Real-Time PCR-Based Detection of Hepatitis E Virus in Groundwater: Primer Performance and Method Validation
1
Biomedical Research Institute, Dankook University Hospital, Cheonan 31116, Republic of Korea
2
Department of Chemistry, College of Science and Engineering, Dankook University, Cheonan 31116, Republic of Korea
3
R&D Team, LSLK Co., Ltd., Gimpo 10111, Republic of Korea
4
Water Use and Management Research Division, Water Environmental Research Department, National Institute of Environmental Research, Incheon 22689, Republic of Korea
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Int. J. Mol. Sci. 2025, 26(15), 7377; https://doi.org/10.3390/ijms26157377
Submission received: 7 July 2025
/
Revised: 26 July 2025
/
Accepted: 28 July 2025
/
Published: 30 July 2025
(This article belongs to the Special Issue Microbial Infections and Novel Biological Molecules for Treatment)
Abstract
Hepatitis E virus (HEV) is a leading cause of acute viral hepatitis and is primarily transmitted via contaminated water and food. Groundwater may also serve as a potential vector for HEV transmission. This study aimed to optimize real-time polymerase chain reaction (rtPCR) for the detection of HEV, employing both TaqMan probe- and SYBR Green-based methods. A total of 12 primer sets for the TaqMan probe-based method and 41 primer sets for the SYBR Green-based method were evaluated in order to identify the optimal combinations. Primer sets #4 (TaqMan probe-based) and #21 (SYBR Green-based) demonstrated the highest sensitivity and specificity, successfully detecting HEV in artificially spiked samples at 1 fg/μL. The TaqMan probe-based method facilitated rapid detection with minimized non-specific amplification, whereas the SYBR Green-based method allowed for broader primer exploration by leveraging melting curve analysis. Despite the absence of HEV detection in 123 groundwater samples, this study underscores the value of real-time PCR for environmental monitoring and paves the way for enhanced diagnostic tools for public health applications.
1. Introduction
Hepatitis E virus (HEV) is a non-enveloped RNA virus belonging to the Hepeviridae family that causes hepatitis, with four major genotypes (GT1, GT2, GT3, and GT4) [1,2]. Globally, HEV is predominantly distributed in areas with inadequate sewage management and poor hygiene and sanitation, with a particularly high prevalence in low-resource and developing countries [3,4]. The virus can be contracted primarily through ingestion of contaminated water or food and contact with infected animals [5,6,7]. Groundwater has been identified as a potential vector for infection [8]. While hepatitis E vaccines are currently available in some countries, they are not universally accessible worldwide, which has significant implications for public health [9,10]. Detecting HEV in environmental samples, particularly groundwater, is more challenging due to the low concentration of the target viruses and the presence of numerous interfering substances [11,12]. Consequently, numerous researchers have devised a range of biological molecular techniques for diagnosing HEV.
So far, testing has been conducted using a number of different methods, including reverse-transcription (RT) polymerase chain reaction (PCR), nested PCR, loop-mediated isothermal amplification (LAMP), droplet digital PCR (ddPCR), and clustered regularly interspaced short palindromic repeat (CRISPR)-based techniques [13,14,15,16,17]. These methods are constrained by their complexity, potential for contamination, non-specific reactions, and the need for specialized equipment [18,19,20]. However, real-time PCR (rtPCR) is a well-established technique that can be validated in real time, has a rapid detection time, and exhibits high sensitivity and specificity [21]. Moreover, the technique allows for not only qualitative but also quantitative analyses [22]. Accordingly, various primers and rtPCR techniques have been developed; however, the efficacy of each primer for rtPCR-based methods has not been assessed using groundwater samples.
Therefore, this study aimed to compare and evaluate the reaction efficiency of previously developed primers and probes for the diagnosis of HEV in groundwater samples, with a view to identifying the optimal combination.
2. Results
Following the amplification of 12 primer sets for the TaqMan probe-based method, primer sets #8 and #11 were found to be non-reactive, while primer sets 1 and 10 exhibited Cq values exceeding 35. Consequently, these four primer sets were initially excluded. Subsequently, the specificity of the primer sets was assessed using 22 reference viruses, and all primer sets demonstrated high specificity. The sensitivity test using a 10-fold serially diluted HEV plasmid revealed that primer set #4 could amplify the plasmid even at the lowest concentration (100 fg/μL) (Table 1).
A total of 41 combined primer sets were tested using the SYBR Green-based method to identify the optimal primer set. In this manner, negative samples exhibiting even minimal reactivity were excluded. Subsequently, ten primer sets were selected in accordance with the order of the lowest Cq value. The ten selected primer sets (# 4, 5, 6, 7, 13, 15, 20, 21, 22, and 23) were subsequently employed in sensitivity and specificity tests. The results demonstrated that the primer sets #6, #15, and #21 were capable of detecting positive samples at the lowest concentration (100 fg/μL) with Cq values ≤35 (Table 2). The three selected primer sets were employed in the specificity tests with 22 RefVs. The results demonstrated that each primer set exhibited a Cq value ≥35 (Supplementary Table S1). As a final confirmation step, a melting curve analysis was conducted to verify cross-reactivities. The results demonstrated a distinction between the melting peak of the HEV positive control (PC) and that of the RefVs’ amplification products (#6, PC 79.0 °C/RefV 80.5–84.0 °C). The melting curves for the HEV positive control and RefVs’ amplification products for the #6 primer set were as follows: #6, PC 79.0 °C/RefV 80.5 °C; #15, PC 78.5 °C/RefV 79.5 °C; #21, PC 78.0 °C/<75.0 °C and >80.5 °C (Supplementary Figure S1).
A total of 123 groundwater samples were analyzed using three primer sets selected from the TaqMan probe- and the SYBR Green-based methods as the primary testing techniques. Although HEV was not detected in these environmental samples, to confirm the sensitivity of the method with environmental samples, an experiment was performed using artificially spiked samples (ASSs). The TaqMan probe-based primer set #4 was capable of detecting ASSs at a concentration of 1 fg/μL, with a reaction time of 78 min (Table 1). Additionally, three of the SYBR Green-based primer sets—#6, #15, and #21—were also able to detect ASSs at a concentration of 1 fg/μL in a manner comparable to the TaqMan probe-based primer set (Figure 1). The selected primer sets demonstrated high sensitivity and showed potential applicability for environmental monitoring.
To validate the experiment, three analysts repeated the sensitivity experiment using ASSs. The TaqMan probe-based method exhibited 10 times reduced sensitivity, with two of the three analysts detecting concentrations down to 10 fg/μL. However, one experimenter yielded identical results, detecting concentrations down to 1 fg/μL (Figure 2). To compare the two candidate primer sets (#15 and #21) using the SYBR Green-based method, three analysts performed two replicates and compared the Cq values, including the results provided by the developer. The results were averaged, with the maximum and minimum values for each concentration excluded. The results demonstrated that primer set #21 exhibited slightly greater sensitivity (Table 3). Consequently, the #21 primer set was selected for further analysis.
3. Discussion
This study aimed to compare and evaluate the detection efficiency of rtPCR-based tests for HEV in groundwater in Korea, utilizing previously reported primers and probe sets. The results demonstrated that both the TaqMan probe- and the SYBR Green-based methods have high sensitivity and specificity. The primer specificity was experimentally validated through in-silico testing using the BLAST with reference sequences (hepatitis E virus [taxid: 291484]). The test results confirmed that the selected primers specifically matched, displaying an identity of 100% with the reference sequences, thereby supporting the accuracy and reliability of our assay. Notably, primer set #4, using the TaqMan probe-based method, and primer set #21, using the SYBR Green-based method, demonstrated sensitivity for detection at a level as low as 1 fg/μL in ASSs. Furthermore, in contrast to previous studies on the detection of HEV, we assessed a multitude of primer combinations (41 sets for SYBR Green-based rtPCR) in addition to the previously documented primer sets, with the objective of exploring a broader range of possibilities. This contributed to the evaluation of the sensitivity and specificity of HEV detection, especially in complex matrices such as environmental samples. Particularly, utilizing this method for groundwater samples demonstrated its efficacy in assessing environmental samples. We also attempted to ascertain the relative advantages and weaknesses of the two rtPCR-based methods. The TaqMan probe-based method demonstrated a reduced probability of non-specific amplification and had a faster reaction time compared to the SYBR Green-based method, thereby promising greater efficiency in the analysis of environmental samples. Conversely, the SYBR Green-based method necessitated a supplementary melting curve analysis but afforded versatility to assess a broader spectrum of primer combinations.
A limitation of this study is that HEV was not detected in 123 actual groundwater samples, which may be indicative of either extremely low viral concentrations in those groundwater samples or degradation of the viral RNA due to environmental factors [23,24]. To address this, we successfully demonstrated the method sensitivity using groundwater samples artificially spiked with an HEV plasmid, underscoring the assay’s potential applicability to real-world environmental samples. Although artificially spiked samples are widely used to evaluate viral detection methods, they are known to have certain limitations, particularly regarding the overestimation of analytical sensitivity [25]. It is demonstrated that the recovery of viruses from environmental water samples can vary significantly depending on the characteristics of the sample. The recovery rates observed in this study ranged from 0.05% to 100%, and there was considerable variability across the trials. These findings suggest that preanalytical steps such as filtration and concentration may result in a substantial loss of viral particles, potentially leading to false-negative results even when viruses are present at low levels. Despite these limitations, artificially spiked samples remain a valuable tool for method standardization and performance evaluation under controlled conditions [26]. This is especially relevant in cases where naturally contaminated samples are unavailable or when the target virus, such as norovirus or hepatitis E virus, cannot be easily cultured. Rodríguez-Lázaro and colleagues underscored the technical complexity of detecting infectious virus particles, indicating that this task is not always feasible [26]. Consequently, they proposed the utilization of alternative infectivity assessment strategies. The application of artificial infection tests, encompassing surrogate viruses and animal models, provides critical insights into the feasibility of a method and the potential health risks associated with it. These tests serve as a crucial link between molecular detection and actual infectivity.
While HEV was not detected in the groundwater samples examined in this study, existing epidemiological evidence supports the ongoing circulation of HEV in South Korea. A nationwide seroprevalence study reported anti-HEV IgG positivity of 5.9% in the general population, with higher prevalence observed among individuals residing in rural areas or working in agriculture and fisheries, suggesting possible zoonotic transmission routes [27]. This is supported by the detection of anti-HEV antibodies in 18% of Korean blood donors and the identification of swine HEV genotype 3 in pig sera [28]. Furthermore, fecal shedding of HEV genotype 3 has been observed in approximately 17.5% of pigs from swine farms in South Korea [29]. These findings indicate the circulation of HEV in non-human reservoirs and foodborne matrices, suggesting the necessity of exercising caution when interpreting negative groundwater results. A multi-matrix surveillance approach, incorporating human serology, livestock monitoring, and food and water testing, is essential to comprehensively assess the public health risk posed by HEV in South Korea.
Traditional diagnostic methods, including conventional PCR, nested PCR, and LAMP, often suffer from potential contamination, non-specific amplification, complex procedures, and extended reaction times [30,31]. rtPCR provides significant improvements, including rapid detection, real-time validation, high specificity, and sensitivity. However, it requires specialized equipment and higher reagent costs, presenting potential limitations for its widespread use in resource-limited settings.
Nevertheless, this study contributes to the understanding of the environmental pathways of HEV infection and facilitates the improvement of molecular diagnostic tools for HEV monitoring, particularly in key resources such as groundwater.
4. Materials and Methods
The TaqMan probe- and SYBR green-based methods were both evaluated for rtPCR. The primer sets for both methods were collated by consulting the literature registered in PubMed from 2004 to 2023. In the event of multiple primer sets being identified, the most representative literature was selected based on the first report of primer information for inclusion (Table 4 and Table 5) [32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49]. For the primer sets employed in the SYBR Green-based method, a total of 19 forward and 11 reverse primers were combined from each literature source. These primer sets included those used in the TaqMan probe-based method. The collected primer sets were aligned against various HEV genotypes (GT1 to GT4) using the Basic Local Alignment Search Tool (BLAST 1.4.0) provided by NCBI. The primer alignment coverage indicated high conservation across different HEV genotypes. Furthermore, 41 combinations of primer sets with PCR amplicon sizes ranging from 70 to 150 nt were tested to provide greater diversity than that observed in previously reported primer sets (see Supplementary Table S2). The Cq analysis employed a threshold of 2500 relative fluorescence units (RFUs). A Cq value of less than 35 was taken to indicate a positive reaction. The conditions of the TaqMan probe-based rtPCR method were established following reference to the conditions described in the respective literature. The conditions for SYBR Green-based rtPCR were chosen following the manufacturer’s instructions (Bio-Rad, Hercules, CA, USA). For the TaqMan probe-based method, any primer set candidates that exhibited a non-specific reaction were excluded. Similarly, several primer sets in the SYBR Green-based method were excluded following confirmation by melting curve analysis. All PCR reactions were conducted using a CFX connect™ rtPCR system (Bio-Rad, Hercules, CA, USA). The TaqMan probe-based method was conducted using 10 μL of 2X Accupower® Plus Dualstar™ qPCR master mix (Bioneer, Daejeon, Republic of Korea), 1 μL of forward primer (25 pmol/μL), 1 μL of reverse primer (25 pmol/μL) and probe (25 pmol/μL), 1 μL of template, and 5.6 μL of HiGene™ RNase-Free Water (BIOFACT Co., Ltd., Daejeon, Republic of Korea). The SYBR Green-based method was prepared using 10 μL of 2X iTaq Universal SYBR® Green Supermix (Bio-Rad, Hercules, CA, USA), 1 μL of forward primer (25 pmol/μL), 1 μL of reverse primer (25 pmol/μL), 1 μL of template, and 7 μL of HiGene™ RNase-Free Water (BIOFACT Co., Ltd., Daejeon, Republic of Korea).
A synthesized HEV plasmid was used as a positive control to evaluate the rtPCR methods. The HEV positive control was prepared by Macrogen Co., Ltd. (Seoul, Republic of Korea) using the ORF2 gene sequence (accession number [FJ763142.1], 1168 nucleotides [nt]) from the National Centre for Biotechnology Information (NCBI). To determine the analytical sensitivity, a 1 ng/μL solution of the HEV plasmid was diluted 10-fold, from 10−1 (100 pg/μL) to 10−8 (10 ag/μL), and used as the template for the subsequent reaction. For testing the analytical specificity of the method, 22 reference viruses (RefVs) were used. The names, genotypes, groups, inserted genes, and concentrations of these viruses are shown in Table 3. When both rtPCR methods were conducted using groundwater samples, 3 μL of 1X SL™ non-specific reaction inhibitor (LSLK Co., Ltd., Incheon, Republic of Korea) was added. In all PCR reactions, HiGene™ RNase-Free Water (BIOFACT Co., Ltd., Daejeon, Republic of Korea) was used as a negative control. Additionally, 1 pg/μL of HEV plasmid was used as a positive control.
A total of 123 groundwater samples were collected from 47 administrative regions across 11 metropolitan cities and provinces in South Korea. The sampling wells were selected annually based on multiple criteria, including installation year, capacity, usage, and baseline microbiological indicators, such as E. coli and nitrate nitrogen. The samples were collected biannually (in the first and second halves of each year) across multiple provinces to ensure broad temporal and spatial coverage without geographical or seasonal bias. These samples were collected based on the national norovirus groundwater monitoring network operated by the National Institute of Environmental Research (NIER) under the Ministry of Environment from 2021 to 2024. The sampling procedures were carried out in accordance with the established protocols outlined in NIER Notice No. 2017-50, which serves as the standard for virus sampling methodologies [50]. At each site, a team of at least three trained personnel conducted environmental assessments, disinfected the wells following sufficient flushing, and measured water quality parameters including temperature, pH, turbidity, and residual chlorine. Pretreatment steps, including turbidity removal and dechlorination, were implemented when deemed necessary. The filtration process, which was conducted over a period of 3–5 h, involved the use of a controlled-flow housing unit equipped with a virus adsorption filter, resulting in the filtration of approximately 500 L of groundwater. The filters were transported to the laboratory on ice, and virus elution and concentration determination were performed within the recommended holding time according to the standardized recovery protocol defined by NIER Notice No. 2017-50 [51]. In addition, the virus concentration method used in this study is also based on a standardized protocol established by NIER Notice No. 2017-50 [50]. This method was developed by benchmarking the U.S. EPA Method 1615 and aligning it with ISO 15216-1:2017. It has been validated for its recovery efficiency and reproducibility. Although a process control virus was not added to individual samples, the procedure was conducted within the framework of the national groundwater virus surveillance system, which includes multiple layers of quality assurance. These include mandatory training and on-site inspections for field staff, implementation of an analytical quality control program, and regular interlaboratory proficiency testing. The absence of internal process controls is offset by the validation and verification practices embedded in this standardized method.
The groundwater samples were eluted and concentrated, and total RNA was extracted from the final concentrate in accordance with the instructions provided in the RNeasy Mini Kit manual (Qiagen, Hilden, Germany). The RNA samples of the reference viruses, including the extracted total RNA, were subjected to cDNA synthesis using ReverTra Ace-α-® (Toyobo, Osaka, Japan). The nucleic acids of the RefVs were sourced from the National Institute of Environmental Science, Ministry of Environment. Similarly, the synthetic gene sequences of the RefVs in plasmid form were obtained from NCBI and synthesized for use as the HEV positive control by Macrogen Co., Ltd. (Seoul, Republic of Korea) (Table 6). If HEV was not amplified in the environmental samples, the prepared HEV positive control (1 ng/μL) was artificially infected with a mixed solution of 10 randomly selected groundwater samples and diluted 10-fold in order to evaluate the analytical sensitivity of the two real-time PCR methods with environmental samples. The artificial infection step was performed after the sample concentration step. The above-mentioned validation experiments were conducted by three researchers.
5. Conclusions
In conclusion, the selected primer set could be further applied to assess the public health significance of HEV in both clinical and environmental surveillance and could be used for the initial monitoring of HEV infection in the future.
Supplementary Materials
The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms26157377/s1.
Author Contributions
Conceptualization, J.-H.K. and S.L.; methodology, experiments, and writing—original draft preparation, J.-H.K. and S.L.; data curation, J.-H.K., S.L. and E.-R.P.; investigation, S.L.; funding acquisition, E.-R.P.; writing—review and editing, J.-H.K., S.L. and E.-R.P. All authors contributed to and reviewed the manuscript. All authors have read and agreed to the published version of the manuscript.
Funding
This research was supported by a grant from the National Institute of Environmental Research (NIER), funded by the Ministry of Environment of the Republic of Korea (grant number: NIER-2023-01-01-166).
Institutional Review Board Statement
Not applicable.
Informed Consent Statement
Not applicable.
Data Availability Statement
All data are included in the manuscript. The HEV and reference virus genomes were obtained from GenBank, and the GenBank accession number for each sequence is provided in the manuscript. The original contributions presented in the study are included in the article/Supplementary Materials. Further inquiries can be directed to the corresponding author/s.
Conflicts of Interest
Siwon Lee was employed by the company LSLK Co., Ltd. The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as potential conflicts of interest.
References
- Wang, B.; Meng, X.J. Structural and molecular biology of hepatitis E virus. Comput. Struct. Biotechnol. J. 2021, 19, 1907–1916. [Google Scholar] [CrossRef]
- Aggarwal, R.; Goel, A. Hepatitis E: Current Status in India. Clin. Liver Dis. 2021, 18, 168–172. [Google Scholar] [CrossRef] [PubMed]
- Khuroo, M.S.; Khuroo, M.S.; Khuroo, N.S. Transmission of Hepatitis E Virus in Developing Countries. Viruses 2016, 8, 253. [Google Scholar] [CrossRef] [PubMed]
- Takuissu, G.R.; Kenmoe, S.; Ndip, L.; Ebogo-Belobo, J.T.; Kengne-Nde, C.; Mbaga, D.S.; Bowo-Ngandji, A.; Oyono, M.G.; Kenfack-Momo, R.; Tchatchouang, S.; et al. Hepatitis E Virus in Water Environments: A Systematic Review and Meta-analysis. Food Environ. Virol. 2022, 14, 223–235. [Google Scholar] [CrossRef] [PubMed]
- Van der Poel, W.H. Food and environmental routes of Hepatitis E virus transmission. Curr. Opin. Virol. 2014, 4, 91–96. [Google Scholar] [CrossRef]
- Barnaud, E.; Rogee, S.; Garry, P.; Rose, N.; Pavio, N. Thermal inactivation of infectious hepatitis E virus in experimentally contaminated food. Appl. Environ. Microbiol. 2012, 78, 5153–5159. [Google Scholar] [CrossRef]
- Denner, J. Hepatitis E virus (HEV)-The Future. Viruses 2019, 11, 251. [Google Scholar] [CrossRef]
- Itarte, M.; Fores, E.; Martinez-Puchol, S.; Scheiber, L.; Vazquez-Sune, E.; Bofill-Mas, S.; Rusinol, M. Exploring viral contamination in urban groundwater and runoff. Sci. Total Environ. 2024, 946, 174238. [Google Scholar] [CrossRef]
- Wu, X.; Chen, P.; Lin, H.; Hao, X.; Liang, Z. Hepatitis E virus: Current epidemiology and vaccine. Hum. Vaccines Immunother. 2016, 12, 2603–2610. [Google Scholar] [CrossRef]
- Peron, J.M.; Larrue, H.; Izopet, J.; Buti, M. The pressing need for a global HEV vaccine. J. Hepatol. 2023, 79, 876–880. [Google Scholar] [CrossRef]
- Baez, P.A.; Lopez, M.C.; Duque-Jaramillo, A.; Pelaez, D.; Molina, F.; Navas, M.C. First evidence of the Hepatitis E virus in environmental waters in Colombia. PLoS ONE 2017, 12, e0177525. [Google Scholar] [CrossRef]
- Abbaszadegan, M.; Stewart, P.; LeChevallier, M. A strategy for detection of viruses in groundwater by PCR. Appl. Environ. Microbiol. 1999, 65, 444–449. [Google Scholar] [CrossRef]
- La Rosa, G.; Fratini, M.; Muscillo, M.; Iaconelli, M.; Taffon, S.; Equestre, M.; Chionne, P.; Madonna, E.; Pisani, G.; Bruni, R.; et al. Molecular characterisation of human hepatitis E virus from Italy: Comparative analysis of five reverse transcription-PCR assays. Virol. J. 2014, 11, 72. [Google Scholar] [CrossRef]
- Martinez Wassaf, M.G.; Pisano, M.B.; Barril, P.A.; Elbarcha, O.C.; Pinto, M.A.; Mendes de Oliveira, J.; DiGiusto, P.; Nates, S.V.; Re, V.E. First detection of hepatitis E virus in Central Argentina: Environmental and serological survey. J. Clin. Virol. 2014, 61, 334–339. [Google Scholar] [CrossRef] [PubMed]
- Gao, S.; Li, D.; Liu, Y.; Zha, E.; Wang, S.; Li, Y.; Zhou, T.; Yue, X. Development and evaluation of a RT-LAMP assay for rapid detection of hepatitis E virus from shellfish. Int. J. Food Microbiol. 2016, 220, 1–5. [Google Scholar] [CrossRef]
- Nemes, K.; Persson, S.; Simonsson, M. Hepatitis A Virus and Hepatitis E Virus as Food- and Waterborne Pathogens-Transmission Routes and Methods for Detection in Food. Viruses 2023, 15, 1725. [Google Scholar] [CrossRef] [PubMed]
- Bahrulolum, H.; Tarrahimofrad, H.; Rouzbahani, F.N.; Nooraei, S.; Sameh, M.M.; Hajizade, A.; Ahmadian, G. Potential of CRISPR/Cas system as emerging tools in the detection of viral hepatitis infection. Virol. J. 2023, 20, 91. [Google Scholar] [CrossRef] [PubMed]
- Peters, J.M.; Silvis, M.R.; Zhao, D.; Hawkins, J.S.; Gross, C.A.; Qi, L.S. Bacterial CRISPR: Accomplishments and prospects. Curr. Opin. Microbiol. 2015, 27, 121–126. [Google Scholar] [CrossRef]
- Schuler, F.; Trotter, M.; Geltman, M.; Schwemmer, F.; Wadle, S.; Dominguez-Garrido, E.; Lopez, M.; Cervera-Acedo, C.; Santibanez, P.; von Stetten, F.; et al. Digital droplet PCR on disk. Lab. Chip 2016, 16, 208–216. [Google Scholar] [CrossRef]
- Gao, X.; Sun, B.; Guan, Y. Pullulan reduces the non-specific amplification of loop-mediated isothermal amplification (LAMP). Anal. Bioanal. Chem. 2019, 411, 1211–1218. [Google Scholar] [CrossRef]
- Al-Sadeq, D.W.; Majdalawieh, A.F.; Mesleh, A.G.; Abdalla, O.M.; Nasrallah, G.K. Laboratory challenges in the diagnosis of hepatitis E virus. J. Med. Microbiol. 2018, 67, 466–480. [Google Scholar] [CrossRef]
- Shain, E.B.; Clemens, J.M. A new method for robust quantitative and qualitative analysis of real-time PCR. Nucleic Acids Res. 2008, 36, e91. [Google Scholar] [CrossRef]
- Atoui, A.; Cordevant, C.; Chesnot, T.; Gassilloud, B. SARS-CoV-2 in the environment: Contamination routes, detection methods, persistence and removal in wastewater treatment plants. Sci. Total Environ. 2023, 881, 163453. [Google Scholar] [CrossRef]
- Takeuchi, K.; Yanagisawa, H.; Kurosawa, Y.; Iida, Y.; Kawai, K.; Fujimaki, S. Degradation of SARS-CoV-2 specific ribonucleic acid in samples for nucleic acid amplification detection. PLoS One 2022, 17, e0264541. [Google Scholar] [CrossRef]
- Petterson, S.; Grondahl-Rosado, R.; Nilsen, V.; Myrmel, M.; Robertson, L.J. Variability in the recovery of a virus concentration procedure in water: Implications for QMRA. Water Res. 2015, 87, 79–86. [Google Scholar] [CrossRef]
- Rodriguez-Lazaro, D.; Cook, N.; Ruggeri, F.M.; Sellwood, J.; Nasser, A.; Nascimento, M.S.; D’Agostino, M.; Santos, R.; Saiz, J.C.; Rzezutka, A.; et al. Virus hazards from food, water and other contaminated environments. FEMS Microbiol. Rev. 2012, 36, 786–814. [Google Scholar] [CrossRef]
- Yoon, Y.; Jeong, H.S.; Yun, H.; Lee, H.; Hwang, Y.S.; Park, B.; Lee, C.J.; Lee, S.; Hyeon, J.Y. Hepatitis E Virus (HEV) seroprevalence in the general population of the Republic of Korea in 2007-2009: A nationwide cross-sectional study. BMC Infect. Dis. 2014, 14, 517. [Google Scholar] [CrossRef] [PubMed]
- Choi, I.S.; Kwon, H.J.; Shin, N.R.; Yoo, H.S. Identification of swine hepatitis E virus (HEV) and prevalence of anti-HEV antibodies in swine and human populations in Korea. J. Clin. Microbiol. 2003, 41, 3602–3608. [Google Scholar] [CrossRef] [PubMed]
- Kim, S.E.; Kim, M.Y.; Kim, D.G.; Song, Y.J.; Jeong, H.J.; Lee, S.W.; Lee, J.B.; Park, S.Y.; Song, C.S.; Oh, S.J.; et al. Determination of fecal shedding rates and genotypes of swine hepatitis E virus (HEV) in Korea. J. Vet. Med. Sci. 2008, 70, 1367–1371. [Google Scholar] [CrossRef] [PubMed]
- Soroka, M.; Wasowicz, B.; Rymaszewska, A. Loop-Mediated Isothermal Amplification (LAMP): The Better Sibling of PCR? Cells 2021, 10, 1931. [Google Scholar] [CrossRef]
- Walker, F.M.; Hsieh, K. Advances in Directly Amplifying Nucleic Acids from Complex Samples. Biosensors 2019, 9, 117. [Google Scholar] [CrossRef]
- Mansuy, J.M.; Peron, J.M.; Abravanel, F.; Poirson, H.; Dubois, M.; Miedouge, M.; Vischi, F.; Alric, L.; Vinel, J.P.; Izopet, J. Hepatitis E in the south west of France in individuals who have never visited an endemic area. J. Med. Virol. 2004, 74, 419–424. [Google Scholar] [CrossRef]
- Adlhoch, C.; Wolf, A.; Meisel, H.; Kaiser, M.; Ellerbrok, H.; Pauli, G. High HEV presence in four different wild boar populations in East and West Germany. Vet. Microbiol. 2009, 139, 270–278. [Google Scholar] [CrossRef]
- Jothikumar, N.; Cromeans, T.L.; Robertson, B.H.; Meng, X.J.; Hill, V.R. A broadly reactive one-step real-time RT-PCR assay for rapid and sensitive detection of hepatitis E virus. J. Virol. Methods 2006, 131, 65–71. [Google Scholar] [CrossRef] [PubMed]
- Colson, P.; Coze, C.; Gallian, P.; Henry, M.; De Micco, P.; Tamalet, C. Transfusion-associated hepatitis E, France. Emerg. Infect. Dis. 2007, 13, 648–649. [Google Scholar] [CrossRef] [PubMed]
- Zhao, C.; Li, Z.; Yan, B.; Harrison, T.J.; Guo, X.; Zhang, F.; Yin, J.; Yan, Y.; Wang, Y. Comparison of real-time fluorescent RT-PCR and conventional RT-PCR for the detection of hepatitis E virus genotypes prevalent in China. J. Med. Virol. 2007, 79, 1966–1973. [Google Scholar] [CrossRef] [PubMed]
- Matsubayashi, K.; Kang, J.H.; Sakata, H.; Takahashi, K.; Shindo, M.; Kato, M.; Sato, S.; Kato, T.; Nishimori, H.; Tsuji, K.; et al. A case of transfusion-transmitted hepatitis E caused by blood from a donor infected with hepatitis E virus via zoonotic food-borne route. Transfusion 2008, 48, 1368–1375. [Google Scholar] [CrossRef]
- Rolfe, K.J.; Curran, M.D.; Mangrolia, N.; Gelson, W.; Alexander, G.J.; L’Estrange, M.; Vivek, R.; Tedder, R.; Ijaz, S. First case of genotype 4 human hepatitis E virus infection acquired in India. J. Clin. Virol. 2010, 48, 58–61. [Google Scholar] [CrossRef]
- KMFDS. Manual for Testing Methods of Hepatitisvirus E in Meat and Food-Grade Water; Ministry of Food and Drug Safety: Cheongju-si, Republic of Korea, 2012.
- Pas, S.D.; de Man, R.A.; Mulders, C.; Balk, A.H.; van Hal, P.T.; Weimar, W.; Koopmans, M.P.; Osterhaus, A.D.; van der Eijk, A.A. Hepatitis E virus infection among solid organ transplant recipients, the Netherlands. Emerg. Infect. Dis. 2012, 18, 869–872. [Google Scholar] [CrossRef]
- Martin-Latil, S.; Hennechart-Collette, C.; Guillier, L.; Perelle, S. Duplex RT-qPCR for the detection of hepatitis E virus in water, using a process control. Int. J. Food Microbiol. 2012, 157, 167–173. [Google Scholar] [CrossRef]
- Martin-Latil, S.; Hennechart-Collette, C.; Delannoy, S.; Guillier, L.; Fach, P.; Perelle, S. Quantification of Hepatitis E Virus in Naturally-Contaminated Pig Liver Products. Front. Microbiol. 2016, 7, 1183. [Google Scholar] [CrossRef] [PubMed]
- Aslan, A.T.; Balaban, H.Y. Hepatitis E virus: Epidemiology, diagnosis, clinical manifestations, and treatment. World J. Gastroenterol. 2020, 26, 5543–5560. [Google Scholar] [CrossRef]
- Orru, G.; Masia, G.; Orru, G.; Romano, L.; Piras, V.; Coppola, R.C. Detection and quantitation of hepatitis E virus in human faeces by real-time quantitative PCR. J. Virol. Methods 2004, 118, 77–82. [Google Scholar] [CrossRef]
- Inoue, J.; Takahashi, M.; Yazaki, Y.; Tsuda, F.; Okamoto, H. Development and validation of an improved RT-PCR assay with nested universal primers for detection of hepatitis E virus strains with significant sequence divergence. J. Virol. Methods 2006, 137, 325–333. [Google Scholar] [CrossRef]
- Garson, J.A.; Ferns, R.B.; Grant, P.R.; Ijaz, S.; Nastouli, E.; Szypulska, R.; Tedder, R.S. Minor groove binder modification of widely used TaqMan probe for hepatitis E virus reduces risk of false negative real-time PCR results. J. Virol. Methods 2012, 186, 157–160. [Google Scholar] [CrossRef]
- Bae, K.S.; Lee, S.; Lee, J.Y.; Kim, J.H.; Joo, Y.L.; Lee, S.H.; Chung, H.M.; You, K.A. Development of diagnostic systems for wide range and highly sensitive detection of two waterborne hepatitis viruses from groundwater using the conventional reverse transcription nested PCR assay. J. Virol. Methods 2022, 299, 114344. [Google Scholar] [CrossRef]
- NIER. Study on the Provided a Analytical System for the Monitoring of Pathogenic Microorganism from Drinking Water; National Institute of Environmental Research: Incheon, Republic of Korea, 2020.
- Frias, M.; Lopez-Lopez, P.; Zafra, I.; Caballero-Gomez, J.; Machuca, I.; Camacho, A.; Risalde, M.A.; Rivero-Juarez, A.; Rivero, A. Development and Clinical Validation of a Pangenotypic PCR-Based Assay for the Detection and Quantification of Hepatitis E Virus (Orthohepevirus A Genus). J. Clin. Microbiol. 2021, 59, e02075-20. [Google Scholar] [CrossRef] [PubMed]
- NIER. Development and Verification of Genetically Diagnostic Method for the Detection of Non-Regulated Viruses From Water Environment (I); National Institute of Environmental Research: Incheon, Republic of Korea, 2017.
- Lee, S.; Bae, K.S.; Lee, J.Y.; Joo, Y.L.; Kim, J.H.; You, K.A. Development of Molecular Diagnostic System with High Sensitivity for the Detection of Human Sapovirus from Water Environments. Biomed. Sci. Letters 2021, 27, 35–43. [Google Scholar] [CrossRef]
Figure 1.
Sensitivity results of three HEV SYBR Green-based method primer sets using artificially spiked samples (ASSs).
Figure 1.
Sensitivity results of three HEV SYBR Green-based method primer sets using artificially spiked samples (ASSs).
Figure 2.
Validation results of the HEV TaqMan probe-based real-time (rt) PCR assay by three analysts.
Figure 2.
Validation results of the HEV TaqMan probe-based real-time (rt) PCR assay by three analysts.
Table 1.
Comparative analysis of the specificity, sensitivity, and running time of HEV TaqMan probe-based real-time (rt) PCR assays *.
Table 1.
Comparative analysis of the specificity, sensitivity, and running time of HEV TaqMan probe-based real-time (rt) PCR assays *.
| Number of HEV-TP | Specificity | Plasmid-Based Sensitivity (2500 RFU) b | Artificial Spiking-Based Sensitivity (2500 RFU) c | Running Time (min) d | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Target | 22 Refs. a | 100 pg | 10 pg | 1 pg | 100 fg | 10 fg | 1 fg | 100 ag | 10 ag | 100 pg | 10 pg | 1 pg | 100 fg | 10 fg | 1 fg | 100 ag | 10 ag | ||
| 1 | 35.0 < | N/A | 37.10 | 39.37 | N/A | N/A | N/A | N/A | N/A | N/A | 34.94 | 37.31 | N/A | N/A | N/A | N/A | N/A | N/A | 110.0 |
| 2 | O | 33.84 | 30.73 | 36.56 | 40.14 | 41.12 | 43.89 | N/A | N/A | 29.20 | 30.91 | 32.36 | 34.84 | 35.61 | 38.54 | 43.34 | 42.93 | 85.0 | |
| 3 | O | 26.93 | 29.86 | 30.75 | 40.31 | N/A | N/A | N/A | N/A | N/A | 28.76 | 29.78 | 31.44 | 34.59 | 38.38 | 44.13 | N/A | 100.0 | |
| 4 e | O | 23.45 | 23.94 | 28.15 | 32.82 | 35.18 | 38.58 | N/A | N/A | 23.69 | 25.34 | 24.73 | 28.64 | 30.26 | 33.61 | 36.61 | 38.03 | 78.0 | |
| 5 | O | 16.32 | 28.22 | 32.76 | 36.45 | 38.97 | 43.36 | N/A | N/A | 23.66 | 20.15 | 25.70 | 31.10 | 33.96 | 36.67 | 40.00 | 43.57 | 114.0 | |
| 6 | O | 26.61 | 26.75 | 31.68 | 38.26 | 38.64 | 42.43 | 42.06 | N/A | 30.42 | 27.11 | 32.35 | 33.87 | 33.38 | 36.68 | 40.47 | N/A | 86.0 | |
| 7 | O | 25.48 | 28.26 | 33.53 | 39.42 | N/A | N/A | N/A | N/A | 24.27 | 26.83 | 28.36 | 30.96 | 33.94 | 37.99 | 40.91 | N/A | 95.0 | |
| 8 | N/A | N/A | N/A | N/A | N/A | N/A | N/A | N/A | N/A | N/A | N/A | N/A | N/A | N/A | N/A | N/A | N/A | 100.0 | |
| 9 | O | 26.48 | 30.64 | 35.47 | 41.14 | 42.48 | N/A | N/A | N/A | 29.47 | 27.81 | 29.19 | 32.78 | 35.18 | 38.83 | 43.16 | N/A | 100.0 | |
| 10 | 35.0< | 36.71 | N/A | N/A | N/A | N/A | N/A | N/A | N/A | N/A | N/A | N/A | N/A | N/A | N/A | N/A | N/A | 140.0 | |
| 11 | N/A | N/A | N/A | N/A | N/A | N/A | N/A | N/A | N/A | N/A | N/A | N/A | N/A | N/A | N/A | N/A | N/A | 76.0 | |
| 12 | O | 32.15 | 34.42 | N/A | N/A | N/A | N/A | N/A | N/A | 30.00 | 35.69 | 37.18 | 37.17 | N/A | N/A | N/A | N/A | 76.0 | |
* All results are expressed as mean Cq values derived from two replicates.; RFU, relative fluorescence unit; O, specific reaction; N/A, not applicable; bold, Cq values < 35.0. a Refs., nucleic acid of reference viruses; Refs-#1, enteric adenovirus (eAdV) 40 (eAdV-40) DNA (1 pg/μL); Refs-#2, eAdV-41 DNA (100 copies); Refs-#3, Aichivirus A1 (AiV-A1) plasmid [NC_001918, VP3-VP1 (2740–3918), 2AB (4400–5199) and 3CD (6038–8011)] (each, 1 pg/μL); Refs-#4, Astrovirus (AstV) plasmid [JN887820, ORF 1b-2 (3800–6685)] (1 pg/μL); Refs-#5, Coxsackievirus (CoxV) A6 (CoxV-A6) cDNA (100 copies); Refs-#6, CoxV-A24 cDNA (1 pg/μL); Refs-#7, CoxV-B1 cDNA (100 copies); Refs-#8, CoxV-B5 cDNA (100 copies); Refs-#9, Echovirus (EchoV) 5 (EcoV-5) cDNA (100 copies); Refs-#10, EcoV-11 cDNA (1 pg/μL); Refs-#11, EcoV-22 cDNA (1 pg/μL); Refs-#12, Enterovirus (EV) 68 (EV-68) cDNA (100 copies); Refs-#13, EV-71 cDNA (100 copies); Refs-#14, Hepatitisvirus A (HAV) cDNA (1 pg/μL); Refs-#15, Norovirus (NoV) GI (NoV-GI) plasmid [JQ388274, ORF1/VP1 (5283–5673)] (1 pg/μL); Refs-#16, NoV-GII cDNA (100 copies); Refs-#17, Orthoreovirus (OrV) plasmid [NC_013231.1, segment S (146–975)] (1 pg/μL); Refs-#18, Parechovirus (PeV-A) plasmid [NC_001897.1, 5′UTR/VP3-VP1-2A (411–613, 2078–3110)] (1 pg/μL); Refs-#19, Poliovirus type 3 (PV-type3) plasmid [AY184221.1, 5′UTR/VP2/VP1/3C (159–646, 1403–1611, 2503–2567, 3252–3376, 5559–5644)] (1 pg/μL); Refs-#20, Reovirus (ReV) cDNA (1 pg/μL); Refs-#21, Rotavirus (RV-A) cDNA (100 copies); Refs-#22, Sapovirus GI (SaV-GI) plasmid [KP298674.1, NS7-VP1 (4440–6439)] (1 pg/μL). b Cq value; 10-fold serially diluted template from 1 ng/μL. c The artificial spiking-based sensitivity test was conducted by randomly selecting 10 HEV-negative groundwater samples, combining them, and utilizing this mixture as a diluent for a 10-fold dilution of the HEV template (1 ng/μL). d The reaction times were based on the use of the CFX Connect Real-Time PCR (Bio-Rad, USA). e Final selected primer sets.
Table 2.
Comparison of the sensitivities of primer sets using the SYBR Green-based method for the HEV real-time (rt) PCR assay.
Table 2.
Comparison of the sensitivities of primer sets using the SYBR Green-based method for the HEV real-time (rt) PCR assay.
| HEV-SYBR Set # | Plasmid-Based Sensitivity (2500 RFU, Cq Value) | Running Time with Melting Curve Analysis (min) | |||||||
|---|---|---|---|---|---|---|---|---|---|
| 100 pg | 10 pg | 1 pg | 100 fg | 10 fg | 1 fg | 100 ag | 10 ag | ||
| 4 | 26.51 | 25.33 | 31.54 | 36.09 | 37.30 | N/A | N/A | N/A | Less than 110 |
| 5 | 26.37 | 28.49 | 34.85 | 38.16 | 40.33 | 42.17 | 40.58 | 41.54 | |
| 6 * | 21.61 | 24.20 | 29.50 | 33.81 | 36.04 | 39.58 | N/A | N/A | |
| 7 | 24.61 | 24.23 | 30.82 | 36.15 | 36.40 | 39.44 | 43.06 | N/A | |
| 13 | 24.60 | 24.13 | 30.26 | 35.18 | 36.25 | N/A | N/A | 38.69 | |
| 15 * | 25.53 | 24.56 | 30.53 | 35.00 | 39.59 | 44.15 | N/A | N/A | |
| 20 | 27.05 | 25.78 | 31.79 | 36.28 | 38.75 | 40.90 | N/A | N/A | |
| 21 * | 25.00 | 24.77 | 30.50 | 34.87 | 35.77 | 41.77 | 37.53 | 36.95 | |
| 22 | N/A | N/A | N/A | N/A | N/A | N/A | N/A | N/A | |
| 23 | 27.34 | 25.56 | 31.02 | 36.92 | 36.06 | 38.54 | 41.60 | N/A | |
* Candidate PCR primer set.; RFU, relative fluorescence unit; N/A, not applicable; bold, Cq values < 35.0; under var, Cq = 35.0.
Table 3.
Validation results of HEV SYBR Green-based primer sets #15 and #21 by three analysts.
| HEV-SYBR_Set # | Division | Artificial Spiking-Based Sensitivity (2500 RFU, Cq Value) | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| 100 pg | 10 pg | 1 pg | 100 fg | 10 fg | 1 fg | 100 ag | 10 ag | Neg | |||
| #15 | Developer | 18.42 | 21.19 | 24.40 | 27.93 | 31.31 | 34.59 | 37.92 | 44.43 | 42.44 | |
| Repeat (1) | Analyst 1 | 21.00 | 21.55 | 24.66 | 28.04 | 30.70 | 34.65 | 38.04 | 40.43 | 42.72 | |
| Analyst 2 | 25.55 | 24.87 | 26.37 | 28.97 | 31.36 | 34.63 | 38.93 | 39.87 | N/A | ||
| Analyst 3 | 22.42 | 25.19 | 28.23 | 29.79 | 31.88 | 34.89 | 39.53 | 41.83 | N/A | ||
| Repeat (2) | Analyst 1 | 21.76 | 22.35 | 25.42 | 28.85 | 32.68 | 35.78 | 40.60 | 43.76 | N/A | |
| Analyst 2 | 22.87 | 22.69 | 25.59 | 29.00 | 32.15 | 36.12 | 40.39 | 44.16 | N/A | ||
| Analyst 3 | 22.46 | 22.08 | 25.46 | 28.54 | 32.32 | 36.29 | 39.90 | 38.91 | 38.87 | ||
| Minimum | 18.42 | 21.19 | 24.40 | 27.93 | 30.70 | 34.59 | 37.92 | 38.91 | 38.87 | ||
| Maximum | 25.55 | 25.19 | 28.23 | 29.79 | 32.68 | 36.29 | 40.60 | 44.43 | 44.47 | ||
| Average (7 Cq values) | 22.07 | 22.85 | 25.73 | 28.73 | 31.77 | 35.28 | 39.33 | 41.91 | (N/A) | ||
| Average (5 Cq values) * | 21.37 | 22.38 | 25.23 | 28.52 | 31.59 | 35.08 | 39.08 | 41.41 | (N/A) | ||
| #21 | Developer | 19.34 | 21.14 | 24.48 | 27.40 | 30.65 | 33.57 | 37.39 | N/A | 37.88 | |
| Repeat (1) | Analyst 1 | 20.94 | 21.15 | 24.75 | 27.81 | 30.50 | 34.24 | 37.55 | 38.09 | N/A | |
| Analyst 2 | 22.46 | 22.48 | 25.38 | 28.11 | 30.81 | 35.03 | 37.53 | 40.21 | N/A | ||
| Analyst 3 | 23.03 | 25.22 | 27.19 | 29.16 | 31.52 | 34.37 | 37.31 | 38.71 | 44.47 | ||
| Repeat (2) | Analyst 1 | 22.06 | 23.48 | 26.66 | 28.99 | 32.59 | 35.66 | 38.49 | 37.04 | N/A | |
| Analyst 2 | 25.07 | 23.54 | 26.04 | 28.57 | 32.45 | 36.99 | N/A | 39.53 | N/A | ||
| Analyst 3 | 35.69 | 25.76 | 26.96 | 28.97 | 32.37 | 35.91 | 39.98 | 40.42 | 41.96 | ||
| Minimum | 19.34 | 21.14 | 24.48 | 27.40 | 30.50 | 33.57 | 37.31 | 37.04 | 37.88 | ||
| Maximum | 35.69 | 25.76 | 27.19 | 29.16 | 32.59 | 36.99 | 39.98 | 40.42 | 44.47 | ||
| Average (7 Cq values) | 24.08 | 23.25 | 25.92 | 28.43 | 31.56 | 35.11 | 38.04 | 39.00 | N/A | ||
| Average (5 Cq values) * | 21.76 | 22.75 | 25.67 | 28.28 | 31.35 | 34.73 | 37.56 | 38.65 | N/A | ||
* The maximum and minimum values for each concentration were excluded.; RFU, relative fluorescence unit; N/A, not applicable; bold, Cq values < 35.0.
Table 4.
Information on TaqMan probe-based real-time (rt) PCR method for detecting hepatitis E virus.
Table 4.
Information on TaqMan probe-based real-time (rt) PCR method for detecting hepatitis E virus.
| # | Primer (TaqMan Probe) | Location | Product Size (nt) | PCR Conditions b | Reference c | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Type | Name | Sequence (5′→3′) | Length (bp) | Start a | End a | 1st DN | DN | AN | EX | Cycle | |||
| 1 | F | Sense primer | GACAGAATTRATTTCGTCGGCTGG | 24 | 6336 | 6359 | 73 | 95 °C, 10 min | 95 °C, 15 s | 60 °C, 60 s | 50 | [32,33] | |
| R | HEV_R | CCYTTRTCYTGCTGNGCRTTCTC | 23 | 6386 | 6408 | ||||||||
| Probe | Probe | FAM-GTYGTCTCRGCCAATGGCGAGC-BHQ1 | 22 | 6385 | 6406 | ||||||||
| 2 | F | JVHEV-F | GGTGGTTTCTGGGGTGAC | 18 | 5299 | 5316 | 70 | 95 °C, 15 min | 95 °C, 10 s | 55 °C, 20 s | 72 °C, 15 s | 45 | [34] |
| R | JVHEV-R | AGGGGTTGGTTGGATGAA | 18 | 5351 | 5368 | ||||||||
| Probe | JVHEV-P | FAM-TGATTCTCAGCCCTTCGC-BHQ1 | 18 | 5322 | 5339 | ||||||||
| 3 | F | HevMrsFwd | AATTRATTTCGTCGGCYGG | 19 | 6341 | 6359 | 73 | 95 °C, 10 min | 95 °C, 15 s | 60 °C, 60 s | 45 | [35] | |
| R | HevMrsRev | ACWGTCGGCTCGCCATTG | 18 | 6396 | 6413 | ||||||||
| Probe | HevMrsFam | FAM-ACTCYCGCCCSGTYGTCTCA-BHQ1 | 20 | 6374 | 6393 | ||||||||
| 4 | F | Forward | CGGTGGTTTCTGGGGTGA | 18 | 5298 | 5315 | 75 | 95 °C, 3 min d | 95 °C, 10 s | 55 °C, 40 s | 40 | [36] | |
| R | Reverse | GCGAAGGGGTTGGTTGGA | 18 | 5355 | 5372 | ||||||||
| Probe | Probe | FAM-TGATTCTCAGCCCTTCGC-BHQ1 | 18 | 5322 | 5339 | ||||||||
| 5 | F | forward primer | CGGCGGTGGTTTCTGG | 16 | 5295 | 5310 | 75 | 95 °C, 15 min | 94 °C, 15 s | 60 °C, 60 s | 50 | [37] | |
| R | reverse primer | AAGGGGTTGGTTGGATGAATA | 21 | 5349 | 5369 | ||||||||
| Probe | probe | FAM-TGACAGGGTTGATTCTCAGCCCTTCG-BHQ1 | 26 | 5313 | 5338 | ||||||||
| 6 | F | HEV_F | CGACAGAATTGATTTCGTCGGC | 22 | 6335 | 6356 | 121 | 95 °C, 15 min | 95 °C, 15 s | 60 °C, 35 s | 45 | [33] | |
| R | HEV_R | CCYTTRTCYTGCTGNGCRTTCTC | 23 | 6433 | 6455 | ||||||||
| Probe | HEV_TM | FAM-TYGGCTCGCCATTGGCYGAGAC-BHQ1 | 22 | 6386 | 6407 | ||||||||
| 7 | F | HEV-F | CCGACAGAATTRATTTCGTCGGC | 23 | 6344 | 6366 | 115 | 95 °C, 2 min | 95 °C, 15 s | 60 °C, 60 s | 45 | [38] | |
| R | HEV-R | ATACCCTTRTCYTGCTGIGCRTTCTC | 26 | 6433 | 6458 | ||||||||
| Probe | HEV-P | FAM-GTCTCAGCCAATGGCGAG-BHQ1 | 18 | 6388 | 6405 | ||||||||
| 8 | F | Forward | GGTGGTTTCTGGGGTGAC | 18 | 5299 | 5316 | 73 | 95 °C, 10 min | 95 °C, 15 s | 60 °C, 60 s | 45 | [39] | |
| R | Reverse | CGAAGGGGTTGGTTGGATG | 19 | 5353 | 5371 | ||||||||
| Probe | Probe | FAM-ATTCTCAGCCCTTCGCAATCCCCT-BHQ1 | 24 | 5324 | 5347 | ||||||||
| 9 | F | HEV25 | CGGTGGTTTCTGGGGTGA | 18 | 5298 | 5315 | 75 | 95 °C, 10 min | 95 °C, 15 s | 60 °C, 60 s | 45 | [40] | |
| R | HEV26 | GCRAAGGGRTTGGTTGG | 17 | 5356 | 5372 | ||||||||
| Probe | HEV-MGB | FAM-ATTCTCAGCCCTTCGC-BHQ1 | 16 | 5324 | 5339 | ||||||||
| 10 | F | HEV-5260-F | CGGTGGTTTCTGGGGTGAC | 19 | 5298 | 5316 | 71 | 95 °C, 5 min | 95 °C, 15 s | 60 °C, 60 s | 65 °C, 60 s | 45 | [41] |
| R | HEV-5330-R | AGGGGTTGGTTGGATGAATATAG | 23 | 5346 | 5368 | ||||||||
| Probe | HEV-5280-T | FAM-GGGTTGATTCTCAGCCCTTCGC-BHQ1 | 22 | 5318 | 5339 | ||||||||
| 11 | F | HEV-5260-F | CGGTGGTTTCTGGGGTGAC | 19 | 5298 | 5316 | 71 | 95 °C, 5 min | 95 °C, 15 s | 60 °C, 35 s | 45 | [42,43] | |
| R | HEV-5330-R | AGGGGTTGGTTGGATGAATATAG | 23 | 5346 | 5368 | ||||||||
| Probe | E-Probe(M) | FAM-GGTTGATTCTCAGCCCTTCGC-BHQ1 | 21 | 5319 | 5339 | ||||||||
| 12 | F | HEV-5260-F | GGTGGTTTCTGGGGTGAC | 18 | 5299 | 5315 | 70 | 95 °C, 5 min | 95 °C, 15 s | 55 °C, 35 s | 45 | [42,43] | |
| R | JVHEV-R(M) | AAGGGGTTGGTTGGATGAATA | 21 | 5349 | 5368 | ||||||||
| Probe | JVHEV-P(M) | FAM-TTGATTCTCAGCCCTTCGC-BHQ1 | 19 | 5321 | 5348 | ||||||||
a Location was calculated based on FJ763142.1 (NCBI accession number); b 1st DN, first denaturation; DN, denaturation; AN, annealing; EX, extension; c KMFDS, Korea Ministry of Food and Drug Safety; MSS, Ministry of SMEs and Startups (Korea); d five cycles (95 °C for 10 s, 50 °C for 20 s, and 72 °C for 30 s) were conducted before starting the main reaction.
Table 5.
Primer information on SYBR Green-based real-time (rt) PCR method for detecting hepatitis E virus.
Table 5.
Primer information on SYBR Green-based real-time (rt) PCR method for detecting hepatitis E virus.
| # | Type | Name | Sequence (5′→3′) | Length (nt) | Location * | # | |
|---|---|---|---|---|---|---|---|
| Start | End | ||||||
| 1 | Forward | HEV-05_08Matsubayashi_F | CGGCGGTGGTTTCTGG | 16 | 5295 | 1 | [37] |
| 2 | Forward | HEV-13_04Orrù_F | GCGGTGGTTTCTGGGG | 16 | 5297 | 2 | [44] |
| 3 | Forward | HE361 | GCRGTGGTTTCTGGGGTGAC | 20 | 5297 | 3 | [45] |
| 4 | Forward | HEV-5260-F | CGGTGGTTTCTGGGGTGAC | 19 | 5298 | 4 | [45] |
| 5 | Forward | HEV-02_06Jothikumar_F | GGTGGTTTCTGGGGTGAC | 18 | 5299 | 5 | [34] |
| 6 | Forward | JVHEV-F(M) | GGTGGTTTCTGGGGTGA | 17 | 5299 | 6 | [46] |
| 7 | Forward | HE366 | GYTGATTCTCAGCCCTTCGC | 20 | 5320 | 7 | [46] |
| 8 | Forward | HEV_SLNL-F | TCCCCYATATTCATCCAACCAA | 22 | 5342 | 8 | [47] |
| 9 | Forward | HEV-F1 | TCCCCTATATTCATCCAACCAA | 22 | 5342 | 9 | [48] |
| 10 | Forward | HEV_SLNL-NF | GAYCARKCCCAGCGCCCCG | 19 | 5449 | 10 | [47] |
| 11 | Forward | HEV-F2 | GAYCARKCCCAGCGCCCC | 18 | 5449 | 11 | [48] |
| 12 | Forward | F-3156N | AATTATGCCCAGTACCGGGTTG | 22 | 5725 | 12 | [39] |
| 13 | Forward | HE044 | CAAGGHTGGCGYTCKGTTGAGAC | 23 | 5950 | 13 | [45] |
| 14 | Forward | HE110-2 | GYTCKGTTGAGACCWCBGGBGT | 22 | 5960 | 14 | [49] |
| 15 | Forward | F-3158N | GTTATGCTTTGCATACATGGCT | 22 | 6010 | 15 | [49] |
| 16 | Forward | ORF2 BOVF2 | CYGTYGTSTCRGCCAATGG | 19 | 6321 | 16 | [47] |
| 17 | Forward | ORF2 BOVF1 | GGBCTNCCGACAGAATTRAT | 20 | 6328 | 17 | [47] |
| 18 | Forward | HEV-06_09Adlhoch_F | CGACAGAATTGATTTCGTCGGC | 22 | 6335 | 18 | [33] |
| 19 | Forward | HEV-03_07Colson_F | AATTRATTTCGTCGGCYGG | 19 | 6341 | 19 | [35] |
| 20 | Reverse | HE041 | TTMACWGTCRGCTCGCCATTGGC | 23 | 6394 | 20 | [13] |
| 21 | Reverse | HEV-03_07Colson_R | ACWGTCGGCTCGCCATTG | 18 | 6396 | 21 | [35] |
| 22 | Reverse | HEV-09_12Pas_R | GCRAAGGGRTTGGTTGG | 17 | 6393 | 22 | [40] |
| 23 | Reverse | HEV-R_NL | RGCCGACGAAATYAATTCTGTC | 23 | 6335 | 23 | [47] |
| 24 | Reverse | HEV-R (=R-3159N) | RGCCGACGAAATYAATTCTGTC | 22 | 6336 | 24 | [47] |
| 25 | Reverse | HE364 | CTGGGMYTGGTCDCGCCAAG | 20 | 5441 | 25 | [45] |
| 26 | Reverse | HE363 | GMYTGGTCDCGCCAAGHGGA | 20 | 5437 | 26 | [45] |
| 27 | Reverse | HEV-08_12KMFDS_R | CGAAGGGGTTGGTTGGATG | 19 | 5353 | 27 | [39] |
| 28 | Reverse | HEV-02_06Jothikumar_R | AGGGGTTGGTTGGATGAA | 18 | 5351 | 28 | [34] |
| 29 | Reverse | HEV-5330-R | AGGGGTTGGTTGGATGAATATAG | 23 | 5346 | 29 | [42] |
| 30 | Reverse | JVHEV-R(M) | AGGGGTTGGTTGGATGAATA | 20 | 5349 | 30 | [42] |
* Location was calculated based on FJ763142.1 (NCBI accession number).
Table 6.
Information on hepatitis E virus and 22 reference viruses as positive control or for testing the analytical specificity.
Table 6.
Information on hepatitis E virus and 22 reference viruses as positive control or for testing the analytical specificity.
| # | Division and # | Virus | Genotype | Acronym | Group * | Gene | NCBI Accession # * | Length (nt) * | Conc. |
|---|---|---|---|---|---|---|---|---|---|
| 1 | Target | Hepatitisvirus | E | HEV | Plasmid | ORF2 | FJ763142.1 | 1168 | 1 ng/μL based dilutes |
| 2 | Refs. #01 | Enteric Adenovirus | 40 | eAdV-40 | DNA | - | - | - | 1 pg/μL |
| 3 | Refs. #02 | Enteric Adenovirus | 41 | eAdV-41 | DNA | - | - | - | 1 pg/μL |
| 4 | Refs. #03 | Aichivirus | A1 | AiV-A1 | Plasmid | VP3-VP1/2AB/3CD | NC_001918.1 | 3953 | 1 pg/μL |
| 5 | Refs. #04 | Astrovirus | - | AstV | Plasmid | ORF1b-2 | JN887820.1 | 2886 | 1 pg/μL |
| 6 | Refs. #05 | Coxsackievirus | A6 | CoxV-A6 | cDNA | - | - | - | 100 copies |
| 7 | Refs. #06 | Coxsackievirus | A24 | CoxV-A24 | cDNA | - | - | - | 1 pg/μL |
| 8 | Refs. #07 | Coxsackievirus | B1 | CoxV-B1 | cDNA | - | - | - | 100 copies |
| 9 | Refs. #08 | Coxsackievirus | B5 | CoxV-B5 | cDNA | - | - | - | 100 copies |
| 10 | Refs. #09 | Echovirus | 5 | EcoV-5 | cDNA | - | - | - | 100 copies |
| 11 | Refs. #10 | Echovirus | 11 | EcoV-11 | cDNA | - | - | - | 1 pg/μL |
| 12 | Refs. #11 | Echovirus | 22 | EcoV-22 | cDNA | - | - | - | 1 pg/μL |
| 13 | Refs. #12 | Enterovirus | 68 | EV-68 | cDNA | - | - | - | 100 copies |
| 14 | Refs. #13 | Enterovirus | 71 | EV-71 | cDNA | - | - | - | 100 copies |
| 15 | Refs. #14 | Hepatitisvirus | A | HAV | cDNA | - | - | - | 1 pg/μL |
| 16 | Refs. #15 | Norovirus | GI | NoV-GI | Plasmid | ORF1/VP1 | JQ388274.1 | 391 | 1 pg/μL |
| 17 | Refs. #16 | Norovirus | GII | NoV-GII | cDNA | - | - | - | 100 copies |
| 18 | Refs. #17 | Orthoreovirus | - | OrV | Plasmid | Segment S | NC_013231.1 | 830 | 1 pg/μL |
| 19 | Refs. #18 | Parechovirus | A | PeV-A | Plasmid | 5′UTR/VP3-VP1-2A | NC_001897.1 | 1237 | 1 pg/μL |
| 20 | Refs. #19 | Poliovirus | Type3 | PV-type3 | Plasmid | 5′UTR/VP2/VP1/3C | AY184221.1 | 983 | 1 pg/μL |
| 21 | Refs. #20 | Reovirus | - | ReV | cDNA | - | - | - | 1 pg/μL |
| 22 | Refs. #21 | Rotavirus | A | RV-A | cDNA | - | - | - | 100 copies |
| 23 | Refs. #22 | Sapovirus | GI.1 | SaV-GI | Plasmid | NS7-VP1 | KP298674.1 | 2000 | 1 pg/μL |
* Information on synthesized gene location: HEV (ORF2 gene, NCBI accession number FJ763142.1, 5293–6460), AiV-A1 [VP3-VP1 (NC_001918.1, 2740–3918)/2AB (4400–5199)/3CD (6038–8011)], AstV (ORF1b-2, JN887820.1, 3800–6685), NoV-GI (ORF1/VP1, JQ388274.1, 5283–5673), OrV (Segment S, NC_013231.1, 146–975), PeV-A [5′UTR (NC_001897.1, 411–613)/VP3-VP1-2A (2078–3110), PV-type3 [5′UTR (AY184221.1, 159–646)/VP2 (1403–1611)/VP1 (2503–2567 and 3252–3376)/3C (5559–5644)], SaV-GI (NS7-VP1, KP298674.1, 4440–6439).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
MDPI and ACS Style
Kim, J.-H.; Lee, S.; Park, E.-R. Real-Time PCR-Based Detection of Hepatitis E Virus in Groundwater: Primer Performance and Method Validation. Int. J. Mol. Sci. 2025, 26, 7377. https://doi.org/10.3390/ijms26157377
AMA Style
Kim J-H, Lee S, Park E-R. Real-Time PCR-Based Detection of Hepatitis E Virus in Groundwater: Primer Performance and Method Validation. International Journal of Molecular Sciences. 2025; 26(15):7377. https://doi.org/10.3390/ijms26157377
Chicago/Turabian StyleKim, Jin-Ho, Siwon Lee, and Eung-Roh Park. 2025. "Real-Time PCR-Based Detection of Hepatitis E Virus in Groundwater: Primer Performance and Method Validation" International Journal of Molecular Sciences 26, no. 15: 7377. https://doi.org/10.3390/ijms26157377
APA StyleKim, J.-H., Lee, S., & Park, E.-R. (2025). Real-Time PCR-Based Detection of Hepatitis E Virus in Groundwater: Primer Performance and Method Validation. International Journal of Molecular Sciences, 26(15), 7377. https://doi.org/10.3390/ijms26157377
Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.
