Next Article in Journal
Comprehensive Genetic and Molecular Characterization Confirms Hepatic Stellate Cell Origin of the Immortal Col-GFP HSC Line
Previous Article in Journal
Disease-Associated Shifts in Minor T Cell Subpopulations Define Distinct Immunopathology in HBV vs. HCV Infection
Previous Article in Special Issue
Natural Variations in Key Maturity Genes Underpin Soybean Cultivars Adaptation Beyond 50° N in Northeast China
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 26
Issue 16
10.3390/ijms26167763
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Regulatory Mechanism of the GmMYB14 Transcription Factor on Auxin-Related Proteins in Soybean

by
Lihua Peng
1,2,
Yangyan Liu
1,2,
Hongli Yang
1,
Wei Guo
1,
Qingnan Hao
1,
Shuilian Chen
1,
Songli Yuan
1,
Chanjuan Zhang
1,
Zhonglu Yang
1,
Bei Han
1,
Yi Huang
1,
Zhihui Shan
1,
Limiao Chen
1,* and
Haifeng Chen
1,*
1
Key Laboratory of Biology and Genetic Improvement of Oil Crops, Ministry of Agriculture and Rural Affairs, Oil Crops Research Institute of Chinese Academy of Agricultural Sciences, Wuhan 430062, China
2
College of Agriculture, Yangtze University, Jingzhou 434000, China
*
Authors to whom correspondence should be addressed.
Int. J. Mol. Sci. 2025, 26(16), 7763; https://doi.org/10.3390/ijms26167763
Submission received: 8 July 2025 / Revised: 6 August 2025 / Accepted: 8 August 2025 / Published: 11 August 2025
(This article belongs to the Special Issue Recent Advances in Soybean Molecular Breeding)
Browse Figures
Versions Notes

Abstract

In a previous study, GmMYB14 overexpressing (GmMYB14-OX) transgenic soybean plants displayed a semi-dwarfism and compact phenotype, which was regulated by the brassinosteroid (BR) pathway. However, the phenotype of GmMYB14-OX plants could be partly rescued after spraying them with exogenous BR. This indicates that other hormones, in addition to BR, also play a role in regulating the architecture of GmMYB14-OX plants. We observed a significant decrease in the content of endogenous indole-3-acetic acid (IAA) in transgenic soybean lines (OX9 and OX12) compared to wild type (WT) plants. The plant height, leaf area, leaf petiole length, and leaf petiole angle of GmMYB14-OX plants could also be partly rescued after applying exogenous IAA for two weeks. Transcriptome sequencing analysis revealed that the expression of many genes within the Aux/IAA gene family underwent alterations in the GmMYB14-OX transgenic soybean plants. Among them, Glyma.02G000500 (GmIAA1) showed the highest expression in GmMYB14-OX plants. Furthermore, the results of electrophoretic mobility shift assay and dual-luciferase reporter indicate that GmMYB14 protein could bind to the promoter of GmIAA1. In summary, a decrease in endogenous IAA content may be one of the factors contributing to the compact and dwarfed architecture of GmMYB14-OX plants. GmMYB14 also acts as a transcriptional activator of GmIAA1 to potentially block IAA effects. Our findings provide a theoretical basis for further investigation of the regulatory mechanism of GmMYB14 on soybean plant architecture.

1. Introduction

Soybean is a crucial oil and forage crop, boasting abundant plant proteins and oils [1]. It serves as a significant source for various agricultural products [2], health supplements [1,3], and animal feed [4]. With the continuous growth of the world’s population, the global demand for soybeans is also increasing.
As a podding crop, the yield of soybean is affected by plant architecture, including plant height, stem diameter, node number, internode length, branch number, leaf petiole length, leaf petiole angle, leaf size, etc. [5,6]. Unlike wild soybeans, cultivated soybeans have undergone multiple rounds of domestication. They generally exhibit an erect stem growth habit, with thicker stems, larger inflorescences, and bigger seeds compared to wild soybeans [5,7]. Over the past few decades, semi-dwarf breeding has been achieved in crops such as rice and wheat. Semi-dwarf varieties possess stronger lodging resistance and higher yields, which has inspired breeders to enhance the lodging resistance and yield of soybeans by selecting and breeding semi-dwarf varieties [8]. The petiole angle directly affects the canopy structure of crops. A smaller petiole angle results in a more compact plant, which not only influences light interception and photosynthetic efficiency but also effectively increases the planting density of crops and land use efficiency, thereby leading to an increase in crop yield per unit area [8,9].
MYB transcription factors (TFs) constitute one of the largest TFs families in plants. Previous research has revealed that MYB TFs not only play a role in regulating the synthesis of flavonoid secondary metabolites and responding to abiotic stresses, such as drought and cold, but also participate in the regulation of plant architecture [10,11,12]. MYB110 was a Pi-dependent negative regulator of plant height. Under both low phosphorus and high phosphorus conditions, the myb110 mutant exhibited increased rice plant height and enhanced lodging resistance [13]. Li et al. found that Dissected Leaf 1 (StDL1), an R2R3 MYB TF, regulated the dissected leaf morphology in potato (Solanum tuberosum L.), and knocking out StDL1 resulted in the non-dissected leaf morphology in plants [14]. Notably, some MYB TFs regulate the architecture of higher plant height through several hormonal pathways. Han et al. discovered that FveMYB117a inhibits the number of axillary buds during crown outgrowth in woodland strawberry (Fragaria vesca L.) by negatively regulating cytokinin (CK) synthesis [15]. In Oryza sativa, overexpression of OsMYB14 negatively regulated the expression of genes related to gibberellin (GA) synthesis, leading to reduced plant height [16]. In Arabidopsis, the AtMYB30 knockout mutant showed decreased BR levels and dwarfed plant growth [17]. In our previous study, overexpression of the GmMYB14 inhibited BR synthesis, resulting in reduced soybean plant height, decreased leaf area, and smaller petiole angles and lengths [12].
Indole-3-acetic acid (IAA) is a crucial class of plant hormones that play significant roles in plant growth, development, and morphogenesis. The auxin/indole-3-acetic acid (Aux/IAAs) gene family represents a group of early auxin responsive genes that act as repressors in the classical auxin signaling pathway [18]. Under low levels, Aux/IAA proteins can form dimers with auxin response factors (ARFs) through their PB1 domains, thereby impeding the interaction between ARFs and auxin response elements (AuxREs). Under high levels, auxin, Aux/IAA proteins, and the auxin receptor TRANSPORT INHIBITOR RESPONSE 1 (TIR1)/AUXIN SIGNALING F-BOX (AFB) form a ternary complex, which is subsequently recognized and ubiquitinated by the SKP1-CUL1-F-BOX (SCF)-type ubiquitin–protein ligase complex. Eventually, the Aux/IAA proteins are degraded by the 26S proteasome, relieving the repression on transcription [19,20]. It has been reported that Aux/IAA proteins are involved in lateral root development, aerenchyma formation, promotion of floral organ development and flowering, regulation of apical hook formation, and responses to abiotic stresses, such as salt and drought [21,22,23,24,25].
Some research has revealed that the functions of MYB TFs are associated with Aux/IAA proteins. In Brassica napus L., silencing of BnMYB69 led to reduced plant height, which was associated with impaired IAA synthesis. After supplementation with exogenous IAA, the dwarf phenotype was largely restored [26]. Overexpression of GmMYB133 in soybean led to shortened hypocotyls, reduced plant height, increased stem diameter, and significantly decreased endogenous free IAA and GA contents [27]. Yuan et al. found that under low auxin concentrations, the development of tomato trichomes was negatively regulated by the SlARF4-SlTHM1/SlMYB52-SlIAA15 network. At higher auxin concentrations, SlIAA15 was degraded, releasing SlARF4, which then inhibited the expression of SlTHM1/SlMYB52, thereby alleviating the suppression of trichome development [28]. In Camellia sinensis (L.), the interaction between CsMYB4a and CsIAA4 impeded the degradation of CsIAA4 and inhibited filament growth [29]. However, the role of MYB TFs in conjunction with Aux/IAA proteins in regulating plant architecture remains poorly understood.
In our previous study, overexpression of GmMYB14 inhibited BR synthesis, resulting in reduced plant height, decreased leaf area, and smaller petiole angles and lengths in soybean plants [12]. After application of exogenous BR, the plant architecture was partially restored to normal levels, suggesting that other hormones were also involved in regulating the compact plant architecture. In this study, we discovered that many genes related to IAA synthesis and transport were up regulated in GmMYB14-OX plants, in which the endogenous IAA content was significantly decreased. Gel shift assays and dual-luciferase reporter assays demonstrated that GmIAA1 was one of the downstream target genes of GmMYB14. After supplementation with exogenous IAA, the plant architecture of the GmMYB14-OX plants could be largely restored, proving that the dwarfed and compact plant architecture of the GmMYB14-OX lines is associated with reductions in endogenous IAA levels.

2. Results

2.1. Endogenous IAA Content of GmMYB14-OX Plants Decreased

We hypothesized that auxin may regulate the semi-dwarf and compact phenotype of transgenic GmMYB14-OX plants, in addition to BR [12]. Therefore, we measured the endogenous IAA content of OX9 and OX12 lines and WT plants. The results show that compared with WT, the endogenous IAA content of both OX9 and OX12 were significantly reduced (Figure 1), suggesting that the semi-dwarf and compact phenotype of transgenic GmMYB14-OX plants may be associated with reducing endogenous IAA levels.

2.2. Phenotype of GmMYB14-OX Plants Partially Recovered After Treatment with IAA

We explored whether spraying exogenous IAA on OX9 and OX12 plants could rescue the semi-dwarf phenotype, which may provide direct evidence for the semi-dwarfism associated with the GmMYB14 mediated decrease in IAA levels in transgenic soybean plants.
We sprayed 25 and 50 μM of IAA or mock treatment on the leaves of OX9, OX12, and WT plants. After two weeks of treatment, we measured the plant height, leaf area, leaf petiole length, and leaf petiole angle of the OX9, OX12, and WT plants. The results show that the plant height, leave area, leaf petiole length, and leaf petiole angle of the OX9, OX12, and WT plants were partially recovered (Figure 2), while the phenotype of the control plants showed no significant change. These results provide evidence that the semi-dwarf and compact phenotype of GmMYB14-OX plants is associated with endogenous IAA levels decreasing.

2.3. Differentially Expressed Genes (DEGs) in GmMYB14-OX and WT Plants

The leaves of WT and homozygous T3 generation OX9 plants were collected for RNA-seq analysis at day 24 after sowing (24 DAS). After filtering the raw data obtained from Illumina HiSeq sequencing (BGI Genomics, Shenzhen, China), the clean reads acquired for the WT plants and OX9 line were 40.8 M and 40.5 M, respectively, with a read length of 150 bp. The Q30 rate (%) and GC content (%) of the WT and OX9 line were 93.1% and 45.0%, 93.8%, and 45.1%, respectively. Subsequently, the clean reads were aligned to the reference genome using HISAT software (version: v2.0.4), with total mapping of 84.13% and 84.56% for the WT plants and OX9 line, respectively [30]. The link for the reference genome is https://phytozome-next.jgi.doe.gov/info/Gmax_Wm82_a4_v1 (accessed on 25 April 2024). DEG detection was performed using DEseq2 software (version: v1.10.1), as described by Love et al. [31].
The results show that 2923 DEGs (1648 up regulated and 1275 down regulated) were identified in leaves [12]. Among them, 25 auxin related genes were identified. We found several auxin related genes that were up regulated, including G. Max AUXIN/INDOLE-3-ACETIC ACID (GmIAA, Glyma.02G000500 and Glyma.05G229300); G. Max AUXIN RESPONSE FACTORS (GmARF, Glyma.14G217700 and Glyma.10G210600); G. Max AUXIN BINDING PROTEINS (GmABP, Glyma.15G176900 and Glyma.02G150100); G. Max AUXIN RESISTANT 1/LIKE AUXIN RESISTANT (GmAUX1/GmLAX, Glyma.02G255800); G. Max AUXIN RESISTANT (GmAXR4, Glyma.03G237400). Meanwhile, G. Max AUXIN RESISTANT 1/LIKE AUXIN RESISTANT (GmAUX1/GmLAX, Glyma.06G110200 and Glyma.03G063600); G. Max PIN FORMED PROTEIN (GmPIN, Glyma.18G241000 and Glyma.07G164600); G. Max SMALL AUXIN UP RNA (GmSAUR, Glyma.08G004100, Glyma.09G221900, Glyma.09G221800 and Glyma.16G020700) and G. Max IAA LEU RESISTANT 1 (GmILR1, Glyma.06G115100) were down regulated in OX9 leaves (Table 1).

2.4. High Expression of GmIAA1 in OX12 Leaves

GmMYB14 acts as a transcriptional activator, as demonstrated by a transactivation activity assay in a previous study [12]. To find the target gene of GmMYB14 in the auxin pathway, the expression levels of 8 genes upregulated in transcriptome analysis were verified by qRT-PCR. The results show that Glyma.02G000500 (GmIAA1), Glyma.15G176900, Glyma.05G229300, and Glyma.14G217700 were up regulated in OX12 leaves, which is basically consistent with the transcriptome results (Figure 3). Furthermore, we found that GmIAA1 exhibited the highest up regulation (2.9 fold) compared to WT. Therefore, we speculate that GmIAA1 may be a direct target gene of GmMYB14 in the auxin signaling pathway.

2.5. GmMYB14 Directly Regulated the Expression of GmIAA1

To investigate whether GmMYB14 directly regulated the expression of GmIAA1, our study used GmIAA1 as a hot probe and GmMYB14 protein as the target protein in an electrophoretic mobility shift assay (EMSA). The results show that when both GmMYB14 protein and the hot probe were present, shifted bands appeared on the gel. However, when cold probe was added, the color of the shifted band slightly faded (Figure 4a). Subsequently, we performed a transactivation assay in Arabidopsis protoplasts using the pGmIAA1::LUC reporter plasmid to verify whether GmMYB14 directly binds to the promoter region of GmIAA1. The results show that compared with the control, the promoter activity was significantly enhanced upon GmMYB14 binding to GmIAA1 (Figure 4b), demonstrating that GmMYB14 directly binds to the GmIAA1 promoter region and regulates its expression.

3. Discussion

The MYB transcription factor is one of the largest transcription factor families in plants. It not only participates in the synthesis of plant secondary metabolites and responds to various abiotic stresses, but it also regulates the plant architecture of multiple species, such as soybean [12], rice [16], and strawberry [15]. Previous research identified a transcription factor that negatively regulates the biosynthesis and accumulation of BR, thereby mediating a semi-dwarfism and compact plant architecture in GmMYB14-OX plants. However, when exogenous BR was supplemented, the plant architecture of GmMYB14-OX did not fully revert to the level of the wild type plants. Therefore, we hypothesized that the plant architecture of the GmMYB14-OX lines was also regulated by other hormones.
It is well known that auxin is the first discovered plant hormone, and the morphological development of plants depends on auxin regulation. The steady state level of auxin in cells is not only related to the metabolism of auxin but also affected by the transmembrane transport of auxin [32,33]. Some studies have found that plants can mediate the asymmetric distribution of auxin levels in cells through polar transport, thereby regulating the development of organs, such as stem meristem and leaf primordia formation and lateral root development [34,35,36,37]. In Oryza sativa, OsMYB7 increased leaf angle by reducing auxin accumulation and promoted cell elongation at the adaxial side of lamina joints [38]. Zhang et al. found that OsPIN1b regulated the rice leaf angle through the IAA pathway. In OE-OsPIN1b-1 plants, the free auxin content in the lamina joint was significantly reduced, while adaxial cell division in the pulvinus increased, ultimately promoting leaf inclination [39]. In soybean, the transcripts of GmPIN1 exhibited an asymmetric distribution at the base of the petiole. The lower cells of the petiole showed higher expression levels of GmPIN1 and elevated auxin concentrations, leading to asymmetric expansion of cells at the petiole base and resulting in changes in the petiole angle of the plant [40]. Additionally, GmPIN1 participated in nodule primordium formation through polar auxin transport [41].
In this study, we measured endogenous auxin levels in two GmMYB14-OX transgenic lines (OX9 and OX12) and found that both lines exhibited significantly reduced auxin levels compared to the control (Figure 1). These results suggest that the observed phenotypes in GmMYB14-OX plants may be associated with decreased endogenous auxin content. Interestingly, several auxin influx carrier GmAUX1s/GmLAXs (Glyma.03G063600 and Glyma.06G110200), auxin efflux carrier GmPINs (Glyma.07G164600 and Glyma.18G241000) were down regulated in OX9 leaves. AtAUX1, a homologous gene of Glyma.03G063600, regulated the accumulation of auxin in callus tissue, and the auxin levels in the aux1-22 mutant callus were significantly reduced [42,43]. AtLAX3, the homologous gene of Glyma.06G110200, has been demonstrated to alter intracellular auxin levels by regulating auxin influx activity [44,45]. These results suggest that both Glyma.03G063600 and Glyma.06G110200 may play roles in modulating auxin levels in soybean. Furthermore, although the functions of the soybean PIN family members Glyma.07G164600 and Glyma.18G241000 remain uncharacterized, their homologous genes AtPIN3 and AtPIN5 are known to participate in the regulation of intracellular auxin homeostasis, implying that Glyma.07G164600 and Glyma.18G241000 may possess important biological functions [46,47,48]. IAA amino acid hydrolase ILR1 like 6 (Glyma.06G115100), a member of the soybean ILR gene family, down regulated in GmMYB14-OX lines, may be affected the auxin content of the GmMYB14-OX lines by converting amino acid conjugated auxin into free auxin [33,49].
On the other hand, auxin signaling transduction also played critical roles in plant growth and development. Several auxin signaling related genes, such as OsARF4 and OsARF19, regulated the rice leaf angle by modulating asymmetric cell elongation or division [50,51]. Shin et al. demonstrated that the interaction between AtMYB77 and AtARF7 significantly reduced the lateral root number in Arabidopsis [52]. GmMYB81, the soybean homolog of AtMYB77, was also predicted to interact with ARFs to regulate plant development [53]. Song et al. revealed that OsIAA1 interacted with OsARF1, and OsIAA1 overexpressing plants exhibited morphological changes, including dwarfism and increasing leaf angles [54]. Similarly, the GmIAA27 protein mediated dwarf and multi-branching phenotypes in soybean, where amino acid mutations in its coding region disrupted its binding to GmTIR1 [55]. In this study, we found that GmIAA1 displayed the most significant up regulation in the leaves of GmMYB14-OX plants (Figure 3), further confirming an interaction between GmMYB14 and GmIAA1 (Figure 4). Ma et al. reported that the interaction between CsMYB4a and CsIAA4 blocked the ubiquitination degradation of CsIAA4 induced by α-NAA, thereby inhibiting filament elongation in tobacco [29]. We hypothesize that the binding of the GmMYB14 protein to GmIAA may affect the stability of the GmIAA protein, and this hypothesis will be verified in future experiments. However, in this study, three genes in the AUX/IAA subfamily (Glyma.20G210500, Glyma.02G142500, and Glyma.10G031900) expression were down regulated. Among these, Glyma.20G210500 is the homologous gene of GmIAA1. The down regulation of these genes suggests the presence of a compensatory mechanism, which results in a less pronounced decline in the endogenous content of IAA.
Notably, foliar application of either 25 μM or 50 μM IAA increased plant height, leaf area, leaf petiole angle, and leaf petiole length in GmMYB14-OX transgenic lines, although these morphological parameters failed to fully recover to wild type levels (Figure 2). Since spraying exogenous IAA or BR alone can partially restore the phenotype of the GmMYB14-OX lines, it is highly necessary to further investigate whether co-spraying exogenous IAA and BR can fully restore its phenotype [12]. In fact, we are currently exploring the optimal concentrations of IAA and BR in a mixed solution to avoid inhibiting plant growth due to excessively high hormone concentrations, which could compromise the accuracy of the experiment.
Transcriptome analysis revealed that DEGs in OX9 leaves were significantly enriched in the environmental adaption, lipid metabolism, biosynthesis of secondary metabolites, amino acid metabolism, and signal transduction pathways [12]. These DEGs may be involved in growth and morphological development. Moreover, recent reports have shown that MYB TFs regulated plant height, leaf shape, and axillary bud growth through the GA and CK pathway, respectively [15,17,56]. For other approaches, further verification through experiments is needed.

4. Materials and Methods

4.1. Plants Materials

In a previous study, the CDS of GmMYB14 was cloned into the pB2GW7 expression vector under the control of the cauliflower mosaic virus CaMV 35S promoter, and the construct was then transferred into the Agrobacterium tumefaciens EHA105 to transform the Tianlong No. 1 cultivar. The stable GmMYB14-OX lines OX9 and OX12 have been verified to contain a single copy of the transgene, as evidenced by Southern blot analysis [12]. Here, GmMYB14-OX homozygous lines (OX9, OX12) were used as plant materials, and they all displayed a semi-dwarfism and compact phenotype. The plump, uniformly sized, and disease free seeds of the OX9, OX12, and Tianlong No.1 (WT) were cultivated in pots (height × top diameter = 18.5 × 18.5 cm) filled with a mixture of vermiculite and nutrient soil (vermiculite:nutrient soil = 1:2). After the unifoliolate leaves had unfolded, each pot retained four seedlings. Three biological replicates per line were used in the analysis. The seedlings were grown in a greenhouse under controlled conditions of 28 °C with a 16 h light/8 h dark photoperiod.

4.2. Endogenous IAA Content Measurement

Soybean plants were grown in pots (height × top diameter = 18.5 × 18.5 cm) with two plants per pot in a greenhouse under 16 h light/8 h dark photoperiod conditions at 28 °C. Shoot parts were harvested from two week old seedlings. Three biological replicates per line were used in the analysis. Endogenous free IAA contents were quantified using ultra performance liquid chromatography electrospray ionization–tandem mass spectrometry (UPLC-ESI-MS/MS), as previously described by Lee et al. [57]. The endogenous IAA from the shoots of OX9, OX12, and WT plants was extracted using an isopropanol/water/hydrochloric acid extraction method. The endogenous IAA was then quantified using an Agilent 1260 high performance liquid chromatography (HPLC) system (Agilent Technologies, Santa Clara, CA, USA) coupled with an AB Qtrap6500 (AB Sciex, Framingham, MA, USA) mass spectrometer. The IAA standard sample was purchased from Sigma-Aldrich (St. Louis, MO, USA).

4.3. Application of Exogenous IAA

The application method for IAA followed previous studies, with slight modifications [58]. First, IAA was dissolved in 95% ethanol to prepare a stock solution, which was then diluted with deionized water to the desired concentrations for the working solution. During the V2 vegetative stage, the OX9, OX12, and WT plants were sprayed with 0, 25, and 50 μM concentrations of IAA. After 14 days of application, photographs were taken, and plant height, leaf area, leaf petiole angle, and leaf petiole length were measured. The same experiment was repeated at least twice, and photographs were taken to show representative results.

4.4. Transcriptome Analysis

Transcriptome analysis was performed in accordance with a previous study [12]. Here, the analysis process is briefly described as follows: the leaves of WT and OX9 plants were collected from the seedlings in the V2 vegetative stage (day 24 after sowing), and each sample was collected from three biological replications. Total RNA was extracted from each sample. The cDNA was synthesized using adapters and sequenced with the Illumina HiSeq 2500 platform from BGI Genomics (Shenzhen, China). The DEGs of WT and GmMYB14-OX9 line have been further analyzed with fold changes ≥ 2.0 and adjusted p-values (q-values) ≤ 0.05.

4.5. Quantitative Reverse Transcription PCR (qRT-PCR)

Total RNA of OX12 leaves during the V2 vegetative stage were extracted with Trizol, and then about 1 μg of total RNA was used for reverse transcription using the HiScript 1st Strand cDNA Synthesis Kit (Vazyme, Nanjing, China). The qRT-PCR reactions were run on the CFX ConnectTMreal time PCR System (Bio-Rad, Hercules, CA, USA) using the iTaqTM Universal SYBR Green Supermix (Bio-Rad, Hercules, CA, USA). Reactions were carried out in a 20 μL volume (Bio-Rad iTaq Universal SYBR Green Mix: 10 μL, 10 μM primer F/R: 1 μL, 0.01 μg/μL cDNA: 2 μL, RNase free ddH2O: 6 μL), and the cycling program conditions were denaturation at 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s and 58 °C for 30 s. The soybean GmActin gene was used as the reference gene. Data of three biological replicates were analyzed following the relative quantification method (2−∆∆CT) [59]. The relative expression levels were normalized to the expression level of Tianlong No.1 (WT). The primers used for RT-qPCR are shown in Table 2.

4.6. Electrophoretic Mobility Shift Assay (EMSA)

EMSA was performed essentially as previously described by Hellman et al. [60]. Briefly, the full -length CDS of GmMYB14 was amplified by PCR and then cloned into the NdeI/XbaI sites of the pCzn1-His expression vector using the ClonExpress II One Step Cloning Kit (Vazyme, Nanjing, China) for the expression of the GmMYB14 protein in Escherichia coli DE3 strain. The recombinant GmMYB14 protein was purified using Ni-affinity chromatography. EMSA was conducted using an EMSA Kit (Thermo Fisher Scientific, Shanghai, China). DNA-protein complexes were separated on a non-denaturing 6% polyacrylamide gel, transferred to a positively charged nylon membrane, and cross-linked by UV irradiation. Detection of DNA-protein complexes was performed using streptavidin-HRP conjugates, followed by incubation with the substrate from an enhanced chemiluminescence (ECL) kit (Amersham, Buckinghamshire, UK).

4.7. Dual-Luciferase Assay

The 1000 bp DNA sequence upstream of the start codon ATG of the GmIAA1 gene amplified from WT plants and subcloned into the pGreenII-LUC vector to generate the pGmIAA1::LUC reporter plasmid. The empty pGreenII-LUC vector (without promoter insertion) was used as a control. The effector plasmid was constructed by subcloning the full-length CDS of GmMYB14 into the pAN580 vector under the control of the 35S promoter. The reporter plasmid (along with the control plasmid) and the effector plasmid were co-transformed into Arabidopsis protoplasts, as previously described [61]. Each samples luminescence activity were measuring by the Dual-Luciferase Reporter Assay System e1910 (Promega, Wisconsin). The primers used for the dual-luciferase assay are shown in Table 2.

4.8. Data Analysis

Three biological replicates were designed for each experiment. Data are presented as mean values with error bars representing standard deviations (SDs). Student’s t-test was employed for significance analysis between two groups, while Duncan’s multiple range test was used for comparisons among multiple groups. All graphs were generated using GraphPad Prism software (version: 8.0.1) [62].

5. Conclusions

In summary, our research findings provided new insights into the regulatory mechanisms of dwarfism and compactness architecture of GmMYB14-OX lines, suggesting that in addition to the BR pathway, the phenotype of GmMYB14-OX plants may be partially attributed to significant reduction of endogenous auxin levels. We also clarified the interaction between GmMYB14 and GmIAA1 affecting plant growth and development. Our findings have enriched the understanding of the functional diversity of GmMYB14 and GmIAA1, and provide theoretical references for elucidating the regulatory mechanisms of soybean plant architecture.

Author Contributions

Conceptualization, L.C. and H.C.; methodology, L.P.; software, Y.L. and H.Y.; validation, L.P. and W.G.; formal analysis, Q.H. and S.C.; investigation, S.Y. and C.Z.; resources, Z.Y. and Z.S.; data curation, B.H. and Y.H.; writing—original draft preparation, L.P.; writing-review and editing, L.C. and H.C.; visualization, L.P. and L.C.; supervision, L.C. and H.C.; project administration, L.C. and H.C.; funding acquisition, L.C. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Acknowledgments

Science and Technology Demonstration Project of Shandong Province, Key R&D Program of Shandong Province, China (2024SFGC0402). The research was supported by The National Natural Science Foundation of China (32171957), Scientific and Technological Innovation 2030, Design and Cultivation of New High-Yielding Salt-Alkali Tolerant Soybean Varieties (2023ZD0403602), and Knowledge Innovation Program of Wuhan (2023020201010127).

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Kumar, M.; Suhag, R.; Hasan, M.; Dhumal, S.; Radha; Pandiselvam, R.; Senapathy, M.; Sampathrajan, V.; Punia, S.; Sayed, A.; et al. Black soybean (Glycine max (L.) Merr.): Paving the way toward new nutraceutical. Crit. Rev. Food Sci. Nutr. 2023, 63, 6208–6234. [Google Scholar] [CrossRef]
  2. Liu, L.; Chen, X.; Hao, L.; Zhang, G.; Jin, Z.; Li, C.; Yang, Y.; Rao, J.; Chen, B. Traditional fermented soybean products: Processing, flavor formation, nutritional and biological activities. Crit. Rev. Food Sci. Nutr. 2022, 62, 1971–1989. [Google Scholar] [CrossRef]
  3. Kim, I.S.; Yang, W.S.; Kim, C.H. Beneficial effects of soybean-derived bioactive peptides. Int. J. Mol. Sci. 2021, 22, 8570. [Google Scholar] [CrossRef]
  4. He, Y.; Wang, Y.J.; Zhang, S.Z.; Tao, W. Investigation and analysis of soybean meal supply in 2020. Feed Rev. 2021, 7, 48–50. [Google Scholar]
  5. Hou, Z.; Huang, H.; Wang, Y.; Chen, L.; Yue, L.; Liu, B.; Kong, F.; Yang, H. Molecular regulation of shoot architecture in soybean. Plant Cell Environ. 2024. [Google Scholar] [CrossRef] [PubMed]
  6. Clark, C.B.; Ma, J. The genetic basis of shoot architecture in soybean. Mol. Breed. 2023, 43, 55. [Google Scholar] [CrossRef] [PubMed]
  7. Zhou, X.; Wang, D.; Mao, Y.; Zhou, Y.; Zhao, L.; Zhang, C.; Liu, Y.; Chen, J. The organ size and morphological change during the domestication process of soybean. Front. Plant Sci. 2022, 13, 913238. [Google Scholar] [CrossRef] [PubMed]
  8. Zhang, S.; Song, Y.; Ou, R.; Liu, Y.; Li, S.; Lu, X.; Xu, S.; Su, Y.; Jiang, D.; Ding, Y.; et al. SCAG: A stratified, clustered, and growing-based algorithm for soybean branch angle extraction and ideal plant architecture evaluation. Plant Phenomics 2024, 6, 190. [Google Scholar] [CrossRef]
  9. Clark, C.B.; Wang, W.; Wang, Y.; Fear, G.J.; Wen, Z.; Wang, D.; Ren, B.; Ma, J. Identification and molecular mapping of a major quantitative trait locus underlying branch angle in soybean. Theor. Appl. Genet. 2022, 135, 777–784. [Google Scholar] [CrossRef]
  10. Liu, W.; Wang, T.; Wang, Y.; Liang, X.; Han, J.; Han, D. MbMYBC1, a M. baccata MYB transcription factor, contribute to cold and drought stress tolerance in transgenic Arabidopsis. Front. Plant Sci. 2023, 14, 1141446. [Google Scholar] [CrossRef]
  11. Li, P.H. Study on Transcriptional Regulation Mechanism of Flavonoid and Isoflavonoid Biosynthesis in Legume Plants. Ph.D. Thesis, Huazhong Agricultural University, Wuhan, China, 2017. [Google Scholar]
  12. Chen, L.; Yang, H.; Fang, Y.; Guo, W.; Chen, H.; Zhang, X.; Dai, W.; Chen, S.; Hao, Q.; Yuan, S.; et al. Overexpression of GmMYB14 improves high-density yield and drought tolerance of soybean through regulating plant architecture mediated by the brassinosteroid pathway. Plant Biotechnol. J. 2021, 19, 702–716. [Google Scholar] [CrossRef]
  13. Wang, T.; Jin, Y.; Deng, L.; Li, F.; Wang, Z.; Zhu, Y.; Wu, Y.; Qu, H.; Zhang, S.; Liu, Y.; et al. The transcription factor MYB110 regulates plant height, lodging resistance, and grain yield in rice. Plant Cell 2024, 36, 298–323. [Google Scholar] [CrossRef]
  14. Li, D.; Lu, X.; Qian, D.; Wang, P.; Tang, D.; Zhong, Y.; Shang, Y.; Guo, H.; Wang, Z.; Zhu, G.; et al. Dissected leaf 1 encodes an MYB transcription factor that controls leaf morphology in potato. Theor. Appl. Genet. 2023, 136, 183. [Google Scholar] [CrossRef]
  15. Han, Y.; Qu, M.; Liu, Z.; Kang, C. Transcription factor FveMYB117a inhibits axillary bud outgrowth by regulating cytokinin homeostasis in woodland strawberry. Plant Cell 2024, 36, 2427–2446. [Google Scholar] [CrossRef]
  16. Kim, J.S.; Chae, S.; Jo, J.E.; Kim, K.D.; Song, S.; Park, S.H.; Choi, S.; Jun, K.M.; Shim, S.; Jeon, J.; et al. OsMYB14, an R2R3-MYB transcription factor, regulates plant height through the control of hormone metabolism in rice. Mol. Cells 2024, 47, 100093. [Google Scholar] [CrossRef] [PubMed]
  17. Li, L.; Yu, X.; Thompson, A.; Guo, M.; Yoshida, S.; Asami, T.; Chory, J.; Yin, Y. Arabidopsis MYB30 is a direct target of BES1 and cooperates with BES1 to regulate brassinosteroid-induced gene expression. Plant J. 2009, 58, 275–286. [Google Scholar] [CrossRef]
  18. Li, Y.Y.; Qi, Y.H. Research advances in biological functions of plant Aux/IAA gene family. Chin. Bull. Bot. 2022, 57, 30–41. [Google Scholar]
  19. Luo, J.; Zhou, J.; Zhang, J. Aux/IAA gene family in plants: Molecular structure, regulation, and function. Int. J. Mol. Sci. 2018, 19, 259. [Google Scholar] [CrossRef] [PubMed]
  20. Cancé, C.; Martin-Arevalillo, R.; Boubekeur, K.; Dumas, R. Auxin response factors are keys to the many auxin doors. New Phytol. 2022, 235, 402–419. [Google Scholar] [CrossRef] [PubMed]
  21. Li, Y.; Wang, L.; Yu, B.; Guo, J.; Zhao, Y.; Zhu, Y. Expression Analysis of AUX/IAA family genes in apple under salt stress. Biochem. Genet. 2022, 60, 1205–1221. [Google Scholar] [CrossRef]
  22. Wang, F.; Niu, H.; Xin, D.; Long, Y.; Wang, G.; Liu, Z.; Li, G.; Zhang, F.; Qi, M.; Ye, Y.; et al. OsIAA18, an Aux/IAA transcription factor gene, is involved in salt and drought tolerance in rice. Front. Plant Sci. 2021, 12, 738660. [Google Scholar] [CrossRef] [PubMed]
  23. Yamauchi, T.; Tanaka, A.; Inahashi, H.; Nishizawa, N.K.; Tsutsumi, N.; Inukai, Y.; Nakazono, M. Fine control of aerenchyma and lateral root development through AUX/IAA- and ARF-dependent auxin signaling. Proc. Natl. Acad. Sci. USA 2019, 116, 20770–20775. [Google Scholar] [CrossRef]
  24. Cao, M.; Chen, R.; Li, P.; Yu, Y.; Zheng, R.; Ge, D.; Zheng, W.; Wang, X.; Gu, Y.; Gelová, Z.; et al. TMK1-mediated auxin signalling regulates differential growth of the apical hook. Nature 2019, 568, 240–243. [Google Scholar] [CrossRef] [PubMed]
  25. Si, C.; Zeng, D.; Da Silva, J.A.T.; Qiu, S.; Duan, J.; Bai, S.; He, C. Genome-wide identification of Aux/IAA and ARF gene families reveals their potential roles in flower opening of dendrobium officinale. BMC Genom. 2023, 24, 199. [Google Scholar] [CrossRef]
  26. Lin, N.; Wang, M.; Jiang, J.; Zhou, Q.; Yin, J.; Li, J.; Lian, J.; Xue, Y.; Chai, Y. Down regulation of Brassica napus MYB69 (BnMYB69) increases biomass growth and disease susceptibility via remodeling phytohormone, chlorophyll, shikimate and lignin levels. Front. Plant Sci. 2023, 14, 1157836. [Google Scholar] [CrossRef]
  27. Shan, B.H. Functional Study and Molecular Mechanisms of GmMYB133 in Regulating Plant Height in Soybean (Glycine max). Master’s Thesis, Jilin University, Changchun, China, 2022. [Google Scholar]
  28. Yuan, Y.J. Auxin Signaling Pathway Dependent on R2R3 MYB Regulates Tomato Trichome Formation. Ph.D. Thesis, Chongqing University, Chongqing, China, 2020. [Google Scholar]
  29. Ma, G.; Li, M.; Wu, Y.; Jiang, C.; Chen, Y.; Xing, D.; Zhao, Y.; Liu, Y.; Jiang, X.; Xia, T.; et al. Camellia sinensis CsMYB4a participates in regulation of stamen growth by interaction with auxin signaling transduction repressor CsAUX/IAA4. Crop. J. 2024, 12, 188–201. [Google Scholar] [CrossRef]
  30. Kim, D.; Langmead, B.; Salzberg, S.L. HISAT: A fast spliced aligner with low memory requirements. Nat. Methods 2015, 12, 357–360. [Google Scholar] [CrossRef] [PubMed]
  31. Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef]
  32. Strader, L.C.; Bartel, B. Transport and metabolism of the endogenous auxin precursor indole-3-butyric acid. Mol. Plant 2011, 4, 477–486. [Google Scholar] [CrossRef]
  33. Casanova-Sáez, R.; Mateo-Bonmatí, E.; Ljung, K. Auxin metabolism in plants. Cold Spring Harb. Perspect. Biol. 2021, 13, a039867. [Google Scholar] [CrossRef]
  34. Wang, Y.; Jiao, Y. Auxin and above-ground meristems. J. Exp. Bot. 2018, 69, 147–154. [Google Scholar] [CrossRef]
  35. Dong, J.; Huang, H. Auxin polar transport flanking incipient primordium initiates leaf adaxial-abaxial polarity patterning. J. Integr. Plant Biol. 2018, 60, 455–464. [Google Scholar] [CrossRef]
  36. Benková, E.; Michniewicz, M.; Sauer, M.; Teichmann, T.; Seifertova, D.; Jurgens, G.; Friml, J. Local, efflux-dependent auxin gradients as a common module for plant organ formation. Cell 2003, 115, 591–602. [Google Scholar] [CrossRef]
  37. Wang, Q.; Marconi, M.; Guan, C.; Wabnik, K.; Jiao, Y. Polar auxin transport modulates early leaf flattening. Proc. Natl. Acad. Sci. USA 2022, 119, e2079398177. [Google Scholar] [CrossRef] [PubMed]
  38. Kim, S.; Yoon, J.; Kim, H.; Lee, S.; Kim, T.; Kang, K.; Paek, N. OsMYB7 determines leaf angle at the late developmental stage of lamina joints in rice. Front. Plant Sci. 2023, 14, 1167202. [Google Scholar] [CrossRef] [PubMed]
  39. Zhang, Y.; Han, S.; Lin, Y.; Qiao, J.; Han, N.; Li, Y.; Feng, Y.; Li, D.; Qi, Y. Auxin transporter OsPIN1b, a novel regulator of leaf inclination in rice (Oryza sativa L.). Plants 2023, 12, 409. [Google Scholar] [CrossRef]
  40. Zhang, Z.; Gao, L.; Ke, M.; Gao, Z.; Tu, T.; Huang, L.; Chen, J.; Guan, Y.; Huang, X.; Chen, X. GmPIN1-mediated auxin asymmetry regulates leaf petiole angle and plant architecture in soybean. J. Integr. Plant Biol. 2022, 64, 1325–1338. [Google Scholar] [CrossRef] [PubMed]
  41. Gao, Z.; Chen, Z.; Cui, Y.; Ke, M.; Xu, H.; Xu, Q.; Chen, J.; Li, Y.; Huang, L.; Zhao, H.; et al. GmPIN-dependent polar auxin transport is involved in soybean nodule development. Plant Cell 2021, 33, 2981–3003. [Google Scholar] [CrossRef]
  42. Wiśniewska, J.; Kęsy, J.; Mucha, N.; Tyburski, J. Auxin resistant 1 gene (AUX1) mediates auxin effect on Arabidopsis thaliana callus growth by regulating its content and distribution pattern. J. Plant Physiol. 2024, 293, 154168. [Google Scholar] [CrossRef]
  43. Yang, Z.; Wei, H.; Gan, Y.; Liu, H.; Cao, Y.; An, H.; Que, X.; Gao, Y.; Zhu, L.; Tan, S.; et al. Structural insights into auxin influx mediated by the Arabidopsis AUX1. Cell 2025, 188, 3960–3973.e15. [Google Scholar] [CrossRef]
  44. Mellor, N.; Bennett, M.J.; King, J.R. GH3-mediated auxin conjugation can result in either transient or oscillatory transcriptional auxin responses. Bull. Math. Biol. 2016, 78, 210–234. [Google Scholar] [CrossRef] [PubMed]
  45. Péret, B.; Middleton, A.M.; French, A.P.; Larrieu, A.; Bishopp, A.; Njo, M.; Wells, D.M.; Porco, S.; Mellor, N.; Band, L.R.; et al. Sequential induction of auxin efflux and influx carriers regulates lateral root emergence. Mol. Syst. Biol. 2013, 9, 699. [Google Scholar] [CrossRef]
  46. Tognacca, R.S.; Ljung, K.; Botto, J.F. Unveiling molecular signatures in light-induced seed germination: Insights from PIN3, PIN7, and AUX1 in Arabidopsis thaliana. Plants. 2024, 13, 408. [Google Scholar] [CrossRef] [PubMed]
  47. Seifu, Y.W.; Pukyšová, V.; Rýdza, N.; Bilanovičová, V.; Zwiewka, M.; Sedláček, M.; Nodzyński, T. Mapping the membrane orientation of auxin homeostasis regulators PIN5 and PIN8 in Arabidopsis thaliana root cells reveals their divergent topology. Plant Methods 2024, 20, 84. [Google Scholar] [CrossRef]
  48. Mravec, J.; Skůpa, P.; Bailly, A.; Hoyerová, K.; Křeček, P.; Bielach, A.; Petrášek, J.; Zhang, J.; Gaykova, V.; Stierhof, Y.; et al. Subcellular homeostasis of phytohormoneauxin is mediated by the ER-localized PIN5 transporter. Nature 2009, 459, 1136–1140. [Google Scholar] [CrossRef]
  49. Hayashi, K.; Arai, K.; Aoi, Y.; Tanaka, Y.; Hira, H.; Guo, R.; Hu, Y.; Ge, C.; Zhao, Y.; Kasahara, H.; et al. The main oxidative inactivation pathway of the plant hormone auxin. Nat. Commun. 2021, 12, 6752. [Google Scholar] [CrossRef]
  50. Qiao, J.; Zhang, Y.; Han, S.; Chang, S.; Gao, Z.; Qi, Y.; Qian, Q. OsARF4 regulates leaf inclination via auxin and brassinosteroid pathways in rice. Front. Plant Sci. 2022, 13, 979033. [Google Scholar] [CrossRef]
  51. Zhang, S.; Wang, S.; Xu, Y.; Yu, C.; Shen, C.; Qian, Q.; Geisler, M.; Jiang, D.A.; Qi, Y. Auxin response factor, OsARF19, controls rice leaf angles through positively regulating OsGH3-5 and OsBRI1. Plant Cell Environ. 2015, 38, 638–654. [Google Scholar] [CrossRef] [PubMed]
  52. Shin, R.; Burch, A.Y.; Huppert, K.A.; Tiwari, S.B.; Murphy, A.S.; Guilfoyle, T.J.; Schachtman, D.P. Arabidopsis transcription factor MYB77 modulates auxin signal transduction. Plant Cell 2007, 19, 2440–2453. [Google Scholar] [CrossRef]
  53. Bian, S.; Jin, D.; Sun, G.; Shan, B.; Zhou, H.; Wang, J.; Zhai, L.; Li, X. Characterization of the soybean R2R3-MYB transcription factor GmMYB81 and its functional roles under abiotic stresses. Gene 2020, 753, 144803. [Google Scholar] [CrossRef]
  54. Song, Y.; You, J.; Xiong, L. Characterization of OsIAA1 gene, a member of rice Aux/IAA family involved in auxin and brassinosteroid hormone responses and plant morphogenesis. Plant Mol. Biol. 2009, 70, 297–309. [Google Scholar] [CrossRef]
  55. Su, B.; Wu, H.; Guo, Y.; Gao, H.; Wei, Z.; Zhao, Y.; Qiu, L. GmIAA27 encodes an AUX/IAA protein involved in dwarfing and multi-branching in soybean. Int. J. Mol. Sci. 2022, 23, 8643. [Google Scholar] [CrossRef]
  56. Bar, M.; Israeli, A.; Levy, M.; Gera, H.B.; Jiménez-Gómez, J.M.; Kouril, S.; Tarkowski, P.; Ori, N. CLAUSA is a MYB transcription factor that promotes leaf differentiation by attenuating cytokinin signaling. Plant Cell 2016, 28, 1602–1615. [Google Scholar] [CrossRef]
  57. Lee, K.W.; Chen, J.J.W.; Wu, C.S.; Chang, H.C.; Chen, H.Y.; Kuo, H.H.; Lee, Y.S.; Chang, Y.L.; Chang, H.C.; Shiue, S.Y.; et al. Auxin plays a role in the adaptation of rice to anaerobic germination and seedling establishment. Plant Cell Environ. 2023, 46, 1157–1175. [Google Scholar] [CrossRef] [PubMed]
  58. Gören-Sağlam, N.; Harrison, E.; Breeze, E.; Öz, G.; Buchanan-Wollaston, V. Analysis of the impact of indole-3-acetic acid (IAA) on gene expression during leaf senescence in Arabidopsis thaliana. Physiol. Mol. Biol. Plants 2020, 26, 733–745. [Google Scholar] [CrossRef] [PubMed]
  59. Chen, L.M.; Zhou, X.A.; Li, W.B.; Chang, W.; Zhou, R.; Wang, C.; Sha, A.H.; Shan, Z.H.; Zhang, C.J.; Qiu, D.Z.; et al. Genome-wide transcriptional analysis of two soybean genotypes under dehydration and rehydration conditions. BMC Genomics. 2013, 14, 687. [Google Scholar] [CrossRef] [PubMed]
  60. Hellman, L.M.; Fried, M.G. Electrophoretic mobility shift assay (EMSA) for detecting protein–nucleic acid interactions. Nat. Protoc. 2007, 2, 1849–1861. [Google Scholar] [CrossRef]
  61. Yoo, S.D.; Cho, Y.H.; Sheen, J. Arabidopsis mesophyll protoplasts: A versatile cell system for transient gene expression analysis. Nat. Protoc. 2007, 2, 1565–1572. [Google Scholar] [CrossRef]
  62. Motulsky, H.J.; Brown, R.E. Detecting outliers when fitting data with nonlinear regression—A new method based on robust nonlinear regression and the false discovery rate. BMC Bioinform. 2006, 7, 123. [Google Scholar] [CrossRef]
Ijms 26 07763 g001
Figure 1. Endogenous IAA content of GmMYB14-OX and WT plants. Data are shown with three biological replicates. The values are the means ± SD (n = 3). Statistically significant differences between OX9 or OX12 and WT are marked with asterisks (** p < 0.01, and *** p < 0.001; Student’s t-test).
Figure 1. Endogenous IAA content of GmMYB14-OX and WT plants. Data are shown with three biological replicates. The values are the means ± SD (n = 3). Statistically significant differences between OX9 or OX12 and WT are marked with asterisks (** p < 0.01, and *** p < 0.001; Student’s t-test).
Ijms 26 07763 g001
Ijms 26 07763 g002
Figure 2. Exogenous IAA regulated the plant architecture of transgenic GmMYB14-OX plants and WT plants. (a–c) Phenotypes of OX9, OX12, and WT plants after treatment with 0, 25, and 50 μM of IAA for two weeks. (d–g) Plant height, leaf area, leaf petiole length, and leaf petiole angle of the OX9, OX12, and WT plants after treatment with 0, 25, and 50 μM IAA for two weeks. Data are shown with 3 biological replicates. The values were the means ± SD (n = 3). Significant differences are shown with different letters following Duncan’s multiple range test (p < 0.05).
Figure 2. Exogenous IAA regulated the plant architecture of transgenic GmMYB14-OX plants and WT plants. (a–c) Phenotypes of OX9, OX12, and WT plants after treatment with 0, 25, and 50 μM of IAA for two weeks. (d–g) Plant height, leaf area, leaf petiole length, and leaf petiole angle of the OX9, OX12, and WT plants after treatment with 0, 25, and 50 μM IAA for two weeks. Data are shown with 3 biological replicates. The values were the means ± SD (n = 3). Significant differences are shown with different letters following Duncan’s multiple range test (p < 0.05).
Ijms 26 07763 g002
Ijms 26 07763 g003
Figure 3. Relative expression levels of auxin related genes in OX12 leaves. Data are shown with 3 biological replicates. Relative expression levels were normalized to the expression levels of Tianlong No. 1 (WT).
Figure 3. Relative expression levels of auxin related genes in OX12 leaves. Data are shown with 3 biological replicates. Relative expression levels were normalized to the expression levels of Tianlong No. 1 (WT).
Ijms 26 07763 g003
Ijms 26 07763 g004
Figure 4. GmMYB14 TF activates GmIAA1 expression. (a) Electrophoretic mobility shift assay (EMSA) showing the interaction between GmMYB14 and GmIAA1. GmIAA1 was used as the hot probe, with a 100 × competitive cold probe used for the binding competition test. Lanes 1, 3: Only included biotin probe or hot probe, used as negative controls. Lane 2: Co incubation of GmMYB14 protein and biotin probe as positive controls. Lane 4: Co-incubation of GmMYB14 protein and hot probe (shifted band). Lane 5: Interaction between GmMYB14 protein and hot probe, with the competition test by a 100 × cold probe. (b) GmMYB14 protein enhanced the transcription activity of LUCIFERASE (LUC) reporter gene driven by pGmIAA1 promoter in Arabidopsis protoplasts. LUC activity was normalized to the respective Renilla luciferase (REN) activity and expressed as relative luminescence units. Data are presented as mean ± SD (n = 3). Statistical significance was determined by Student’s t-test (** p < 0.01).
Figure 4. GmMYB14 TF activates GmIAA1 expression. (a) Electrophoretic mobility shift assay (EMSA) showing the interaction between GmMYB14 and GmIAA1. GmIAA1 was used as the hot probe, with a 100 × competitive cold probe used for the binding competition test. Lanes 1, 3: Only included biotin probe or hot probe, used as negative controls. Lane 2: Co incubation of GmMYB14 protein and biotin probe as positive controls. Lane 4: Co-incubation of GmMYB14 protein and hot probe (shifted band). Lane 5: Interaction between GmMYB14 protein and hot probe, with the competition test by a 100 × cold probe. (b) GmMYB14 protein enhanced the transcription activity of LUCIFERASE (LUC) reporter gene driven by pGmIAA1 promoter in Arabidopsis protoplasts. LUC activity was normalized to the respective Renilla luciferase (REN) activity and expressed as relative luminescence units. Data are presented as mean ± SD (n = 3). Statistical significance was determined by Student’s t-test (** p < 0.01).
Ijms 26 07763 g004
Table 1. Auxin related DEGs of OX9 leaves.
Table 1. Auxin related DEGs of OX9 leaves.
ClassGene IDFold ChangesA. thalianaAnnotations
UpGmARFGlyma.14G2177004.71AT1G19850Auxin response factor 5
Glyma.10G2106003.48AT4G30080Auxin response factor 10 related
GmAUX/IAAGlyma.02G0005002.49AT5G43700Auxin responsive protein IAA 1 related
Glyma.05G2293003.28AT4G29080Auxin induced protein
GmABPGlyma.15G1769003.91AT5G20630Germin like protein subfamily 3 member 3
Glyma.02G1501004.58AT4G02980Auxin binding protein 1
GmAUX1/LAXGlyma.02G2558004.65AT2G38120Amino acid transporter
GmAXR4Glyma.03G2374002.09AT1G54990Protein auxin response 4 like
DownGmARFGlyma.11G145500−2.73AT2G28350Auxin response factor 10 related
Glyma.09G072200−3.37AT5G20730Auxin response factor 19 related
Glyma.01G002100−3.53AT5G20730Auxin response factor
Glyma.13G112600−4.41AT5G20730Auxin response factor 19 related
GmAUX/IAAGlyma.02G142500−2.23AT3G23050Auxin responsive protein IAA16
Glyma.03G158700−2.24AT4G14550Auxin induced protein AUX28
Glyma.20G210500−2.14AT5G43700Auxin responsive protein IAA 1 related
Glyma.10G031900−2.33AT3G23050Auxin responsive protein IAA16
GmAUX1/LAXGlyma.06G110200−2.09AT1G77690Auxin transporter protein 2 related
Glyma.03G063600−2.64AT2G38120Auxin transporter protein 1 related
GmPINGlyma.18G241000−3.84AT5G16530Auxin efflux carrier component 8 related
Glyma.07G164600−4.12AT1G70940Auxin efflux carrier component 3 related
GmSAURGlyma.08G004100−2.33AT2G46690Small auxin up RNA
Glyma.09G221900−3.70AT4G38840Small auxin up RNA
Glyma.09G221800−4.78AT4G38840Small auxin up RNA
Glyma.16G020700−2.26AT2G46690Small auxin up RNA
GmILR1Glyma.06G115100−6.10AT1G44350IAA amino acid hydrolase ILR1 like 6
Table 2. Primers used for qRT-PCR analysis, EMSA, and dual-luciferase assay.
Table 2. Primers used for qRT-PCR analysis, EMSA, and dual-luciferase assay.
NamePrimer Sequences (5’-3’)Application
Glyma.02G255800-FTTGACACATTTGGACTCTTGCqRT-PCR
Glyma.02G255800-RTCAATGATGCAGCTTTGTGTTG
Glyma.14G217700-FATGAAGACCACACTTGCAGCAG
Glyma.14G217700-RTATCAATTTTGCCAAGAGGGTG
Glyma.02G150100-FGGTAGAACGTTGTACGAGTCCG
Glyma.02G150100-RAGTCATGTGAGAGAGACCAGCC
Glyma.15G176900-FGCCTCCAGATTCTGGACTTTTC
Glyma.15G176900-RTTAACCTGACCCTCCAAGAACA
Glyma.10G210600-FCACAAGACATCTAATGCTTCCGAT
Glyma.10G210600-RTTGTCAGTTCCAAGATCAGACTTG
Glyam.05G229300-FATGTCTGAGGCATTGGAAGATGT
Glyam.05G229300-RATCCACCATTCCAGTTTTCATCA
Glyma.03G237400-FAGGAAAGTTGAACAGGAGTCCAC
Glyma.03G237400-RGCGTCCATATAATTAGCTCCATG
Glyma.02G255800-FTTGACACATTTGGACTCTTTGC
Glyma.02G255800-RTCAATGATGCAGCTTTGTGTTG
GmActin-FATCTTGACTGAGCGTGGTTATTCC
GmActin-RGCTGGTCCTGGCTGTCTCC
GmIAA1-FAGCTGTTTAACGGTATGTTTAGEMSA
GmIAA-LUC-FACGGTATCGATAAGCTTCGCATTTAAGCTGTTTAACGGDual-luciferase assay
GmIAA-LUC-RAGAACTAGTGGATCCGTGACCAGATTATCAGAATCC
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Peng, L.; Liu, Y.; Yang, H.; Guo, W.; Hao, Q.; Chen, S.; Yuan, S.; Zhang, C.; Yang, Z.; Han, B.; et al. Regulatory Mechanism of the GmMYB14 Transcription Factor on Auxin-Related Proteins in Soybean. Int. J. Mol. Sci. 2025, 26, 7763. https://doi.org/10.3390/ijms26167763

AMA Style

Peng L, Liu Y, Yang H, Guo W, Hao Q, Chen S, Yuan S, Zhang C, Yang Z, Han B, et al. Regulatory Mechanism of the GmMYB14 Transcription Factor on Auxin-Related Proteins in Soybean. International Journal of Molecular Sciences. 2025; 26(16):7763. https://doi.org/10.3390/ijms26167763

Chicago/Turabian Style

Peng, Lihua, Yangyan Liu, Hongli Yang, Wei Guo, Qingnan Hao, Shuilian Chen, Songli Yuan, Chanjuan Zhang, Zhonglu Yang, Bei Han, and et al. 2025. "Regulatory Mechanism of the GmMYB14 Transcription Factor on Auxin-Related Proteins in Soybean" International Journal of Molecular Sciences 26, no. 16: 7763. https://doi.org/10.3390/ijms26167763

APA Style

Peng, L., Liu, Y., Yang, H., Guo, W., Hao, Q., Chen, S., Yuan, S., Zhang, C., Yang, Z., Han, B., Huang, Y., Shan, Z., Chen, L., & Chen, H. (2025). Regulatory Mechanism of the GmMYB14 Transcription Factor on Auxin-Related Proteins in Soybean. International Journal of Molecular Sciences, 26(16), 7763. https://doi.org/10.3390/ijms26167763

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop