; Yang, H.O.; Kim, S.M.; Park, R. Hibiscus extract inhibits the lipid droplet accumulation and adipogenic transcription factors expression of 3T3-L1 preadipocytes. J. Altern. Complement. Med. 2003, 9, 499–504. [Google Scholar] [CrossRef]
- Choi, J.S.; Kim, J.H.; Ali, M.Y.; Min, B.S.; Kim, G.D.; Jung, H.A. Coptis chinensis alkaloids exert anti-adipogenic activity on 3T3-L1 adipocytes by downregulating C/EBP-alpha and PPAR-gamma. Fitoterapia 2014, 98, 199–208. [Google Scholar] [CrossRef] [PubMed]
- Lluch, A.; Latorre, J.; Fernandez-Real, J.M.; Moreno-Navarrete, J.M. Lysozyme Gene Expression in 3T3-L1 Cells Sustains Expression of Adipogenic Genes and Adipocyte Differentiation. Front. Cell Dev. Biol. 2022, 10, 914788. [Google Scholar] [CrossRef] [PubMed]
- Furuhashi, M.; Saitoh, S.; Shimamoto, K.; Miura, T. Fatty Acid-Binding Protein 4 (FABP4): Pathophysiological Insights and Potent Clinical Biomarker of Metabolic and Cardiovascular Diseases. Clin. Med. Insights Cardiol. 2014, 8, 23–33. [Google Scholar] [CrossRef] [PubMed]
- Ahn, K.; Johnson, D.S.; Cravatt, B.F. Fatty acid amide hydrolase as a potential therapeutic target for the treatment of pain and CNS disorders. Expert Opin. Drug Discov. 2009, 4, 763–784. [Google Scholar] [CrossRef]
- Kim, H.J.; Choi, E.J.; Kim, H.S.; Choi, C.W.; Choi, S.W.; Kim, S.L.; Seo, W.D.; Do, S.H. Germinated soy germ extract ameliorates obesity through beige fat activation. Food Funct. 2019, 10, 836–848. [Google Scholar] [CrossRef]
- De Nardo, D.; Labzin, L.I.; Kono, H.; Seki, R.; Schmidt, S.V.; Beyer, M.; Xu, D.; Zimmer, S.; Lahrmann, C.; Schildberg, F.A.; et al. High-density lipoprotein mediates anti-inflammatory reprogramming of macrophages via the transcriptional regulator ATF3. Nat. Immunol. 2014, 15, 152–160. [Google Scholar] [CrossRef]
- Martins, T.; Castro-Ribeiro, C.; Lemos, S.; Ferreira, T.; Nascimento-Gonçalves, E.; Rosa, E.; Oliveira, P.A.; Antunes, L.M. Murine Models of Obesity. Obesities 2022, 2, 127–147. [Google Scholar] [CrossRef]
- Dai, B.; Xu, J.; Li, X.; Huang, L.; Hopkins, C.; Wang, H.; Yao, H.; Mi, J.; Zheng, L.; Wang, J.; et al. Macrophages in epididymal adipose tissue secrete osteopontin to regulate bone homeostasis. Nat. Commun. 2022, 13, 427. [Google Scholar] [CrossRef]
- Drolet, R.; Richard, C.; Sniderman, A.D.; Mailloux, J.; Fortier, M.; Huot, C.; Rheaume, C.; Tchernof, A. Hypertrophy and hyperplasia of abdominal adipose tissues in women. Int. J. Obes. 2008, 32, 283–291. [Google Scholar] [CrossRef]
- Kim, Y.R.; Lee, S.Y.; Lee, S.M.; Shim, I.; Lee, M.Y. Effect of Hibiscus syriacus Linnaeus extract and its active constituent, saponarin, in animal models of stress-induced sleep disturbances and pentobarbital-induced sleep. Biomed. Pharmacother. 2022, 146, 112301. [Google Scholar] [CrossRef]
- Kim, M.-J.; Lee, H.-J.; Seo, J.-W.; Kim, S.-H.; Kim, M.-J.; Kim, Y.-M.; Kim, J.-T.; Kawk, H.-W.; Jang, S.-H. Anti-Obesity Effect of Hot Water Extract of Barley Sprout through the Inhibition of Adipocyte Differentiation and Growth. Metabolites 2021, 11, 610. [Google Scholar] [CrossRef]
- Rozen, S.; Skaletsky, H. Primer3 on the WWW for general users and for biologist programmers. Methods Mol. Biol. 2000, 132, 365–386. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]





| Target Gene | Forward Primer (5′–3′) | Reverse Primer (5′–3′) |
|---|---|---|
| C/EBPα | GAACAGCAACGAGTACCGGGT | GCCATGGCCTTGACCAAGGAG |
| PPARγ | GCCTTTTGGTGACTTTATGGA | GTAGCAGGTTGTCTTGAATG |
| FABP4 | GGATGGAAAGTCGACCACAA | TGGAAGTCACGCCTTTCATA |
| FAAH | ACTTGGACGTGGTGCTAACC | GCCTATACCCTTTTTCATGCCC |
| Plin 1 | GCGGAATTTGCTGCCAACACTC | AGACTTCTGGGCTTGCTGGTGT |
| β-Actin | AGGCTGTGCTGTCCCTGTAT | ACCCAAGAAGGAAGGCTGGA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kim, S.-H.; Shin, H.-L.; Son, T.H.; Kim, D.; Kwon, H.-Y.; Shin, H.; Park, Y.; Choi, S.-W. Hibiscus syriacus Bud ‘Pyeonghwa’ Water Extract Inhibits Adipocyte Differentiation and Mitigates High-Fat-Diet-Induced Obesity In Vivo. Int. J. Mol. Sci. 2025, 26, 9870. https://doi.org/10.3390/ijms26209870
Kim S-H, Shin H-L, Son TH, Kim D, Kwon H-Y, Shin H, Park Y, Choi S-W. Hibiscus syriacus Bud ‘Pyeonghwa’ Water Extract Inhibits Adipocyte Differentiation and Mitigates High-Fat-Diet-Induced Obesity In Vivo. International Journal of Molecular Sciences. 2025; 26(20):9870. https://doi.org/10.3390/ijms26209870
Chicago/Turabian StyleKim, Shin-Hye, Hye-Lim Shin, Tae Hyun Son, Dongsoo Kim, Hae-Yun Kwon, Hanna Shin, Yunmi Park, and Sik-Won Choi. 2025. "Hibiscus syriacus Bud ‘Pyeonghwa’ Water Extract Inhibits Adipocyte Differentiation and Mitigates High-Fat-Diet-Induced Obesity In Vivo" International Journal of Molecular Sciences 26, no. 20: 9870. https://doi.org/10.3390/ijms26209870
APA StyleKim, S.-H., Shin, H.-L., Son, T. H., Kim, D., Kwon, H.-Y., Shin, H., Park, Y., & Choi, S.-W. (2025). Hibiscus syriacus Bud ‘Pyeonghwa’ Water Extract Inhibits Adipocyte Differentiation and Mitigates High-Fat-Diet-Induced Obesity In Vivo. International Journal of Molecular Sciences, 26(20), 9870. https://doi.org/10.3390/ijms26209870

