Acute Severe Hypoxia Decreases Mitochondrial Chain Complex II Respiration in Human Peripheral Blood Mononuclear Cells
Abstract
1. Introduction
2. Results
2.1. Subjects’ Baseline Clinical Characteristics and Cardiorespiratory Effects of Hypoxia
2.2. Severe Hypoxia Significantly and Specifically Reduced Complex II of the Mitochondrial Respiratory Chain Respiration
2.3. H2O2 Production Was Not Modified by Hypoxia
2.4. OXPHOS Complex II Activity in Hypoxia Is Inversely Correlated to SUCNR1, HIF-1α, ISG15 and CXCL9 Gene Expression in PBMCs
3. Discussion
3.1. Cardiorespiratory Responses to Hypoxia
3.2. Effects of Hypoxia on PBMCs’ Mitochondrial Respiration
3.2.1. Global Mitochondrial Respiration and ETC Complex Respiration
3.2.2. Mitochondrial Complex II Respiration and Link to Inflammation and HIF-1α
3.3. Decreased PBMCs’ CII Respiration Is Associated with Increased Succinate Receptor 1, HIF-1α Activation and Markers of Inflammation
3.4. Effects of Hypoxia on H2O2 Production by PBMCs
3.5. Limitations
4. Material and Methods
4.1. Population and Methods
4.2. Study Design
4.3. Determined Parameters
4.3.1. Clinical Parameters
4.3.2. Mitochondrial Respiration of PBMCs
4.3.3. Measurement of Mitochondrial H2O2 Production
4.4. RT-PCR
4.5. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Burtscher, M.; Niedermeier, M.; Burtscher, J.; Pesta, D.; Suchy, J.; Strasser, B. Preparation for Endurance Competitions at Altitude: Physiological, Psychological, Dietary and Coaching Aspects. A Narrative Review. Front. Physiol. 2018, 9, 1504. [Google Scholar] [CrossRef]
- Millet, G.P.; Debevec, T.; Brocherie, F.; Malatesta, D.; Girard, O. Therapeutic Use of Exercising in Hypoxia: Promises and Limitations. Front. Physiol. 2016, 7, 224. [Google Scholar] [CrossRef] [PubMed]
- Sommer, N.; Dietrich, A.; Schermuly, R.T.; Ghofrani, H.A.; Gudermann, T.; Schulz, R.; Seeger, W.; Grimminger, F.; Weissmann, N. Regulation of Hypoxic Pulmonary Vasoconstriction: Basic Mechanisms. Eur. Respir. J. 2008, 32, 1639–1651. [Google Scholar] [CrossRef] [PubMed]
- Buck, M.D.; Sowell, R.T.; Kaech, S.M.; Pearce, E.L. Metabolic Instruction of Immunity. Cell 2017, 169, 570–586. [Google Scholar] [CrossRef] [PubMed]
- Alexovič, M.; Uličná, C.; Sabo, J.; Davalieva, K. Human Peripheral Blood Mononuclear Cells as a Valuable Source of Disease-Related Biomarkers: Evidence from Comparative Proteomics Studies. Proteom. Clin. Appl. 2024, 18, e2300072. [Google Scholar] [CrossRef]
- Ederle, C.; Charles, A.-L.; Khayath, N.; Poirot, A.; Meyer, A.; Clere-Jehl, R.; Andres, E.; De Blay, F.; Geny, B. Mitochondrial Function in Peripheral Blood Mononuclear Cells (PBMC) Is Enhanced, Together with Increased Reactive Oxygen Species, in Severe Asthmatic Patients in Exacerbation. J. Clin. Med. 2019, 8, 1613. [Google Scholar] [CrossRef]
- Domínguez-Mozo, M.I.; García-Frontini Nieto, M.C.; Gómez-Calcerrada, M.I.; Pérez-Pérez, S.; García-Martínez, M.Á.; Villar, L.M.; Villarrubia, N.; Costa-Frossard, L.; Arroyo, R.; Alvarez-Lafuente, R. Mitochondrial Impairments in Peripheral Blood Mononuclear Cells of Multiple Sclerosis Patients. Biology 2022, 11, 1633. [Google Scholar] [CrossRef]
- Zhou, B.; Wang, D.D.-H.; Qiu, Y.; Airhart, S.; Liu, Y.; Stempien-Otero, A.; O’Brien, K.D.; Tian, R. Boosting NAD Level Suppresses Inflammatory Activation of PBMCs in Heart Failure. J. Clin. Invest. 2020, 130, 6054–6063. [Google Scholar] [CrossRef]
- Clere-Jehl, R.; Helms, J.; Kassem, M.; Le Borgne, P.; Delabranche, X.; Charles, A.-L.; Geny, B.; Meziani, F.; Bilbault, P. Septic Shock Alters Mitochondrial Respiration of Lymphoid Cell-Lines and Human Peripheral Blood Mononuclear Cells: The Role of Plasma. Shock 2019, 51, 97–104. [Google Scholar] [CrossRef]
- Alfatni, A.; Riou, M.; Charles, A.-L.; Meyer, A.; Barnig, C.; Andres, E.; Lejay, A.; Talha, S.; Geny, B. Peripheral Blood Mononuclear Cells and Platelets Mitochondrial Dysfunction, Oxidative Stress, and Circulating mtDNA in Cardiovascular Diseases. J. Clin. Med. 2020, 9, 311. [Google Scholar] [CrossRef]
- Sauer, F.; Riou, M.; Charles, A.-L.; Meyer, A.; Andres, E.; Geny, B.; Talha, S. Pathophysiology of Heart Failure: A Role for Peripheral Blood Mononuclear Cells Mitochondrial Dysfunction? J. Clin. Med. 2022, 11, 741. [Google Scholar] [CrossRef] [PubMed]
- Korepanov, V.A.; Atabekov, T.A.; Rebrova, T.Y.; Batalov, R.E.; Afanasiev, S.A. Relationship between Mitochondrial Respiratory Dysfunction of Blood Mononuclear Cells and Heart Failure Severity. J. Geriatr. Cardiol. 2024, 21, 130–134. [Google Scholar] [CrossRef] [PubMed]
- Riou, M.; Alfatni, A.; Charles, A.-L.; Andres, E.; Pistea, C.; Charloux, A.; Geny, B. New Insights into the Implication of Mitochondrial Dysfunction in Tissue, Peripheral Blood Mononuclear Cells, and Platelets during Lung Diseases. J. Clin. Med. 2020, 9, 1253. [Google Scholar] [CrossRef] [PubMed]
- Li, P.; Wang, B.; Sun, F.; Li, Y.; Li, Q.; Lang, H.; Zhao, Z.; Gao, P.; Zhao, Y.; Shang, Q.; et al. Mitochondrial Respiratory Dysfunctions of Blood Mononuclear Cells Link with Cardiac Disturbance in Patients with Early-Stage Heart Failure. Sci. Rep. 2015, 5, 10229. [Google Scholar] [CrossRef]
- Alfatni, A.; Charles, A.-L.; Sauer, F.; Riou, M.; Goupilleau, F.; Talha, S.; Meyer, A.; Andres, E.; Kindo, M.; Mazzucotelli, J.-P.; et al. Peripheral Blood Mononuclear Cells Mitochondrial Respiration and Superoxide Anion after Heart Transplantation. J. Clin. Med. 2022, 11, 7247. [Google Scholar] [CrossRef]
- McElroy, G.S.; Chandel, N.S. Mitochondria Control Acute and Chronic Responses to Hypoxia. Exp. Cell Res. 2017, 356, 217–222. [Google Scholar] [CrossRef]
- Weinberg, S.E.; Sena, L.A.; Chandel, N.S. Mitochondria in the Regulation of Innate and Adaptive Immunity. Immunity 2015, 42, 406–417. [Google Scholar] [CrossRef]
- Sies, H.; Belousov, V.V.; Chandel, N.S.; Davies, M.J.; Jones, D.P.; Mann, G.E.; Murphy, M.P.; Yamamoto, M.; Winterbourn, C. Defining Roles of Specific Reactive Oxygen Species (ROS) in Cell Biology and Physiology. Nat. Rev. Mol. Cell Biol. 2022, 23, 499–515. [Google Scholar] [CrossRef]
- Pham, K.; Frost, S.; Parikh, K.; Puvvula, N.; Oeung, B.; Heinrich, E.C. Inflammatory Gene Expression during Acute High-Altitude Exposure. J. Physiol. 2022, 600, 4169–4186. [Google Scholar] [CrossRef]
- Taylor, C.T. Interdependent Roles for Hypoxia Inducible Factor and Nuclear Factor-kappaB in Hypoxic Inflammation. J. Physiol. 2008, 586, 4055–4059. [Google Scholar] [CrossRef]
- Weir, E.K.; Lopez-Barneo, J.; Buckler, K.J.; Archer, S.L. Acute Oxygen-Sensing Mechanisms. N. Engl. J. Med. 2005, 353, 2042–2055. [Google Scholar] [CrossRef] [PubMed]
- Germanova, E.; Khmil, N.; Pavlik, L.; Mikheeva, I.; Mironova, G.; Lukyanova, L. The Role of Mitochondrial Enzymes, Succinate-Coupled Signaling Pathways and Mitochondrial Ultrastructure in the Formation of Urgent Adaptation to Acute Hypoxia in the Myocardium. Int. J. Mol. Sci. 2022, 23, 14248. [Google Scholar] [CrossRef] [PubMed]
- Lukyanova, L.D.; Kirova, Y.I. Mitochondria-Controlled Signaling Mechanisms of Brain Protection in Hypoxia. Front. Neurosci. 2015, 9, 320. [Google Scholar] [CrossRef] [PubMed]
- Tan, A.S.; Baty, J.W.; Berridge, M.V. The Role of Mitochondrial Electron Transport in Tumorigenesis and Metastasis. Biochim. Biophys. Acta 2014, 1840, 1454–1463. [Google Scholar] [CrossRef]
- Boucherat, O.; Vitry, G.; Trinh, I.; Paulin, R.; Provencher, S.; Bonnet, S. The Cancer Theory of Pulmonary Arterial Hypertension. Pulm. Circ. 2017, 7, 285–299. [Google Scholar] [CrossRef]
- Riou, M.; Enache, I.; Sauer, F.; Charles, A.-L.; Geny, B. Targeting Mitochondrial Metabolic Dysfunction in Pulmonary Hypertension: Toward New Therapeutic Approaches? Int. J. Mol. Sci. 2023, 24, 9572. [Google Scholar] [CrossRef]
- Pell, V.R.; Chouchani, E.T.; Frezza, C.; Murphy, M.P.; Krieg, T. Succinate Metabolism: A New Therapeutic Target for Myocardial Reperfusion Injury. Cardiovasc. Res. 2016, 111, 134–141. [Google Scholar] [CrossRef]
- Sato, T.; Takeda, N. The Roles of HIF-1α Signaling in Cardiovascular Diseases. J. Cardiol. 2023, 81, 202–208. [Google Scholar] [CrossRef]
- Tran, D.T.; Batchu, S.N.; Advani, A. Interferons and Interferon-Related Pathways in Heart Disease. Front. Cardiovasc. Med. 2024, 11, 1357343. [Google Scholar] [CrossRef]
- Collins, J.-A.; Rudenski, A.; Gibson, J.; Howard, L.; O’Driscoll, R. Relating Oxygen Partial Pressure, Saturation and Content: The Haemoglobin-Oxygen Dissociation Curve. Breathe 2015, 11, 194–201. [Google Scholar] [CrossRef]
- Rubic, T.; Lametschwandtner, G.; Jost, S.; Hinteregger, S.; Kund, J.; Carballido-Perrig, N.; Schwärzler, C.; Junt, T.; Voshol, H.; Meingassner, J.G.; et al. Triggering the Succinate Receptor GPR91 on Dendritic Cells Enhances Immunity. Nat. Immunol. 2008, 9, 1261–1269. [Google Scholar] [CrossRef] [PubMed]
- Mills, E.; O’Neill, L.A.J. Succinate: A Metabolic Signal in Inflammation. Trends Cell Biol. 2014, 24, 313–320. [Google Scholar] [CrossRef] [PubMed]
- Hermand, E.; Lhuissier, F.J.; Pichon, A.; Voituron, N.; Richalet, J.-P. Exercising in Hypoxia and Other Stimuli: Heart Rate Variability and Ventilatory Oscillations. Life 2021, 11, 625. [Google Scholar] [CrossRef] [PubMed]
- Sommer, N.; Pak, O.; Schörner, S.; Derfuss, T.; Krug, A.; Gnaiger, E.; Ghofrani, H.A.; Schermuly, R.T.; Huckstorf, C.; Seeger, W.; et al. Mitochondrial Cytochrome Redox States and Respiration in Acute Pulmonary Oxygen Sensing. Eur. Respir. J. 2010, 36, 1056–1066. [Google Scholar] [CrossRef] [PubMed]
- Belskikh, E.S.; Uryasiev, O.M.; Zvyagina, V.I.; Faletrova, S.V. Succinate and Succinate Dehydrogenase of Mononuclear Blood Leukocytes as Markers of Adaptation of Mitochondria to Hypoxia in Patients with Exacerbation of Chronic Obstructive Pulmonary Disease. I.P. Pavlov. Russ. Med. Biol. Her. 2020, 28, 13–20. [Google Scholar] [CrossRef]
- Sharma, S.; Wang, J.; Cortes Gomez, E.; Taggart, R.T.; Baysal, B.E. Mitochondrial Complex II Regulates a Distinct Oxygen Sensing Mechanism in Monocytes. Hum. Mol. Genet. 2017, 26, 1328–1339. [Google Scholar] [CrossRef]
- Iverson, T.M.; Singh, P.K.; Cecchini, G. An Evolving View of Complex II-Noncanonical Complexes, Megacomplexes, Respiration, Signaling, and Beyond. J. Biol. Chem. 2023, 299, 104761. [Google Scholar] [CrossRef]
- Zhang, W.; Lang, R. Succinate Metabolism: A Promising Therapeutic Target for Inflammation, Ischemia/Reperfusion Injury and Cancer. Front. Cell Dev. Biol. 2023, 11, 1266973. [Google Scholar] [CrossRef]
- Wu, K.K. Extracellular Succinate: A Physiological Messenger and a Pathological Trigger. Int. J. Mol. Sci. 2023, 24, 11165. [Google Scholar] [CrossRef]
- Kammerer, T.; Faihs, V.; Hulde, N.; Stangl, M.; Brettner, F.; Rehm, M.; Horstmann, M.; Kröpfl, J.; Spengler, C.; Kreth, S.; et al. Hypoxic-Inflammatory Responses under Acute Hypoxia: In Vitro Experiments and Prospective Observational Expedition Trial. Int. J. Mol. Sci. 2020, 21, 1034. [Google Scholar] [CrossRef]
- Cramer, T.; Yamanishi, Y.; Clausen, B.E.; Förster, I.; Pawlinski, R.; Mackman, N.; Haase, V.H.; Jaenisch, R.; Corr, M.; Nizet, V.; et al. HIF-1alpha Is Essential for Myeloid Cell-Mediated Inflammation. Cell 2003, 112, 645–657. [Google Scholar] [CrossRef] [PubMed]
- Tannahill, G.M.; Curtis, A.M.; Adamik, J.; Palsson-McDermott, E.M.; McGettrick, A.F.; Goel, G.; Frezza, C.; Bernard, N.J.; Kelly, B.; Foley, N.H.; et al. Succinate Is an Inflammatory Signal That Induces IL-1β through HIF-1α. Nature 2013, 496, 238–242. [Google Scholar] [CrossRef] [PubMed]
- Xu, Q.; Briggs, J.; Park, S.; Niu, G.; Kortylewski, M.; Zhang, S.; Gritsko, T.; Turkson, J.; Kay, H.; Semenza, G.L.; et al. Targeting Stat3 Blocks Both HIF-1 and VEGF Expression Induced by Multiple Oncogenic Growth Signaling Pathways. Oncogene 2005, 24, 5552–5560. [Google Scholar] [CrossRef] [PubMed]
- Jung, J.E.; Kim, H.S.; Lee, C.S.; Shin, Y.J.; Kim, Y.N.; Kang, G.H.; Kim, T.Y.; Juhnn, Y.S.; Kim, S.J.; Park, J.W.; et al. STAT3 Inhibits the Degradation of HIF-1alpha by pVHL-Mediated Ubiquitination. Exp. Mol. Med. 2008, 40, 479–485. [Google Scholar] [CrossRef]
- Jung, J.E.; Lee, H.G.; Cho, I.H.; Chung, D.H.; Yoon, S.-H.; Yang, Y.M.; Lee, J.W.; Choi, S.; Park, J.-W.; Ye, S.-K.; et al. STAT3 Is a Potential Modulator of HIF-1-Mediated VEGF Expression in Human Renal Carcinoma Cells. FASEB J. 2005, 19, 1296–1298. [Google Scholar] [CrossRef]
- Dinarello, A.; Betto, R.M.; Diamante, L.; Tesoriere, A.; Ghirardo, R.; Cioccarelli, C.; Meneghetti, G.; Peron, M.; Laquatra, C.; Tiso, N.; et al. STAT3 and HIF1α Cooperatively Mediate the Transcriptional and Physiological Responses to Hypoxia. Cell Death Discov. 2023, 9, 226. [Google Scholar] [CrossRef]
- Li, W.; Quan, L.; Peng, K.; Wang, Y.; Wang, X.; Chen, Q.; Cheng, H.; Ma, Q. Succinate Dehydrogenase Is Essential for Epigenetic and Metabolic Homeostasis in Hearts. Basic Res. Cardiol. 2023, 118, 45. [Google Scholar] [CrossRef]
- Wang, X.; Zhang, X.; Cao, K.; Zeng, M.; Fu, X.; Zheng, A.; Zhang, F.; Gao, F.; Zou, X.; Li, H.; et al. Cardiac Disruption of SDHAF4-Mediated Mitochondrial Complex II Assembly Promotes Dilated Cardiomyopathy. Nat. Commun. 2022, 13, 3947. [Google Scholar] [CrossRef]
- Moratilla, A.; Martín, D.; Cadenas-Martín, M.; Stokking, M.; Quesada, M.A.; Arnalich, F.; De Miguel, M.P. Hypoxia Increases the Efficiencies of Cellular Reprogramming and Oncogenic Transformation in Human Blood Cell Subpopulations In Vitro and In Vivo. Cells 2024, 13, 971. [Google Scholar] [CrossRef]
- Pham, K.; Vargas, A.; Frost, S.; Shah, S.; Heinrich, E.C. Changes in Immune Cell Populations during Acclimatization to High Altitude. Physiol. Rep. 2024, 12, e70024. [Google Scholar] [CrossRef]
- Nguyen, Q.L.; Corey, C.; White, P.; Watson, A.; Gladwin, M.T.; Simon, M.A.; Shiva, S. Platelets from Pulmonary Hypertension Patients Show Increased Mitochondrial Reserve Capacity. JCI Insight 2017, 2, e91415. [Google Scholar] [CrossRef] [PubMed]
- Salvagno, M.; Coppalini, G.; Taccone, F.S.; Strapazzon, G.; Mrakic-Sposta, S.; Rocco, M.; Khalife, M.; Balestra, C. The Normobaric Oxygen Paradox-Hyperoxic Hypoxic Paradox: A Novel Expedient Strategy in Hematopoiesis Clinical Issues. Int. J. Mol. Sci. 2022, 24, 82. [Google Scholar] [CrossRef] [PubMed]
- Balestra, C.; Baldelli, S.; Virgili, F.; Salvagno, M.; Mrakic-Sposta, S.; Fratantonio, D. Pulsed Hyperoxia Acts on Plasmatic Advanced Glycation End Products and Advanced Oxidation Protein Products and Modulates Mitochondrial Biogenesis in Human Peripheral Blood Mononuclear Cells: A Pilot Study on the “Normobaric Oxygen Paradox”. Int. J. Mol. Sci. 2024, 25, 2394. [Google Scholar] [CrossRef] [PubMed]
- Camacho-Cardenosa, A.; Camacho-Cardenosa, M.; Tomas-Carus, P.; Timón, R.; Olcina, G.; Burtscher, M. Acute Physiological Response to a Normobaric Hypoxic Exposure: Sex Differences. Int. J. Biometeorol. 2022, 66, 1495–1504. [Google Scholar] [CrossRef]
- Mabry, S.; Bradshaw, J.L.; Gardner, J.J.; Wilson, E.N.; Cunningham, R.L. Sex-Dependent Effects of Chronic Intermittent Hypoxia: Implication for Obstructive Sleep Apnea. Biol. Sex Differ. 2024, 15, 38. [Google Scholar] [CrossRef]
- Chatterjee, P.; Holody, C.D.; Kirschenman, R.; Graton, M.E.; Spaans, F.; Phillips, T.J.; Case, C.P.; Bourque, S.L.; Lemieux, H.; Davidge, S.T. Sex-Specific Effects of Prenatal Hypoxia and a Placental Antioxidant Treatment on Cardiac Mitochondrial Function in the Young Adult Offspring. Int. J. Mol. Sci. 2023, 24, 13624. [Google Scholar] [CrossRef]
- Patel, A.A.; Ginhoux, F.; Yona, S. Monocytes, Macrophages, Dendritic Cells and Neutrophils: An Update on Lifespan Kinetics in Health and Disease. Immunology 2021, 163, 250–261. [Google Scholar] [CrossRef]
- Coulson, S.Z.; Duffy, B.M.; Staples, J.F. Mitochondrial Techniques for Physiologists. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 2024, 271, 110947. [Google Scholar] [CrossRef]
Normoxia (FiO2 21%) | Effect of Hypoxia (FiO2 10.5%) | p | ||
---|---|---|---|---|
N = 13 Total Population | N = 8 with spO2 > 80% | N = 5 with spO2 ≤ 80% | ||
spO2, % | 99 ± 1 | 83.5 ± 1.4 | 76.8 ± 1.1 $ | * <0.0001 |
Respiratory rate, /min | 13 ± 0.8 | 12 ± 1 | 11 ± 1 | * 0.06 |
Minute ventilation, L/min | 10.2 ± 0.7 | 12.8 ± 1.1 | 9.2 ± 1.5 $ | * 0.30 |
Heart rate, /min | 73 ± 2 | 81 ± 3 | 84 ± 6 | * 0.04 |
Respiratory rate variation between t0 and t-hypoxia | −2.5 ± 1 | −2.5 ± 0.5 $ | $ >0.99 | |
Minute ventilation variation between t0 and t-hypoxia | +2.5 ± 1.3 | −0.7 ± 0.8 $ | $ 0.14 |
Gene | Forward | Reverse |
---|---|---|
CXCL9 | TAAGCGCTAGAGGAAGCAGC | TTCACTGAACCTCCCCTGGA |
HIF-1α | CCAGACGATCATGCAGCTACT | TGATTGCCCCAGCAGTCTAC |
ISG15 | GATCACCCAGAAGATCGGCG | GGATGCTCAGAGGTTCGTCG |
STAT3 | GGAACAAGCCCCAACCGGA | CTAAAATCAGGGGTCCCAACTGT |
SUCNR1 | CGTTGTGGGAGTCCTTGGAA | GGTTGCTTATGCAGAGCACG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Riou, M.; Charles, A.-L.; Enache, I.; Evrard, C.; Pistea, C.; Giannini, M.; Charloux, A.; Geny, B. Acute Severe Hypoxia Decreases Mitochondrial Chain Complex II Respiration in Human Peripheral Blood Mononuclear Cells. Int. J. Mol. Sci. 2025, 26, 705. https://doi.org/10.3390/ijms26020705
Riou M, Charles A-L, Enache I, Evrard C, Pistea C, Giannini M, Charloux A, Geny B. Acute Severe Hypoxia Decreases Mitochondrial Chain Complex II Respiration in Human Peripheral Blood Mononuclear Cells. International Journal of Molecular Sciences. 2025; 26(2):705. https://doi.org/10.3390/ijms26020705
Chicago/Turabian StyleRiou, Marianne, Anne-Laure Charles, Irina Enache, Charles Evrard, Cristina Pistea, Margherita Giannini, Anne Charloux, and Bernard Geny. 2025. "Acute Severe Hypoxia Decreases Mitochondrial Chain Complex II Respiration in Human Peripheral Blood Mononuclear Cells" International Journal of Molecular Sciences 26, no. 2: 705. https://doi.org/10.3390/ijms26020705
APA StyleRiou, M., Charles, A.-L., Enache, I., Evrard, C., Pistea, C., Giannini, M., Charloux, A., & Geny, B. (2025). Acute Severe Hypoxia Decreases Mitochondrial Chain Complex II Respiration in Human Peripheral Blood Mononuclear Cells. International Journal of Molecular Sciences, 26(2), 705. https://doi.org/10.3390/ijms26020705