Effective Targeting of Glutamine Synthetase with Amino Acid Analogs as a Novel Therapeutic Approach in Breast Cancer
Abstract
1. Introduction
2. Results
2.1. Selective Regulation of Breast Cancer Cell Proliferation by Acivicin and Azaserine Treatment
2.2. Acivicin and Azaserine Exhibit Significant Apoptotic Effects with Less Overall Cytotoxicity in MCF-7 Cells
2.3. Acivicin and Azaserine Treatment Stimulates PCD via Restoring PTEN and P53 Gene Expression in Treated MCF-7 Cells
2.4. Acivicin and Azaserine Treatment Positively Regulate the Production of Anti-Inflammatory Cytokines in MCF-7 Cells
2.5. Acivicin and Azaserine-Regulated GS as a New Insights Mechanism of Their Anticancer Properties
2.6. Acivicin and Azaserine Show High Docking Scores and Strong Binding Affinity for GS
3. Discussion
4. Material and Methods
4.1. Cell Lines
4.2. Preparation of Drugs
4.3. Proliferation Assay Cytotoxicity
4.4. Annexin-V Assay
4.5. Cell Staining and Fluorescent Assay
4.6. Glutamine Assay
4.7. Quantitative RT-PCR Procedure
4.8. Western Blot
4.9. Enzyme-Linked Immunosorbent Assay (ELISA)
4.10. Molecular Docking Study
4.11. Data Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Feng, Y.; Spezia, M.; Huang, S.; Yuan, C.; Zeng, Z.; Zhang, L.; Ji, X.; Liu, W.; Huang, B.; Luo, W.; et al. Breast Cancer Development and Progression: Risk Factors, Cancer Stem Cells, Signaling Pathways, Genomics, and Molecular Pathogenesis. Genes Dis. 2018, 5, 77–106. [Google Scholar] [CrossRef] [PubMed]
- Castaneda, M.; den Hollander, P.; Kuburich, N.A.; Rosen, J.M.; Mani, S.A. Mechanisms of Cancer Metastasis. Semin. Cancer Biol. 2022, 87, 17–31. [Google Scholar] [CrossRef] [PubMed]
- Merckens, A.; Sieler, M.; Keil, S.; Dittmar, T. Altered Phenotypes of Breast Epithelial × Breast Cancer Hybrids after ZEB1 Knock-Out. Int. J. Mol. Sci. 2023, 24, 17310. [Google Scholar] [CrossRef] [PubMed]
- Tai, Y.C.; Domchek, S.; Parmigiani, G.; Chen, S. Breast Cancer Risk Among Male BRCA1 and BRCA2 Mutation Carriers. JNCI J. Natl. Cancer Inst. 2007, 99, 1811–1814. [Google Scholar] [CrossRef] [PubMed]
- Antoniou, A.; Pharoah, P.D.P.; Narod, S.; Risch, H.A.; Eyfjord, J.E.; Hopper, J.L.; Loman, N.; Olsson, H.; Johannsson, O.; Borg, Å.; et al. Average Risks of Breast and Ovarian Cancer Associated with BRCA1 or BRCA2 Mutations Detected in Case Series Unselected for Family History: A Combined Analysis of 22 Studies. Am. J. Hum. Genet. 2003, 72, 1117–1130. [Google Scholar] [CrossRef]
- Anand, P.; Kunnumakara, A.B.; Sundaram, C.; Harikumar, K.B.; Tharakan, S.T.; Lai, O.S.; Sung, B.; Aggarwal, B.B. Cancer Is a Preventable Disease That Requires Major Lifestyle Changes. Pharm. Res. 2008, 25, 2097–2116. [Google Scholar] [CrossRef]
- Abbruzzese, J.L.; Abbruzzese, M.C.; Lenzi, R.; Hess, K.R.; Raber, M.N. Analysis of a Diagnostic Strategy for Patients with Suspected Tumors of Unknown Origin. J. Clin. Oncol. 2024, 13, 2094–2103. [Google Scholar] [CrossRef]
- Cruzat, V.; Rogero, M.M.; Keane, K.N.; Curi, R.; Newsholme, P. Glutamine: Metabolism and Immune Function, Supplementation and Clinical Translation. Nutrients 2018, 10, 1564. [Google Scholar] [CrossRef]
- Watford, M. Glutamine and Glutamate Metabolism across the Liver Sinusoid. J. Nutr. 2000, 130, 983S–987S. [Google Scholar] [CrossRef]
- Janicki, R.H.; Goldstein, L. Glutamine Synthetase and Renal Ammonia Metabolism. Am. J. Physiol. 1969, 216, 1107–1110. [Google Scholar] [CrossRef]
- Smith, R.J.; Larson, S.; Stred, S.E.; Durschlag, R.P. Regulation of Glutamine Synthetase and Glutaminase Activities in Cultured Skeletal Muscle Cells. J. Cell. Physiol. 1984, 120, 197–203. [Google Scholar] [CrossRef] [PubMed]
- Suárez, I.; Bodega, G.; Fernández, B. Glutamine Synthetase in Brain: Effect of Ammonia. Neurochem. Int. 2002, 41, 123–142. [Google Scholar] [CrossRef] [PubMed]
- Otrubova, K.; Lushington, G.; Vander Velde, D.; McGuire, K.L.; McAlpine, S.R. Comprehensive Study of Sansalvamide A Derivatives and Their Structure–Activity Relationships against Drug-Resistant Colon Cancer Cell Lines. J. Med. Chem. 2008, 51, 530–544. [Google Scholar] [CrossRef] [PubMed]
- Bai, D.; Yu, S.; Zhong, S.; Zhao, B.; Qiu, S.; Chen, J.; Lunagariya, J.; Liao, X.; Xu, S. d-Amino Acid Position Influences the Anticancer Activity of Galaxamide Analogs: An Apoptotic Mechanism Study. Int. J. Mol. Sci. 2017, 18, 544. [Google Scholar] [CrossRef] [PubMed]
- Mohamed, E.-S.A.; Bassiouny, K.; Alshambky, A.A.; Khalil, H. Anticancer Properties of N,N-Dibenzylasparagine as an Asparagine (Asp) Analog, Using Colon Cancer Caco-2 Cell Line. Asian Pac. J. Cancer Prev. 2022, 23, 2531–2540. [Google Scholar] [CrossRef]
- Welch, M.; Phillips, R.S. Enzymatic Syntheses of 6-(4H-Selenolo[3,2-b]Pyrrolyl)-L-Alanine, 4-(6H-Selenolo[2,3-b]Pyrrolyl)-L-Alanine, and 6-(4H-Furo[3,2-b]Pyrrolyl)-L-Alanine. Bioorg. Med. Chem. Lett. 1999, 9, 637–640. [Google Scholar] [CrossRef]
- Moroder, L. Isosteric Replacement of Sulfur with Other Chalcogens in Peptides and Proteins. J. Pept. Sci. 2005, 11, 187–214. [Google Scholar] [CrossRef]
- Cluntun, A.A.; Lukey, M.J.; Cerione, R.A.; Locasale, J.W. Glutamine Metabolism in Cancer: Understanding the Heterogeneity. Trends Cancer 2017, 3, 169–180. [Google Scholar] [CrossRef]
- Comşa, Ş.; Cîmpean, A.M.; Raica, M. The Story of MCF-7 Breast Cancer Cell Line: 40 Years of Experience in Research. Anticancer Res. 2015, 35, 3147–3154. [Google Scholar]
- Ma, C.; Wang, Y.; Dong, L.; Li, M.; Cai, W. Anti-Inflammatory Effect of Resveratrol through the Suppression of NF-ΚB and JAK/STAT Signaling Pathways. Acta Biochim. Biophys. Sin. 2015, 47, 207–213. [Google Scholar] [CrossRef]
- Hu, A.; Sun, L.; Lin, H.; Liao, Y.; Yang, H.; Mao, Y. Harnessing Innate Immune Pathways for Therapeutic Advancement in Cancer. Signal Transduct. Target. Ther. 2024, 9, 68. [Google Scholar] [CrossRef] [PubMed]
- Quail, D.F.; Joyce, J.A. Microenvironmental Regulation of Tumor Progression and Metastasis. Nat. Med. 2013, 19, 1423–1437. [Google Scholar] [CrossRef] [PubMed]
- Yıldız, H.; Doğan, S. Possible Inhibition Effects of Resveratrol on Pancreatic Tumorigenesis in the Azaserine-Rat Model. APMIS 2024, 133, e13498. [Google Scholar] [CrossRef] [PubMed]
- Van Cura, D.; Ng, T.L.; Huang, J.; Hager, H.; Hartwig, J.F.; Keasling, J.D.; Balskus, E.P. Discovery of the Azaserine Biosynthetic Pathway Uncovers a Biological Route for α-Diazoester Production. Angew. Chem. Int. Ed. 2023, 62, e202304646. [Google Scholar] [CrossRef]
- Zhang, X.; Li, B.; de Jonge, N.; Björkholm, M.; Xu, D. The DNA Methylation Inhibitor Induces Telomere Dysfunction and Apoptosis of Leukemia Cells That Is Attenuated by Telomerase Over-Expression. Oncotarget 2015, 6, 4888. [Google Scholar] [CrossRef]
- Kreuzer, J.; Bach, N.C.; Forler, D.; Sieber, S.A. Target Discovery of Acivicin in Cancer Cells Elucidates Its Mechanism of Growth Inhibition. Chem. Sci. 2015, 6, 237–245. [Google Scholar] [CrossRef]
- Castegna, A.; Menga, A. Glutamine Synthetase: Localization Dictates Outcome. Genes 2018, 9, 108. [Google Scholar] [CrossRef]
- Kim, G.W.; Lee, D.H.; Jeon, Y.H.; Yoo, J.; Kim, S.Y.; Lee, S.W.; Cho, H.Y.; Kwon, S.H. Glutamine Synthetase as a Therapeutic Target for Cancer Treatment. Int. J. Mol. Sci. 2021, 22, 1701. [Google Scholar] [CrossRef]
- Yang, L.; Venneti, S.; Nagrath, D. Glutaminolysis: A Hallmark of Cancer Metabolism. Annu. Rev. Biomed. Eng. 2017, 19, 163–194. [Google Scholar] [CrossRef]
- Jin, L.; Alesi, G.N.; Kang, S. Glutaminolysis as a Target for Cancer Therapy. Oncogene 2016, 35, 3619–3625. [Google Scholar] [CrossRef]
- Khalil, H.; El Malah, T.; El Maksoud, A.I.A.; El Halfawy, I.; El Rashedy, A.A.; El Hefnawy, M. Identification of Novel and Efficacious Chemical Compounds That Disturb Influenza A Virus Entry in Vitro. Front. Cell. Infect. Microbiol. 2017, 7, 304. [Google Scholar] [CrossRef] [PubMed]
- Fekry, T.; Salem, M.F.; Abd-Elaziz, A.A.; Muawia, S.; Naguib, Y.M.; Khalil, H. Anticancer Properties of Selenium-Enriched Oyster Culinary-Medicinal Mushroom, Pleurotus ostreatus (Agaricomycetes), in Colon Cancer In Vitro. Int. J. Med. Mushrooms 2022, 24, 1–20. [Google Scholar] [CrossRef] [PubMed]
- Awad, A.M.; Dabous, E.; Alalem, M.; Alalem, N.; Nasr, M.E.; Elawdan, K.A.; Nasr, G.M.; Said, W.; El Khashab, K.; Basiouny, M.S.; et al. MicroRNA-141-Regulated KLK10 and TNFSF-15 Gene Expression in Hepatoblastoma Cells as a Novel Mechanism in Liver Carcinogenesis. Sci. Rep. 2024, 14, 13492. [Google Scholar] [CrossRef]
- Dabous, E.; Alalem, M.; Awad, A.M.; Elawdan, K.A.; Tabl, A.M.; Elsaka, S.; Said, W.; Guirgis, A.A.; Khalil, H. Regulation of KLRC and Ceacam Gene Expression by MiR-141 Supports Cell Proliferation and Metastasis in Cervical Cancer Cells. BMC Cancer 2024, 24, 1091. [Google Scholar] [CrossRef]
- Elawdan, K.A.; Farouk, S.; Aref, S.; Shoaib, H.; El-Razik, M.A.; Abbas, N.H.; Younis, M.; Alshambky, A.A.; Khalil, H. Association of Vitamin B12/Ferritin Deficiency in Cancer Patients with Methylomic Changes at Promotors of TET Methylcytosine Dioxygenases. Biomark. Med. 2022, 16, 959–970. [Google Scholar] [CrossRef]
- Khalil, H.; Nada, A.H.; Mahrous, H.; Hassan, A.; Rijo, P.; Ibrahim, I.A.; Mohamed, D.D.; AL-Salmi, F.A.; Mohamed, D.D.; Elmaksoud, A.I.A. Amelioration Effect of 18β-Glycyrrhetinic Acid on Methylation Inhibitors in Hepatocarcinogenesis -Induced by Diethylnitrosamine. Front. Immunol. 2024, 14, 1206990. [Google Scholar] [CrossRef]
- Khalil, H.; Arfa, M.; El-Masrey, S.; EL-Sherbini, S.; Abd-Elaziz, A. Single Nucleotide Polymorphisms of Interleukins Associated with Hepatitis C Virus Infection in Egypt. J. Infect. Dev. Ctries. 2017, 11, 261–268. [Google Scholar] [CrossRef]
- El-Fadl, H.M.A.; Hagag, N.M.; El-Shafei, R.A.; Khayri, M.H.; El-Gedawy, G.; El Maksoud, A.I.A.; Mohamed, D.D.; Mohamed, D.D.; El Halfawy, I.; Khoder, A.I.; et al. Effective Targeting of Raf-1 and Its Associated Autophagy by Novel Extracted Peptide for Treating Breast Cancer Cells. Front. Oncol. 2021, 11, 3317. [Google Scholar] [CrossRef]
- Alalem, M.; Dabous, E.; Awad, A.M.; Alalem, N.; Guirgis, A.A.; El-Masry, S.; Khalil, H. Influenza a Virus Regulates Interferon Signaling and Its Associated Genes; MxA and STAT3 by Cellular MiR-141 to Ensure Viral Replication. Virol. J. 2023, 20, 183. [Google Scholar] [CrossRef]
- Maher, E.; Gedawy, G.; Fathy, W.; Farouk, S.; El Maksoud, A.A.; Guirgis, A.A.; Khalil, H. Hsa-MiR-21-Mediated Cell Death and Tumor Metastases: A Potential Dual Response during Colorectal Cancer Development. Middle East J. Cancer 2020, 11, 483–492. [Google Scholar] [CrossRef]
- Tadros, E.K.; Guirgis, A.A.; Elimam, H.; Habib, D.F.; Hanna, H.; Khalil, H. Supplying Rats with Halfa-Bar and Liquorice Extracts Ameliorate Doxorubicin-Induced Nephrotic Syndrome. Nat. Prod. Res. 2024, 1–7. [Google Scholar] [CrossRef]
NT | DMSO | Triton X-100 | Sorafenib | Acivicin | Azaserine | |
---|---|---|---|---|---|---|
Mean absorbance | 0.05 | 0.07 | 0.37 ** | 0.25 * | 0.07 | 0.09 |
SD | 0.02 | 0.02 | 0.13 | 0.17 | 0.06 | 0.04 |
Relative LDH production | 1.00 | 1.33 | 7.05 | 5 | 1.31 | 1.71 |
p values | 0.33 | 0.002 | 0.04 | 0.99 | 0.15 |
Glutamine Synthetase Domain | Binding Affinity | Full Fitness (kcal/mol) From–To | Estimated ΔG (kcal/mol) From–To |
---|---|---|---|
MS | 35 | −2168 | (−7.04) |
−2147 | (−5.66) | ||
Sorafenib | 31 | −2166.96 | (−8.27) |
−2146.21 | (−8.44) | ||
Acivicin | 38 | −2162.96 | (−6.27) |
−2135.21 | (−6.29) | ||
Azaserine | 52 | −2154.96 | (−6.21) |
−2130.21 | (−6.11) |
Description | Primer Sequences 5′–3′ |
---|---|
Raf-1-sense | TTTCCTGGATCATGTTCCCCT |
Raf-1-antisense | ACTTTGGTGCTACAGTGCTCA |
GS1-sense | ACTGGGTTCCACAAAACGTC |
GS1-antisense | GATGGCTTCTGTCACTGCAA |
PTEN-sense | TTCCATCCTGCAGAAGAAGC |
PTEN-antisense | CTACGGACATTTTCGCATCC |
P53-sense | GCGAGCACTGCCCAACAACA |
P53-anisense | GGTCACCGTCTTGTTGTCCT |
GAPDH-sense | TGGCATTGTGGAAGGGCTCA |
GAPDH-antisense | TGGATGCAGGGATGATGTTCT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Abdelsattar, S.; Al-Amodi, H.S.; Kamel, H.F.; Al-Eidan, A.A.; Mahfouz, M.M.; El khashab, K.; Elshamy, A.M.; Basiouny, M.S.; Khalil, M.A.; Elawdan, K.A.; et al. Effective Targeting of Glutamine Synthetase with Amino Acid Analogs as a Novel Therapeutic Approach in Breast Cancer. Int. J. Mol. Sci. 2025, 26, 78. https://doi.org/10.3390/ijms26010078
Abdelsattar S, Al-Amodi HS, Kamel HF, Al-Eidan AA, Mahfouz MM, El khashab K, Elshamy AM, Basiouny MS, Khalil MA, Elawdan KA, et al. Effective Targeting of Glutamine Synthetase with Amino Acid Analogs as a Novel Therapeutic Approach in Breast Cancer. International Journal of Molecular Sciences. 2025; 26(1):78. https://doi.org/10.3390/ijms26010078
Chicago/Turabian StyleAbdelsattar, Shimaa, Hiba S. Al-Amodi, Hala F. Kamel, Ahood A. Al-Eidan, Marwa M. Mahfouz, Kareem El khashab, Amany M. Elshamy, Mohamed S. Basiouny, Mohamed A. Khalil, Khaled A. Elawdan, and et al. 2025. "Effective Targeting of Glutamine Synthetase with Amino Acid Analogs as a Novel Therapeutic Approach in Breast Cancer" International Journal of Molecular Sciences 26, no. 1: 78. https://doi.org/10.3390/ijms26010078
APA StyleAbdelsattar, S., Al-Amodi, H. S., Kamel, H. F., Al-Eidan, A. A., Mahfouz, M. M., El khashab, K., Elshamy, A. M., Basiouny, M. S., Khalil, M. A., Elawdan, K. A., Elsaka, S., Mohamed, S. E., & Khalil, H. (2025). Effective Targeting of Glutamine Synthetase with Amino Acid Analogs as a Novel Therapeutic Approach in Breast Cancer. International Journal of Molecular Sciences, 26(1), 78. https://doi.org/10.3390/ijms26010078