Adaptive and Pathological Changes of the Cardiac Muscle in a Mouse Model of Renocardiac Syndrome: The Role of Nestin-Positive Cells
Abstract
1. Introduction
2. Results
2.1. Structural and Morphological Cardiac Changes in UUO
2.2. Hemodynamic and ECG Indices in UUO
2.3. In RCS4 Induced by UUO, Cardiac Muscle Fibrosis Does Not Occur
2.4. Expression of Proinflammatory Cytokines and Macrophage Content in the Heart Following UUO of Different Durations
2.5. Analysis of Nestin-Positive Cell Count in the Hearts of Mice with RCS4 Induced by Obstructive Nephropathy
2.6. Analysis of Nestin Colocalization with Markers of Different Cardiac Cell Types
2.7. GFP+ Cardiac Cells Express Cardiac Progenitor Cell Markers
3. Discussion
4. Materials and Methods
4.1. Animals
4.2. Experimental Design
4.3. Morphometric Analysis
4.4. ECG and Blood Pressure Recording
4.5. Histochemical Analysis
4.6. Titin Electrophoresis
4.7. Plasma LDH and CK Activity
4.8. Real-Time PCR
4.9. Confocal Microscopy
4.10. Flow Cytometry and Cell Sorting
4.11. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| β1-AR | β1-adrenergic receptor |
| BP | Blood pressure |
| CK | Creatine kinase |
| CKD | Chronic kidney disease |
| c-Kit | KIT proto-oncogene receptor tyrosine kinase |
| COX2 | Cyclooxygenase-2 |
| CPCs | Cardiac progenitor cells |
| cx40 | Connexin 40 |
| CXCL | C-X-C motif chemokine ligand |
| ECG | Electrocardiogram |
| ECM | Extracellular matrix |
| FACS | Fluorescence-activated sorting |
| GFP | Green fluorescent protein |
| HR | Heart rate |
| IL1β | Interleukin 1β |
| LDH | Lactate dehydrogenase |
| L-NAME | N(G)-nitro-L-arginine methyl ester |
| MAP | Mean arterial pressure |
| MHC | Myosin heavy chains |
| MMP | Matrix metalloproteinase |
| PAS | Periodic acid–Schiff reagent |
| RCS 4 | Renocardiac syndrome type 4 |
| RT-PCR | Real-time PCR |
| SCA-1 | Stem cell antigen-1 |
| TBX5 | T-box transcription factor 5 |
| TGFβ1 | Transforming growth factor β1 |
| TIMP | Tissue inhibitor of matrix metalloproteinase |
| TNFα | Tumor necrosis factor α |
| vWF | von Willebrand factor |
| UUO | Unilateral ureteral obstruction |
Appendix A

| Assays | Experimental Groups | ||
|---|---|---|---|
| Int | 14UUO | 28UUO | |
| Morphometric analysis (heart) | 11 | 8 | 8 |
| Morphometric analysis (kidney) | 4 | 4 | 5 |
| ECG and blood pressure recording | 8 | 8 | 7 |
| Histochemical analysis | 5 | 5 | 5 |
| Titin electrophoresis | 5 | 6 | 6 |
| Plasma LDH and CK activity | 13 | 12 | 12 |
| RT-PCR (cardiac tissue, fibrosis markers) | 7 | 9 | 10 |
| RT-PCR (cardiac tissue, inflammation markers) | 5 | 7 | 10 |
| RT-PCR (cardiac tissue, eGFP) | 7 | 7 | 8 |
| RT-PCR (sorted cells) | 5 | 3 | 3 |
| Confocal microscopy | 5 | 4 | 4 |
| Flow cytometry | 3 | 3 | 3 |
| Figure | Group | p-Value | Mean ± SD | |
|---|---|---|---|---|
| Int vs. 14UUO | Int vs. 28UUO | |||
| Figure 1A | Int (n = 4) | 0.99 | 0.032 | 0.71 ± 0.1 |
| 14UUO (n = 4) | 0.71 ± 0.12 | |||
| 28UUO (n = 5) | 0.53 ± 0.08 | |||
| Figure 1B | Int (n = 11) | 0.044 | 0.21 | 0.55 ± 0.03 |
| 14UUO (n = 8) | 0.61 ± 0.05 | |||
| 28UUO (n = 8) | 0.55 ± 0.06 | |||
| Figure 1C | Int (n = 5) 1 dot represents 1 field of view (total: 428 fields) | <0.0001 | <0.0001 | 15.9 ± 2.54 |
| 14UUO (n = 5) 1 dot represents 1 field of view (total: 486 fields) | 18.73 ± 2.71 | |||
| 28UUO (n = 5) 1 dot represents 1 field of view (total: 480 fields) | 17.42 ± 2.65 | |||
| Figure 1D (T1/MHC) | Int (n = 5) | 0.15 | 0.02 | 1.06 ± 0.19 |
| 14UUO (n = 6) | 1.24 ± 0.18 | |||
| 28UUO (n = 6) | 1.36 ± 0.08 | |||
| Figure 1D (T2/MHC) | Int (n = 5) | 0.45 | 0.1 | 0.57 ± 0.04 |
| 14UUO (n = 6) | 0.63 ± 0.12 | |||
| 28UUO (n = 6) | 0.69 ± 0.07 | |||
| Figure 1D (T2/T1) | Int (n = 5) | 0.91 | 0.98 | 0.5 ± 0.01 |
| 14UUO (n = 6) | 0.51 ± 0.03 | |||
| 28UUO (n = 6) | 0.51 ± 0.04 | |||
| Figure 1D (TT/MHC) | Int (n = 5) | 0.14 | 0.024 | 1.98 ± 0.34 |
| 14UUO (n = 6) | 2.32 ± 0.34 | |||
| 28UUO (n = 6) | 2.53 ± 0.21 | |||
| Figure 1E (LDH) | Int (n = 13) | 0.96 | 0.039 | 104.5 ± 25.14 |
| 14UUO (n = 12) | 100.6 ± 15.38 | |||
| 28UUO (n = 12) | 146.7 ± 50.19 | |||
| Figure 1E (KK) | Int (n = 13) | 0.59 | 0.4 | 105 ± 41.85 |
| 14UUO (n = 12) | 87.29 ± 16.66 | |||
| 28UUO (n = 12) | 128.7 ± 45.54 | |||
| Figure 2A | Int (n = 8) | 0.37 | 0.22 | 69.9 ± 5.6 |
| 14UUO (n = 8) | 73.6 ± 6.0 | |||
| 28UUO (n = 7) | 65.0 ± 6.1 | |||
| Figure 2B | Int (n = 8) | 0.57 | 0.16 | 28.4 ± 7.7 |
| 14UUO (n = 8) | 24.2 ± 9.6 | |||
| 28UUO (n = 7) | 20.18 ± 6.9 | |||
| Figure 2C | Int (n = 8) | 0.82 | 0.199 | 416 ± 54 |
| 14UUO (n = 8) | 394 ± 102 | |||
| 28UUO (n = 7) | 348 ± 66 | |||
| Figure 2D | Int (n = 8) | 0.54 | 0.11 | 145.1 ± 7.9 |
| 14UUO (n = 8) | 160.7 ± 37.1 | |||
| 28UUO (n = 7) | 178.6 ± 33.7 | |||
| Figure 2F | Int (n = 8) | 0.39 | 0.012 | 9.89 ± 0.83 |
| 14UUO (n = 8) | 10.62 ± 0.89 | |||
| 28UUO (n = 7) | 11.80 ± 1.80 | |||
| Figure 2G | Int (n = 8) | 0.76 | 0.69 | 22.78 ± 6.74 |
| 14UUO (n = 8) | 21.35 ± 2.54 | |||
| 28UUO (n = 7) | 24.53 ± 3.00 | |||
| Figure 3A | Int (n = 7) | 0.8 | 0.26 | 234.5 ± 138.5 |
| 14UUO (n = 9) | 261.2 ± 94.47 | |||
| 28UUO (n = 10) | 164.7 ± 56.96 | |||
| Figure 3B | Int (n = 7) | 0.13 | 0.89 | 4.08 ± 2.42 |
| 14UUO (n = 9) | 6.09 ± 2.43 | |||
| 28UUO (n = 10) | 4.52 ± 0.77 | |||
| Figure 3C | Int (n = 7) | 0.999 | 0.91 | 4.82 ± 2.85 |
| 14UUO (n = 9) | 4.79 ± 1.65 | |||
| 28UUO (n = 10) | 4.49 ± 1.26 | |||
| Figure 3D | Int (n = 6) | 0.18 | 0.038 | 49.29 ± 24.29 |
| 14UUO (n = 9) | 37.23 ± 8.58 | |||
| 28UUO (n = 10) | 31.87 ± 7.87 | |||
| Figure 3E | Int (n = 6) | 0.43 | 0.017 | 1 ± 0.66 |
| 14UUO (n = 9) | 0.76 ± 0.34 | |||
| 28UUO (n = 10) | 0.4 ± 0.22 | |||
| Figure 3F | Int (n = 7) | 0.012 | 0.71 | 0.67 ± 0.3 |
| 14UUO (n = 9) | 1.34 ± 0.56 | |||
| 28UUO (n = 10) | 0.82 ± 0.33 | |||
| Figure 3G | Int (n = 7) | 0.74 | 0.083 | 35.11 ± 13.63 |
| 14UUO (n = 9) | 31.94 ± 4.68 | |||
| 28UUO (n = 10) | 25.24 ± 9.03 | |||
| Figure 4A | Int (n = 5) | 0.036 | 0.005 | 12.21 ± 3.23 |
| 14UUO (n = 7) | 7.22 ± 3.56 | |||
| 28UUO (n = 10) | 5.63 ± 2.74 | |||
| Figure 4B | Int (n = 5) | 0.008 | 0.12 | 15.76 ± 5.5 |
| 14UUO (n = 7) | 5.54 ± 0.94 | |||
| 28UUO (n = 10) | 10.51 ± 5.19 | |||
| Figure 4C | Int (n = 5) | 0.44 | 0.21 | 0.2 ± 0.04 |
| 14UUO (n = 7) | 0.25 ± 0.09 | |||
| 28UUO (n = 10) | 0.13 ± 0.05 | |||
| Figure 4D | Int (n = 5) | 0.99 | 0.57 | 0.34 ± 0.14 |
| 14UUO (n = 7) | 0.34 ± 0.12 | |||
| 28UUO (n = 10) | 0.42 ± 0.2 | |||
| Figure 4E | Int (n = 5) | 0.59 | 0.93 | 0.34 ± 0.09 |
| 14UUO (n = 7) | 0.27 ± 0.14 | |||
| 28UUO (n = 10) | 0.31 ± 0.12 | |||
| Figure 4F | Int (n = 5) | 0.92 | 0.46 | 1.58 ± 0.91 |
| 14UUO (n = 7) | 1.76 ± 1.04 | |||
| 28UUO (n = 10) | 1.06 ± 0.54 | |||
| Figure 4G | Int (n = 3) | 0.002 | 0.002 | 2.18 ± 0.73 |
| 14UUO (n = 3) | 0.22 ± 0.06 | |||
| 28UUO (n = 3) | 0.13 ± 0.04 | |||
| Figure 5A | Int (n = 7) | 0.16 | 0.0482 | 370 ± 65.7 |
| 14UUO (n = 7) | 639 ± 183 | |||
| 28UUO (n = 8) | 716 ± 341 | |||
| Figure 10A | Int (n = 3) | 0.09 | 0.58 | 12.37 ± 6.8 |
| 14UUO (n = 3) | 23.1 ± 2.96 | |||
| 28UUO (n = 3) | 9.249 ± 8.37 | |||
| Figure 10B | Int (n = 5) | 0.95 | 0.37 | 9.94 ± 6.28 |
| 14UUO (n = 3) | 8.8 ± 6.34 | |||
| 28UUO (n = 3) | 4.28 ± 4.29 | |||
| Figure 10C | Int (n = 3) | 0.84 | 0.77 | 3.57 ± 2.78 |
| 14UUO (n = 3) | 2.46 ± 0.27 | |||
| 28UUO (n = 3) | 2.19 ± 3.8 | |||
| Gene Name | Primer Nucleotide Sequence (5′ to 3′) | PCR Product Size, bp | Genbank Accession Number |
|---|---|---|---|
| eGFP | for CACGACTTCTTCAAGTCCGC | 318 | U55762.1 |
| rev GGTGTTCTGCTGGTAGTGGT | |||
| Col1a1 | for CGATGGATTCCCGTTCGAGT | 197 | NM_007742.4 |
| rev CGATCTCGTTGGATCCCTGG | |||
| Col4a1 | for ATGGCTTGCCTGGAGAGATAGG | 134 | NM_009931.2 |
| rev TGGTTGCCCTTTGAGTCCTGGA | |||
| Tgfb1 | for TGATACGCCTGAGTGGCTGTCT | 107 | NM_011577.2 |
| rev CACAAGAGCAGTGAGCGCTGAA | |||
| Timp1 | for GCAACTCGGACCTGGTCATAA | 226 | NM_011593.2 |
| rev CGGCCCGTGATGAGAAACT | |||
| Timp2 | for TCAGAGCCAAAGCAGTGAGC | 142 | NM_011594.3 |
| rev GCCGTGTAGATAAACTCGATGTC | |||
| Mmp2 | for CAAGTTCCCCGGCGATGTC | 171 | NM_008610.3 |
| rev TTCTGGTCAAGGTCACCTGTC | |||
| Mmp9 | for CTGGACAGCCAGACACTAAAG | 145 | NM_013599.5 |
| rev CTCGCGGCAAGTCTTCAGAG | |||
| Cxcl1 | for CACCTCAAGAACATCCAGAGCT | 163 | NM_008176.3 |
| rev ACTTGGGGACACCTTTTAGCAT | |||
| Cxcl9 | for ATCATCTTCCTGGAGCAGTGTG | 193 | NM_008599.4 |
| rev CTAGGCAGGTTTGATCTCCGTT | |||
| Il1b | for TTGAAGAAGAGCCCATCCTCTG | 144 | NM_008361.4 |
| rev CTTTCAGCTCATATGGGTCCGA | |||
| Il6 | for ACATAAAATAGTCCTTCCTACCCCA | 100 | NM_031168.2 |
| rev GATGAATTGGATGGTCTTGGTCC | |||
| Tnfa | for CCAAAGGGATGAGAAGTTCCCA | 249 | NM_013693.3 |
| rev ACCTGGGAGTAGACAAGGTACA | |||
| Cox2 | for CTGACCCCCAAGGCTCAAATAT | 224 | NM_011198.5 |
| rev GGGATACACCTCTCCACCAATG | |||
| C-kit | for TTTGCTGAGCTTCTCCTACCAG | 82 | NM_001122733.1 |
| rev TCCCATAGGACCAGACATCACT | |||
| Sca-1 | for GAGACTTCTTGCCCATCAATTACC | 82 | NM_001271416.1 |
| rev GAGAATCCACAATAACTGCTGCC | |||
| Tbx5 | for CCAAAGACAGGTCTTGCGATTCG | 192 | NM_011537.3 |
| rev TTCTCCTCCCTGCCTTGGTGAT | |||
| Rplp0 | for GCTTCGTGTTCACCAAGGAGGA | 135 | NM_007475.5 |
| rev GTCCTAGACCAGTGTTCTGAGC |



- Supplementary Methods
- Measurement of serum urea concentration
- Determination of Oxidative Stress Marker Concentrations
References
- Clementi, A.; Virzì, G.M.; Goh, C.Y.; Cruz, D.N.; Granata, A.; Vescovo, G.; Ronco, C. Cardiorenal Syndrome Type 4: A Review. Cardiorenal Med. 2013, 3, 63–70. [Google Scholar] [CrossRef] [Scilit]
- Quiroga, B.; Ortiz, A.; Navarro-González, J.F.; Santamaría, R.; de Sequera, P.; Díez, J. From Cardiorenal Syndromes to Cardionephrology: A Reflection by Nephrologists on Renocardiac Syndromes. Clin. Kidney J. 2022, 16, 19–29. [Google Scholar] [CrossRef] [Scilit]
- Kingma, J.G., Jr.; Simard, D.; Rouleau, J.R. Renocardiac Syndromes: Physiopathology and Treatment Stratagems. Can. J. Kidney Health Dis. 2015, 2, 41. [Google Scholar] [CrossRef] [Scilit]
- Buliga-Finis, O.N.; Ouatu, A.; Badescu, M.C.; Dima, N.; Tanase, D.M.; Richter, P.; Rezus, C. Beyond the Cardiorenal Syndrome: Pathophysiological Approaches and Biomarkers for Renal and Cardiac Crosstalk. Diagnostics 2022, 12, 773. [Google Scholar] [CrossRef] [Scilit]
- Martínez-Klimova, E.; Aparicio-Trejo, O.E.; Tapia, E.; Pedraza-Chaverri, J. Unilateral Ureteral Obstruction as a Model to Investigate Fibrosis-Attenuating Treatments. Biomolecules 2019, 9, 141. [Google Scholar] [CrossRef] [Scilit]
- Anversa, P.; Kajstura, J. Ventricular Myocytes Are Not Terminally Differentiated in the Adult Mammalian Heart. Circ. Res. 1998, 83, 1–14. [Google Scholar] [CrossRef] [Scilit]
- Beltrami, A.P.; Barlucchi, L.; Torella, D.; Baker, M.; Limana, F.; Chimenti, S.; Kasahara, H.; Rota, M.; Musso, E.; Urbanek, K.; et al. Adult Cardiac Stem Cells Are Multipotent and Support Myocardial Regeneration. Cell 2003, 114, 763–776. [Google Scholar] [CrossRef] [Scilit]
- Amini, H.; Rezaie, J.; Vosoughi, A.; Rahbarghazi, R.; Nouri, M. Cardiac Progenitor Cells Application in Cardiovascular Disease. J. Cardiovasc. Thorac. Res. 2017, 9, 127–132. [Google Scholar] [CrossRef] [Scilit]
- Ge, Z.; Lal, S.; Le, T.Y.L.; Dos Remedios, C.; Chong, J.J.H. Cardiac Stem Cells: Translation to Human Studies. Biophys. Rev. 2015, 7, 127–139. [Google Scholar] [CrossRef] [Scilit]
- El-Helou, V.; Beguin, P.C.; Assimakopoulos, J.; Clement, R.; Gosselin, H.; Brugada, R.; Aumont, A.; Biernaskie, J.; Villeneuve, L.; Leung, T.K.; et al. The Rat Heart Contains a Neural Stem Cell Population; Role in Sympathetic Sprouting and Angiogenesis. J. Mol. Cell. Cardiol. 2008, 45, 694–702. [Google Scholar] [CrossRef] [Scilit]
- Lendahl, U.; Zimmerman, L.B.; McKay, R.D. CNS Stem Cells Express a New Class of Intermediate Filament Protein. Cell 1990, 60, 585–595. [Google Scholar] [CrossRef] [Scilit]
- Béguin, P.C.; Gosselin, H.; Mamarbachi, M.; Calderone, A. Nestin Expression Is Lost in Ventricular Fibroblasts during Postnatal Development of the Rat Heart and Re-Expressed in Scar Myofibroblasts. J. Cell. Physiol. 2012, 227, 813–820. [Google Scholar] [CrossRef] [Scilit]
- Buyan, M.I.; Andrianova, N.V.; Popkov, V.A.; Zorova, L.D.; Pevzner, I.B.; Silachev, D.N.; Zorov, D.B.; Plotnikov, E.Y. Age-Associated Loss in Renal Nestin-Positive Progenitor Cells. Int. J. Mol. Sci. 2022, 23, 11015. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mokrý, J.; Cízková, D.; Filip, S.; Ehrmann, J.; Osterreicher, J.; Kolár, Z.; English, D. Nestin Expression by Newly Formed Human Blood Vessels. Stem Cells Dev. 2004, 13, 658–664. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Drapeau, J.; El-Helou, V.; Clement, R.; Bel-Hadj, S.; Gosselin, H.; Trudeau, L.-E.; Villeneuve, L.; Calderone, A. Nestin-Expressing Neural Stem Cells Identified in the Scar Following Myocardial Infarction. J. Cell. Physiol. 2005, 204, 51–62. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- El-Helou, V.; Dupuis, J.; Proulx, C.; Drapeau, J.; Clement, R.; Gosselin, H.; Villeneuve, L.; Manganas, L.; Calderone, A. Resident Nestin+ Neural-like Cells and Fibers Are Detected in Normal and Damaged Rat Myocardium. Hypertension 2005, 46, 1219–1225. [Google Scholar] [CrossRef] [Scilit]
- Calderone, A. The Biological Role of Nestin(+)-Cells in Physiological and Pathological Cardiovascular Remodeling. Front. Cell Dev. Biol. 2018, 6, 15. [Google Scholar] [CrossRef] [Scilit]
- Vaidya, S.R.; Aeddula, N.R. Chronic Kidney Disease. In StatPearls [Internet]; StatPearls Publishing: Treasure Island, FL, USA, 2024. [Google Scholar]
- Yakupova, E.I.; Abramicheva, P.A.; Rogachevsky, V.V.; Shishkova, E.A.; Bocharnikov, A.D.; Plotnikov, E.Y.; Vikhlyantsev, I.M. Cardiac Titin Isoforms: Practice in Interpreting Results of Electrophoretic Analysis. Methods 2025, 236, 17–25. [Google Scholar] [CrossRef] [Scilit]
- Michel, N.A.; Ljubojevic-Holzer, S.; Bugger, H.; Zirlik, A. Cellular Heterogeneity of the Heart. Front. Cardiovasc. Med. 2022, 9, 868466. [Google Scholar] [CrossRef] [Scilit]
- Chaihongsa, N.; Maneesai, P.; Sangartit, W.; Rattanakanokchai, S.; Potue, P.; Khamseekaew, J.; Bunbupha, S.; Pakdeechote, P. Cardiorenal Dysfunction and Hypertrophy Induced by Renal Artery Occlusion Are Normalized by Galangin Treatment in Rats. Biomed. Pharmacother. 2022, 152, 113231. [Google Scholar] [CrossRef] [Scilit]
- Rofe, M.T.; Levi, R.; Hertzberg-Bigelman, E.; Goryainov, P.; Barashi, R.; Ben-Shoshan, J.; Keren, G.; Entin-Meer, M. Cardiac Hypertrophy and Cardiac Cell Death in Chronic Kidney Disease. Isr. Med. Assoc. J. IMAJ 2015, 17, 744–749. [Google Scholar] [PubMed]
- Kundu, S.; Gairola, S.; Verma, S.; Mugale, M.N.; Sahu, B.D. Chronic Kidney Disease Activates the HDAC6-Inflammatory Axis in the Heart and Contributes to Myocardial Remodeling in Mice: Inhibition of HDAC6 Alleviates Chronic Kidney Disease-Induced Myocardial Remodeling. Basic. Res. Cardiol. 2024, 119, 831–852. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mishima, K.; Nakasatomi, M.; Takahashi, S.; Ikeuchi, H.; Sakairi, T.; Kaneko, Y.; Hiromura, K.; Nojima, Y.; Maeshima, A. Attenuation of Renal Fibrosis after Unilateral Ureteral Obstruction in Mice Lacking the N-Type Calcium Channel. PLoS ONE 2019, 14, e0223496. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Grossman, R.C. Experimental Models of Renal Disease and the Cardiovascular System. Open Cardiovasc. Med. J. 2010, 4, 257–264. [Google Scholar] [CrossRef] [Scilit]
- LeWinter, M.M.; Granzier, H. Cardiac Titin: A Multifunctional Giant. Circulation 2010, 121, 2137–2145. [Google Scholar] [CrossRef] [Scilit]
- Hutchinson, K.R.; Saripalli, C.; Chung, C.S.; Granzier, H. Increased Myocardial Stiffness due to Cardiac Titin Isoform Switching in a Mouse Model of Volume Overload Limits Eccentric Remodeling. J. Mol. Cell Cardiol. 2015, 79, 104–114. [Google Scholar] [CrossRef] [Scilit]
- Valero-Muñoz, M.; Saw, E.L.; Hekman, R.M.; Blum, B.C.; Hourani, Z.; Granzier, H.; Emili, A.; Sam, F. Proteomic and Phosphoproteomic Profiling in Heart Failure with Preserved Ejection Fraction (HFpEF). Front. Cardiovasc. Med. 2022, 9, 966968. [Google Scholar] [CrossRef] [Scilit]
- Nagueh, S.F.; Shah, G.; Wu, Y.; Torre-Amione, G.; King, N.M.P.; Lahmers, S.; Witt, C.C.; Becker, K.; Labeit, S.; Granzier, H.L. Altered Titin Expression, Myocardial Stiffness, and Left Ventricular Function in Patients with Dilated Cardiomyopathy. Circulation 2004, 110, 155–162. [Google Scholar] [CrossRef] [Scilit]
- Desai, A.D.; Yaw, T.S.; Yamazaki, T.; Kaykha, A.; Chun, S.; Froelicher, V.F. Prognostic Significance of Quantitative QRS Duration. Am. J. Med. 2006, 119, 600–606. [Google Scholar] [CrossRef] [Scilit]
- Boukens, B.J.; Rivaud, M.R.; Rentschler, S.; Coronel, R. Misinterpretation of the Mouse ECG: “Musing the Waves of Mus Musculus”. J. Physiol. 2014, 592, 4613–4626. [Google Scholar] [CrossRef] [Scilit]
- Ramkisoensing, A.A.; de Vries, A.A.F.; Atsma, D.E.; Schalij, M.J.; Pijnappels, D.A. Interaction between Myofibroblasts and Stem Cells in the Fibrotic Heart: Balancing between Deterioration and Regeneration. Cardiovasc. Res. 2014, 102, 224–231. [Google Scholar] [CrossRef] [Scilit]
- Hassanabad, A.F.; Zarzycki, A.N.; Patel, V.B.; Fedak, P.V. Current Concepts in the Epigenetic Regulation of Cardiac Fibrosis. Cardiovasc. Pathol. 2024, 73, 107673. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bracco Gartner, T.C.; Deddens, J.C.; Mol, E.A.; Ferrer, M.M.; van Laake, L.W.; Bouten, C.V.C.; Khademhosseini, A.; Doevendans, P.A.; Suyker, W.J.L.; Sluijter, J.P.G.; et al. Anti-Fibrotic Effects of Cardiac Progenitor Cells in a 3D-Model of Human Cardiac Fibrosis. Front. Cardiovasc. Med. 2019, 6, 52. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- DeLeon-Pennell, K.Y.; Tian, Y.; Zhang, B.; Cates, C.A.; Iyer, R.P.; Cannon, P.; Shah, P.; Aiyetan, P.; Halade, G.V.; Ma, Y.; et al. CD36 Is a Matrix Metalloproteinase-9 Substrate That Stimulates Neutrophil Apoptosis and Removal During Cardiac Remodeling. Circ. Cardiovasc. Genet. 2016, 9, 14–25. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Polina, E.R.; Araújo, R.R.C.V.; Sbruzzi, R.C.; Biolo, A.; Rohde, L.E.; Clausell, N.; dos Santos, K.G. Relationship of Polymorphisms in the Tissue Inhibitor of Metalloproteinase (TIMP)-1 and -2 Genes with Chronic Heart Failure. Sci. Rep. 2018, 8, 9446. [Google Scholar] [CrossRef] [Scilit]
- Takawale, A.; Zhang, P.; Patel, V.B.; Wang, X.; Oudit, G.; Kassiri, Z. Tissue Inhibitor of Matrix Metalloproteinase-1 Promotes Myocardial Fibrosis by Mediating CD63–Integrin β1 Interaction. Hypertension 2017, 69, 1092–1103. [Google Scholar] [CrossRef] [Scilit]
- Yabluchanskiy, A.; Ma, Y.; Iyer, R.P.; Hall, M.E.; Lindsey, M.L. Matrix Metalloproteinase-9: Many Shades of Function in Cardiovascular Disease. Physiology (Bethesda) 2013, 28, 391–403. [Google Scholar] [CrossRef] [Scilit]
- Batlle, M.; Pérez-Villa, F.; García-Pras, E.; Lázaro, A.; Orús, J.; Roqué, M.; Roig, E. Down-Regulation of Matrix Metalloproteinase-9 (MMP-9) Expression in the Myocardium of Congestive Heart Failure Patients. Transplant. Proc. 2007, 39, 2344–2346. [Google Scholar] [CrossRef] [Scilit]
- Van Linthout, S.; Seeland, U.; Riad, A.; Eckhardt, O.; Hohl, M.; Dhayat, N.; Richter, U.; Fischer, J.W.; Böhm, M.; Pauschinger, M.; et al. Reduced MMP-2 Activity Contributes to Cardiac Fibrosis in Experimental Diabetic Cardiomyopathy. Basic. Res. Cardiol. 2008, 103, 319–327. [Google Scholar] [CrossRef] [Scilit]
- Tanase, D.M.; Valasciuc, E.; Anton, I.-B.; Gosav, E.M.; Dima, N.; Cucu, A.I.; Costea, C.F.; Floria, D.E.; Hurjui, L.L.; Tarniceriu, C.C.; et al. Matrix Metalloproteinases: Pathophysiologic Implications and Potential Therapeutic Targets in Cardiovascular Disease. Biomolecules 2025, 15, 598. [Google Scholar] [CrossRef] [Scilit]
- Halade, G.V.; Jin, Y.-F.; Lindsey, M.L. Matrix Metalloproteinase (MMP)-9: A Proximal Biomarker for Cardiac Remodeling and a Distal Biomarker for Inflammation. Pharmacol. Ther. 2013, 139, 32–40. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lu, X.; Wang, Z.; Ye, D.; Feng, Y.; Liu, M.; Xu, Y.; Wang, M.; Zhang, J.; Liu, J.; Zhao, M.; et al. The Role of CXC Chemokines in Cardiovascular Diseases. Front. Pharmacol. 2021, 12, 765768. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, C.-L.; Yin, R.; Wang, S.-N.; Ying, R. A Review of CXCL1 in Cardiac Fibrosis. Front. Cardiovasc. Med. 2021, 8, 674498. [Google Scholar] [CrossRef] [Scilit]
- Szentes, V.; Gazdag, M.; Szokodi, I.; Dézsi, C.A. The Role of CXCR3 and Associated Chemokines in the Development of Atherosclerosis and during Myocardial Infarction. Front. Immunol. 2018, 9, 1932. [Google Scholar] [CrossRef] [Scilit]
- Aubry, A.; Kebbe, M.; Naud, P.; Villeneuve, L.; Leblanc, C.A.; Calderone, A. Nestin(+)- and Nestin(−)-Ventricular Cardiomyocytes Reenter the Cell Cycle In Vitro but Are Reciprocally Regulated in the Partial Apex-Resected 7-Day Neonatal Rat Heart. J. Cell. Physiol. 2025, 240, e70040. [Google Scholar] [CrossRef] [Scilit]
- Hertig, V.; Tardif, K.; Meus, M.A.; Duquette, N.; Villeneuve, L.; Toussaint, F.; Ledoux, J.; Calderone, A. Nestin Expression Is Upregulated in the Fibrotic Rat Heart and Is Localized in Collagen-Expressing Mesenchymal Cells and Interstitial CD31(+)- Cells. PLoS ONE 2017, 12, e0176147. [Google Scholar] [CrossRef] [Scilit]
- Berry, S.E.; Andruszkiewicz, P.; Chun, J.L.; Hong, J. Nestin Expression in End-Stage Disease in Dystrophin-Deficient Heart: Implications for Regeneration from Endogenous Cardiac Stem Cells. Stem Cells Transl. Med. 2013, 2, 848–861. [Google Scholar] [CrossRef] [Scilit]
- Tamura, Y.; Matsumura, K.; Sano, M.; Tabata, H.; Kimura, K.; Ieda, M.; Arai, T.; Ohno, Y.; Kanazawa, H.; Yuasa, S.; et al. Neural Crest-Derived Stem Cells Migrate and Differentiate into Cardiomyocytes after Myocardial Infarction. Arter. Thromb. Vasc. Biol. 2011, 31, 582–589. [Google Scholar] [CrossRef] [Scilit]
- Tomita, Y.; Matsumura, K.; Wakamatsu, Y.; Matsuzaki, Y.; Shibuya, I.; Kawaguchi, H.; Ieda, M.; Kanakubo, S.; Shimazaki, T.; Ogawa, S.; et al. Cardiac Neural Crest Cells Contribute to the Dormant Multipotent Stem Cell in the Mammalian Heart. J. Cell Biol. 2005, 170, 1135–1146. [Google Scholar] [CrossRef] [Scilit]
- Meus, M.-A.; Hertig, V.; Villeneuve, L.; Jasmin, J.-F.; Calderone, A. Nestin Expressed by Pre-Existing Cardiomyocytes Recapitulated in Part an Embryonic Phenotype; Suppressive Role of p38 MAPK. J. Cell Physiol. 2017, 232, 1717–1727. [Google Scholar] [CrossRef] [Scilit]
- Mokry, J.; Pudil, R.; Ehrmann, J.; Cizkova, D.; Osterreicher, J.; Filip, S.; Kolar, Z. Re-Expression of Nestin in the Myocardium of Postinfarcted Patients. Virchows Arch. 2008, 453, 33–41. [Google Scholar] [CrossRef] [Scilit]
- Valente, M.; Nascimento, D.S.; Cumano, A.; Pinto-do-Ó, P. Sca-1+ Cardiac Progenitor Cells and Heart-Making: A Critical Synopsis. Stem Cells Dev. 2014, 23, 2263–2273. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hatcher, C.J.; Kim, M.S.; Mah, C.S.; Goldstein, M.M.; Wong, B.; Mikawa, T.; Basson, C.T. TBX5 Transcription Factor Regulates Cell Proliferation during Cardiogenesis. Dev. Biol. 2001, 230, 177–188. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Horb, M.E.; Thomsen, G.H. Tbx5 Is Essential for Heart Development. Development 1999, 126, 1739–1751. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ronco, C.; Bellasi, A.; Di Lullo, L. Cardiorenal Syndrome: An Overview. Adv. Chronic Kidney Dis. 2018, 25, 382–390. [Google Scholar] [CrossRef] [Scilit]
- Mayne, K.J.; Sullivan, M.K.; Lees, J.S. Sex and Gender Differences in the Management of Chronic Kidney Disease and Hypertension. J. Hum. Hypertens. 2023, 37, 649–653. [Google Scholar] [CrossRef] [Scilit]
- Kattah, A.G.; Garovic, V.D. Understanding Sex Differences in Progression and Prognosis of Chronic Kidney Disease. Ann. Transl. Med. 2020, 8, 897. [Google Scholar] [CrossRef] [Scilit]
- Mignone, J.L.; Kukekov, V.; Chiang, A.-S.; Steindler, D.; Enikolopov, G. Neural Stem and Progenitor Cells in Nestin-GFP Transgenic Mice. J. Comp. Neurol. 2004, 469, 311–324. [Google Scholar] [CrossRef] [Scilit]
- Mignone, J.; Peunova, N.; Enikolopov, G. Nestin-Based Reporter Transgenic Mouse Lines. In Multipotent Stem Cells of the Hair Follicle; Springer: New York, NY, USA, 2016; pp. 7–14. [Google Scholar]
- Negulyaev, V.O.; Tarasova, O.S.; Tarasova, N.V.; Lukoshkova, E.V.; Vinogradova, O.L.; Borovik, A.S. Phase Synchronization of Baroreflex Oscillations of Blood Pressure and Pulse Interval in Rats: The Effects of Cardiac Autonomic Blockade and Gradual Blood Loss. Physiol. Meas. 2019, 40, 054003. [Google Scholar] [CrossRef] [Scilit]
- Vikhlyantsev, I.M.; Podlubnaya, Z.A. Nuances of Electrophoresis Study of Titin/connectin. Biophys. Rev. 2017, 9, 189–199. [Google Scholar] [CrossRef] [Scilit]
- Bergmeyer, H.U.; Bernt, E. UV-Assay with Pyruvate and NADH. In Methods of Enzymatic Analysis; Bergmeyer, H.U., Ed.; Elsevier: Amsterdam, The Netherlands, 1974; pp. 574–579. ISBN 9780120913022. [Google Scholar]
- Foreback, C.C.; Chu, J.W. Creatine Kinase Isoenzymes: Electrophoretic and Quantitative Measurements. Crit. Rev. Clin. Lab. Sci. 1981, 15, 187–230. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ohkawa, H.; Ohishi, N.; Yagi, K. Assay for Lipid Peroxides in Animal Tissues by Thiobarbituric Acid Reaction. Anal. Biochem. 1979, 95, 351–358. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Patsoukis, N.; Georgiou, C.D. Determination of the Thiol Redox State of Organisms: New Oxidative Stress Indicators. Anal. Bioanal. Chem. 2004, 378, 1783–1792. [Google Scholar] [CrossRef] [Scilit] [PubMed]











Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Abramicheva, P.A.; Sokolov, I.A.; Druzhinina, A.A.; Potashnikova, D.M.; Andrianova, N.V.; Semenovich, D.S.; Manskikh, V.N.; Zorova, L.D.; Yakupova, E.I.; Vikhlyantsev, I.M.; et al. Adaptive and Pathological Changes of the Cardiac Muscle in a Mouse Model of Renocardiac Syndrome: The Role of Nestin-Positive Cells. Int. J. Mol. Sci. 2025, 26, 8100. https://doi.org/10.3390/ijms26168100
Abramicheva PA, Sokolov IA, Druzhinina AA, Potashnikova DM, Andrianova NV, Semenovich DS, Manskikh VN, Zorova LD, Yakupova EI, Vikhlyantsev IM, et al. Adaptive and Pathological Changes of the Cardiac Muscle in a Mouse Model of Renocardiac Syndrome: The Role of Nestin-Positive Cells. International Journal of Molecular Sciences. 2025; 26(16):8100. https://doi.org/10.3390/ijms26168100
Chicago/Turabian StyleAbramicheva, Polina A., Ilya A. Sokolov, Arina A. Druzhinina, Daria M. Potashnikova, Nadezda V. Andrianova, Dmitry S. Semenovich, Vasily N. Manskikh, Ljubava D. Zorova, Elmira I. Yakupova, Ivan M. Vikhlyantsev, and et al. 2025. "Adaptive and Pathological Changes of the Cardiac Muscle in a Mouse Model of Renocardiac Syndrome: The Role of Nestin-Positive Cells" International Journal of Molecular Sciences 26, no. 16: 8100. https://doi.org/10.3390/ijms26168100
APA StyleAbramicheva, P. A., Sokolov, I. A., Druzhinina, A. A., Potashnikova, D. M., Andrianova, N. V., Semenovich, D. S., Manskikh, V. N., Zorova, L. D., Yakupova, E. I., Vikhlyantsev, I. M., Tarasova, O. S., Zorov, D. B., & Plotnikov, E. Y. (2025). Adaptive and Pathological Changes of the Cardiac Muscle in a Mouse Model of Renocardiac Syndrome: The Role of Nestin-Positive Cells. International Journal of Molecular Sciences, 26(16), 8100. https://doi.org/10.3390/ijms26168100

