Impact of Ultraviolet C Radiation on Male Fertility in Rats: Suppression of Autophagy, Stimulation of Gonadotropin-Inhibiting Hormone, and Alteration of miRNAs
Abstract
:1. Introduction
2. Results
2.1. Effects of UVC Irradiation, Alone or in Combination with HES, on Testicular Weight and Gonadosomatic Index in Male Rats
2.2. Effects of UVC Irradiation, Alone or in Combination with HES, on the Sperm Quality of Rats
2.3. Effects of UVC Irradiation, Alone or in Combination with HES, on Oxidative Stress Biomarkers in Male Rat Testes
2.4. Effects of UVC Irradiation, Alone or in Combination with HES, on Serum Levels of Reproductive Hormones in Male Rats
2.5. Effects of UVC Irradiation, Alone or in Combination with HES, on the Expression Levels of Reproductive-Related Genes in the Hypothalamus of Male Rats
2.6. Effects of UVC Irradiation, Alone or in Combination with HES, on the Expression Levels of Reproductive-Related Genes in the Pituitary Glands of Male Rats
2.7. Effects of UVC Irradiation, Alone or in Combination with HES, on the Expression of Kiss 1 and Steroidogenic Genes in the Testicles of Male Rats
2.8. Effects of UVC Irradiation, Alone or in Combination with HES, on Testicular Autophagy-Related Genes Expression in Male Rats
2.9. Effects of UVC Irradiation, Alone or in Combination with HES, on the Gene Expression of miR-20a and miR-137-3p and Their Targets in Male Rats
2.10. Correlation Study
2.11. Agonistic Interaction of HES with Reproductive and Autophagic Receptors in Male Rats
3. Discussion
3.1. Influence of UVC Radiation on Male Reproductive Physiology
3.2. UVC Radiation Induces Oxidative Stress
3.3. UVC Radiation Induces Disruption of Autophagy
3.4. UVC Radiation Alters miRNA Expression Patterns
3.5. Hesperidin Alleviates UVC-Induced Reproductive Damage in Male Rats
4. Conclusions
5. Materials and Methods
5.1. Animals
5.2. UVC Source
5.3. Experimental Design
5.4. Sampling
5.5. Measurement of Testicular Weight and Gonadosomatic Index of Rats
5.6. Assessment of Sperm Parameters
5.6.1. Sperm Motility
5.6.2. Sperm Vitality
5.6.3. Sperm Count
5.6.4. Sperm Morphology
5.7. Measurement of Oxidative Stress Biomarkers in Rat Testis Homogenates
5.8. Measurement of Reproductive Hormones in Male Rats
5.9. Real-Time Polymerase Chain Reaction
5.10. Bioinformatics Analysis
5.11. Molecular Docking Assessment
5.12. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Kumar, N.; Singh, A.K. Impact of environmental factors on human semen quality and male fertility: A narrative review. Environ. Sci. Eur. 2022, 34, 6. [Google Scholar] [CrossRef]
- Srivasatav, S.; Mishra, J.; Keshari, P.; Verma, S.; Aditi, R. Impact of radiation on male fertility. In Oxidative Stress and Toxicity in Reproductive Biology and Medicine: A Comprehensive Update on Male Infertility Volume II; Springer: Berlin/Heidelberg, Germany, 2022; pp. 71–82. [Google Scholar]
- Babakhanzadeh, E.; Nazari, M.; Ghasemifar, S.; Khodadadian, A. Some of the Factors Involved in Male Infertility: A Prospective Review. Int. J. Gen. Med. 2020, 13, 29–41. [Google Scholar] [CrossRef]
- Li, H.; Wang, B.; Zhang, H.; Katsube, T.; Xie, Y.; Gan, L. Apoptosis induction by iron radiation via inhibition of autophagy in Trp53+/-Mouse testes: Is chronic restraint-induced stress a modifying factor? Int. J. Biol. Sci. 2018, 14, 1109. [Google Scholar] [CrossRef] [PubMed]
- World Health Organization. Infertility Prevalence Estimates, 1990–2021; World Health Organization: Geneva, Switzerland, 2023. [Google Scholar]
- Bala, S.; Chugh, N.A.; Bansal, S.C.; Garg, M.L.; Koul, A. Protective role of Aloe vera against X-ray induced testicular dysfunction. Andrologia 2017, 49, e12697. [Google Scholar] [CrossRef] [PubMed]
- Hockberger, P.E. A history of ultraviolet photobiology for humans, animals and microorganisms. Photochem. Photobiol. 2002, 76, 561–579. [Google Scholar] [CrossRef] [PubMed]
- World Health Organization. Radiation: Ultraviolet (UV) Radiation. Available online: https://www.who.int/news-room/questions-and-answers/item/radiation-ultraviolet-(uv) (accessed on 1 August 2024).
- Tang, X.; Yang, T.; Yu, D.; Xiong, H.; Zhang, S. Current insights and future perspectives of ultraviolet radiation (UV) exposure: Friends and foes to the skin and beyond the skin. Environ. Int. 2024, 185, 108535. [Google Scholar] [CrossRef] [PubMed]
- Umar, S.A.; Tasduq, S.A. Ozone layer depletion and emerging public health concerns-an update on epidemiological perspective of the ambivalent effects of ultraviolet radiation exposure. Front. Oncol 2022, 12, 866733. [Google Scholar] [CrossRef]
- Pereira, A.R.; Braga, D.F.O.; Vassal, M.; Gomes, I.B.; Simões, M. Ultraviolet C irradiation: A promising approach for the disinfection of public spaces? Sci. Total Environ. 2023, 879, 163007. [Google Scholar] [CrossRef] [PubMed]
- Torres, E.R.S.; Abad, C.; Piñero, S.; Proverbio, T.; Marín, R.; Proverbio, F.; Camejo, M.I. Effect of ultraviolet C irradiation on human sperm motility and lipid peroxidation. Int. J. Radiat. Biol. 2010, 86, 187–193. [Google Scholar] [CrossRef] [PubMed]
- Sharma, R.; Rajput, N.; Bansal, K.; Highland, H. Effect of low level, short wavelength ultraviolet radiation on sperm chromatin. Asian Pac. J. Reprod. 2017, 6, 252–256. [Google Scholar] [CrossRef]
- Kirat, D.; Alahwany, A.M.; Arisha, A.H.; Abdelkhalek, A.; Miyasho, T. Role of macroautophagy in mammalian male reproductive physiology. Cells 2023, 12, 1322. [Google Scholar] [CrossRef] [PubMed]
- Krek, A.; Grün, D.; Poy, M.N.; Wolf, R.; Rosenberg, L.; Epstein, E.J.; MacMenamin, P.; Da Piedade, I.; Gunsalus, K.C.; Stoffel, M. Combinatorial microRNA target predictions. Nat. Genet. 2005, 37, 495–500. [Google Scholar] [CrossRef] [PubMed]
- Shi, Z.; Yu, M.; Guo, T.; Sui, Y.; Tian, Z.; Ni, X.; Chen, X.; Jiang, M.; Jiang, J.; Lu, Y. MicroRNAs in spermatogenesis dysfunction and male infertility: Clinical phenotypes, mechanisms and potential diagnostic biomarkers. Front. Endocrinol. 2024, 15, 1293368. [Google Scholar] [CrossRef] [PubMed]
- Musa, A.E.; Omyan, G.; Esmaely, F.; Shabeeb, D. Radioprotective effect of hesperidin: A systematic review. Medicina 2019, 55, 370. [Google Scholar] [CrossRef] [PubMed]
- Parhiz, H.; Roohbakhsh, A.; Soltani, F.; Rezaee, R.; Iranshahi, M. Antioxidant and anti-inflammatory properties of the citrus flavonoids hesperidin and hesperetin: An updated review of their molecular mechanisms and experimental models. Phytother. Res. 2015, 29, 323–331. [Google Scholar] [CrossRef]
- Karimi, N.; Monfared, A.S.; Haddadi, G.H.; Soleymani, A.; Mohammadi, E.; Hajian-Tilaki, K.; Borzoueisileh, S. Radioprotective effect of hesperidin on reducing oxidative stress in the lens tissue of rats. Int. J. Pharm. Investig. 2017, 7, 149. [Google Scholar]
- Breen, K.M.; Mellon, P.L. Influence of stress-induced intermediates on gonadotropin gene expression in gonadotrope cells. Mol. Cell. Endocrinol. 2014, 385, 71–77. [Google Scholar] [CrossRef]
- Sobrino, V.; Avendano, M.S.; Perdices-Lopez, C.; Jimenez-Puyer, M.; Tena-Sempere, M. Kisspeptins and the neuroendocrine control of reproduction: Recent progress and new frontiers in kisspeptin research. Front. Neuroendocrinol. 2022, 65, 100977. [Google Scholar] [CrossRef]
- Sharma, A.; Thaventhiran, T.; Minhas, S.; Dhillo, W.S.; Jayasena, C.N. Kisspeptin and testicular function—Is it necessary? Int. J. Mol. Sci. 2020, 21, 2958. [Google Scholar] [CrossRef]
- Chen, J.; Minabe, S.; Munetomo, A.; Magata, F.; Sato, M.; Nakamura, S.; Hirabayashi, M.; Ishihara, Y.; Yamazaki, T.; Uenoyama, Y. Kiss1-dependent and independent release of luteinizing hormone and testosterone in perinatal male rats. Endocr. J. 2022, 69, 797–807. [Google Scholar] [CrossRef]
- Odetayo, A.F.; Akhigbe, R.E.; Bassey, G.E.; Hamed, M.A.; Olayaki, L.A. Impact of stress on male fertility: Role of gonadotropin inhibitory hormone. Front. Endocrinol. 2024, 14, 1329564. [Google Scholar] [CrossRef] [PubMed]
- Mohapatra, S.S.; Mukherjee, J.; Banerjee, D.; Das, P.K.; Ghosh, P.R.; Das, K. RFamide peptides, the novel regulators of mammalian HPG axis: A review. Vet. World 2021, 14, 1867. [Google Scholar] [CrossRef]
- Dai, T.; Yang, L.; Wei, S.; Chu, Y.; Dan, X. The effect of gonadotropin-inhibitory hormone on steroidogenesis and spermatogenesis by acting through the hypothalamic–pituitary–testis axis in mice. Endocrine 2024, 84, 745–756. [Google Scholar] [CrossRef] [PubMed]
- Anjum, S.; Krishna, A.; Tsutsui, K. Inhibitory roles of the mammalian GnIH ortholog RFRP3 in testicular activities in adult mice. J. Endocrinol 2014, 223, 79–91. [Google Scholar] [CrossRef] [PubMed]
- Kaltsas, A. Oxidative stress and male infertility: The protective role of antioxidants. Medicina 2023, 59, 1769. [Google Scholar] [CrossRef]
- Aitken, R.J.; Drevet, J.R.; Moazamian, A.; Gharagozloo, P. Male infertility and oxidative stress: A focus on the underlying mechanisms. Antioxidants 2022, 11, 306. [Google Scholar] [CrossRef] [PubMed]
- Khosrowbeygi, A.; Zarghami, N. Levels of oxidative stress biomarkers in seminal plasma and their relationship with seminal parameters. BMC Clin. Pathol. 2007, 7, 6. [Google Scholar] [CrossRef] [PubMed]
- Yan, L.; Liu, J.; Wu, S.; Zhang, S.; Ji, G.; Gu, A. Seminal superoxide dismutase activity and its relationship with semen quality and SOD gene polymorphism. J. Assist. Reprod. Genet. 2014, 31, 549–554. [Google Scholar] [CrossRef] [PubMed]
- Darbandi, M.; Darbandi, S.; Agarwal, A.; Sengupta, P.; Durairajanayagam, D.; Henkel, R.; Sadeghi, M.R. Reactive oxygen species and male reproductive hormones. Reprod. Biol. Endocrinol. 2018, 16, 87. [Google Scholar] [CrossRef] [PubMed]
- Iwasa, T.; Matsuzaki, T.; Yano, K.; Mayila, Y.; Irahara, M. The roles of kisspeptin and gonadotropin inhibitory hormone in stress-induced reproductive disorders. Endocr. J. 2018, 65, 133–140. [Google Scholar] [CrossRef] [PubMed]
- Jung, C.H.; Ro, S.-H.; Cao, J.; Otto, N.M.; Kim, D.-H. mTOR regulation of autophagy. FEBS Lett. 2010, 584, 1287–1295. [Google Scholar] [CrossRef] [PubMed]
- Kim, M.-J.; Min, Y.; Im, J.S.; Son, J.; Lee, J.S.; Lee, K.-Y. p62 is negatively implicated in the TRAF6-BECN1 signaling axis for autophagy activation and cancer progression by toll-like receptor 4 (TLR4). Cells 2020, 9, 1142. [Google Scholar] [CrossRef] [PubMed]
- Katsuragi, Y.; Ichimura, Y.; Komatsu, M. p62/SQSTM 1 functions as a signaling hub and an autophagy adaptor. FEBS. J 2015, 282, 4672–4678. [Google Scholar] [CrossRef] [PubMed]
- Funderburk, S.F.; Wang, Q.J.; Yue, Z. The Beclin 1–VPS34 complex–at the crossroads of autophagy and beyond. Trends Cell Biol. 2010, 20, 355–362. [Google Scholar] [CrossRef] [PubMed]
- Lee, Y.-K.; Lee, J.-A. Role of the mammalian ATG8/LC3 family in autophagy: Differential and compensatory roles in the spatiotemporal regulation of autophagy. BMB Rep. 2016, 49, 424. [Google Scholar] [CrossRef] [PubMed]
- Silva, J.M.; Rodrigues, S.; Sampaio-Marques, B.; Gomes, P.; Neves-Carvalho, A.; Dioli, C.; Soares-Cunha, C.; Mazuik, B.F.; Takashima, A.; Ludovico, P. Dysregulation of autophagy and stress granule-related proteins in stress-driven Tau pathology. Cell Death Differ. 2019, 26, 1411–1427. [Google Scholar] [CrossRef] [PubMed]
- Yang, J.; Xu, R.; Luan, Y.; Fan, H.; Yang, S.; Liu, J.; Zeng, H.; Shao, L. Rapamycin ameliorates radiation-induced testis damage in mice. Front. Cell Dev. Biol. 2022, 10, 783884. [Google Scholar] [CrossRef]
- Minjares, M.; Wu, W.; Wang, J.-M. Oxidative stress and microRNAs in endothelial cells under metabolic disorders. Cells 2023, 12, 1341. [Google Scholar] [CrossRef] [PubMed]
- Xie, R.; Lin, X.; Du, T.; Xu, K.; Shen, H.; Wei, F.; Hao, W.; Lin, T.; Lin, X.; Qin, Y. Targeted disruption of miR-17-92 impairs mouse spermatogenesis by activating mTOR signaling pathway. Medicine 2016, 95, e2713. [Google Scholar] [CrossRef] [PubMed]
- Cito, G.; Coccia, M.E.; Salvianti, F.; Fucci, R.; Picone, R.; Giachini, C.; Cocci, A.; Falcone, P.; Micelli, E.; Verrienti, P. Blood plasma miR-20a-5p expression as a potential non-invasive diagnostic biomarker of male infertility: A pilot study. Andrology 2020, 8, 1256–1264. [Google Scholar] [CrossRef]
- Li, G.; Xian, J.; Fang, D.; Mo, Y.; Zheng, C.; Gan, M.; Dong, Y.; Li, Y. miR-137 regulates testosterone secretion in Leydig cells of rats by Kiss-1. Int. J. Clin. Exp. Med. 2018, 11, 8364–8369. [Google Scholar]
- Avendaño, M.S.; Perdices-Lopez, C.; Guerrero-Ruiz, Y.; Ruiz-Pino, F.; Rodriguez-Sanchez, A.B.; Sanchez-Tapia, M.J.; Sobrino, V.; Pineda, R.; Barroso, A.; Correa-Sáez, A. The evolutionary conserved miR-137/325 tandem mediates obesity-induced hypogonadism and metabolic comorbidities by repressing hypothalamic kisspeptin. Metabolism 2024, 157, 155932. [Google Scholar] [CrossRef] [PubMed]
- Zeng, Y.; Huo, G.; Mo, Y.; Wang, W.; Chen, H. MIR137 regulates starvation-induced autophagy by targeting ATG7. J. Mol. Neurosci. 2015, 56, 815–821. [Google Scholar] [CrossRef]
- Shaban, N.Z.; Ahmed Zahran, A.M.; El-Rashidy, F.H.; Abdo Kodous, A.S. Protective role of hesperidin against γ-radiation-induced oxidative stress and apoptosis in rat testis. J. Biol. Res. Thessalon. 2017, 24, 5. [Google Scholar] [CrossRef] [PubMed]
- Li, M.; Lin, X.-f.; Lu, J.; Zhou, B.-r.; Luo, D. Hesperidin ameliorates UV radiation-induced skin damage by abrogation of oxidative stress and inflammatory in HaCaT cells. J. Photochem. Photobiol. B Biol. 2016, 165, 240–245. [Google Scholar] [CrossRef] [PubMed]
- Hewage, S.R.K.M.; Piao, M.J.; Kang, K.A.; Ryu, Y.S.; Han, X.; Oh, M.C.; Jung, U.; Kim, I.G.; Hyun, J.W. Hesperidin attenuates ultraviolet B-induced apoptosis by mitigating oxidative stress in human keratinocytes. Biomol. Ther. 2016, 24, 312. [Google Scholar] [CrossRef]
- Kim, G.D. Hesperidin inhibits vascular formation by blocking the AKT/mTOR signaling pathways. Prev. Nutr. Food Sci. 2015, 20, 221. [Google Scholar] [CrossRef] [PubMed]
- Saiprasad, G.; Chitra, P.; Manikandan, R.; Sudhandiran, G. Hesperidin induces apoptosis and triggers autophagic markers through inhibition of Aurora-A mediated phosphoinositide-3-kinase/Akt/mammalian target of rapamycin and glycogen synthase kinase-3 beta signalling cascades in experimental colon carcinogenesis. Eur. J. Cancer. 2014, 50, 2489–2507. [Google Scholar] [CrossRef]
- Huang, D.; Bian, G.; Pan, Y.; Han, X.; Sun, Y.; Wang, Y.; Shen, G.; Cheng, M.; Fang, X.; Hu, S. MiR–20a-5p promotes radio-resistance by targeting Rab27B in nasopharyngeal cancer cells. Cancer Cell Int. 2017, 17, 32. [Google Scholar] [CrossRef]
- Wang, Z.-C.; Huang, F.-Z.; Xu, H.-B.; Sun, J.-C.; Wang, C.-F. MicroRNA-137 inhibits autophagy and chemosensitizes pancreatic cancer cells by targeting ATG5. Int. J. Biochem. Cell Biol. 2019, 111, 63–71. [Google Scholar] [CrossRef] [PubMed]
- Claytor, S.; Campbell, R.; Hattori, A.; Brown, E.; Hollis, C.; Schureck, M.; Atchley, H.; Stone, J.; Grady, M.; Yang, B. Portable ultraviolet-C chambers for inactivation of SARS-CoV-2. J. res. Natl. Inst. Stand. Technol. 2021, 126, 126056. [Google Scholar] [CrossRef] [PubMed]
- Attia, A.A.; Hamad, H.A.; Fawzy, M.A.; Saleh, S.R. The prophylactic effect of vitamin C and vitamin B12 against ultraviolet-C-induced hepatotoxicity in male rats. Molecules 2023, 28, 4302. [Google Scholar] [CrossRef] [PubMed]
- Shokoohi, M.; Khaki, A.; Shoorei, H.; Khaki, A.A.; Moghimian, M.; Abtahi-Eivary, S.H. Hesperidin attenuated apoptotic-related genes in testicle of a male rat model of varicocoele. Androl. 2020, 8, 249–258. [Google Scholar] [CrossRef]
- World Health Organization. WHO Laboratory Manual for the Examination and Processing of Human Semen; World Health Organization: Geneva, Switzerland, 2021. [Google Scholar]
Parameter | SOD | TAC | MDA | FSH | FSHβ1 | LH | LHβ1 | T. | GnIH | GnRH | Kiss1 | Kiss1r | mTOR | P62 | Beclin1 | LC3II | miR-20a-5p | miR-137-3p Hypoth. | miR- 137-3p Testes | Tes. W. | Sp. count | Live. Sp. | Ab. Sp. | Prog. Sp. Motility | |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
SOD | r p | 1 | 0.974 0.001 | −0.890 0.017 | 0.914 0.010 | 0.911 0.011 | 0.88 0.01 | 0.89 0.01 | 0.933 0.006 | −0.867 0.025 | 0.895 0.016 | 0.978 0.001 | 0.842 0.035 | −0.818 0.046 | −0.991 0.000 | 0.902 0.014 | 0.917 0.010 | 0.880 0.028 | −0.971 0.001 | −0.839 0.037 | 0.872 0.023 | 0.873 0.022 | 0.855 0.030 | −0.857 0.029 | 0.907 0.012 |
TAC | r p | 0.974 0.001 | 1 | −0.947 0.004 | 0.967 0.001 | 0.952 0.003 | 0.972 0.001 | 0.960 0.002 | 0.975 0.001 | −0.975 0.001 | 0.974 0.001 | 0.988 0.000 | 0.962 0.002 | −0.947 0.004 | −0.953 0.003 | 0.990 0.000 | 0.940 0.005 | 0.954 0.003 | −0.993 0.000 | −0.962 0.002 | 0.972 0.001 | 0.968 0.001 | 0.968 0.001 | −0.966 0.001 | 0.987 0.000 |
MDA | r p | −0.890 0.017 | −0.947 0.004 | 1 | −0.951 0.003 | −0.940 0.005 | −0.929 0.00 | −0.927 0.007 | −0.902 0.014 | 0.950 0.004 | −0.943 0.004 | −0.885 0.019 | −0.960 0.002 | 0.991 0.000 | 0.909 0.012 | −0.941 0.005 | −0.974 0.001 | −0.927 0.008 | 0.871 0.024 | 0.977 0.001 | −0.973 0.001 | −0.972 0.001 | −0.983 0.000 | 0.985 0.000 | −0.963 0.002 |
FSH | r p | 0.914 0.010 | 0.967 0.001 | −0.951 0.003 | 1 | 0.997 0.001 | 0.940 0.005 | 0.953 0.003 | 0.968 0.001 | −0.949 0.004 | 0.955 0.002 | 0.973 0.001 | 0.942 0.004 | −0.964 0.002 | −0.975 0.001 | 0.952 0.003 | 0.939 0.005 | 0.940 0.005 | −0.947 0.004 | −0.949 0.004 | 0.969 0.001 | 0.973 0.001 | 0.969 0.001 | −0.975 0.001 | 0.988 0.000 |
FSHβ1 | r p | 0.911 0.011 | 0.952 0.003 | −0.940 0.005 | 0.997 0.001 | 1 | 0.922 0.008 | 0.950 0.003 | 0.955 0.003 | −0.925 0.008 | 0.946 0.004 | 0.967 0.001 | 0.926 0.008 | −0.949 0.004 | −0.966 0.002 | 0.933 0.006 | 0.924 0.008 | 0.935 0.006 | −0.933 0.006 | −0.933 0.007 | 0.958 0.002 | 0.965 0.002 | 0.955 0.003 | −0.964 0.001 | 0.975 0.001 |
LH | r p | 0.882 0.019 | 0.972 0.001 | −0.929 0.007 | 0.940 0.005 | 0.922 0.008 | 1 | 0.965 0.002 | 0.962 0.002 | −0.964 0.002 | 0.972 0.001 | 0.947 0.004 | 0.969 0.001 | −0.935 0.006 | −0.958 0.003 | 0.986 0.000 | 0.981 0.000 | 0.970 0.001 | −0.963 0.002 | −0.970 0.001 | 0.977 0.001 | 0.970 0.001 | 0.975 0.001 | −0.974 0.001 | 0.972 0.001 |
LHβ1 | r p | 0.891 0.015 | 0.960 0.002 | −0.927 0.007 | 0.953 0.003 | 0.950 0.003 | 0.965 0.002 | 1 | 0.919 0.009 | −0.915 0.010 | 0.994 0.000 | 0.956 0.002 | 0.972 0.001 | −0.927 0.008 | −0.960 0.001 | 0.970 0.001 | 0.953 0.003 | 0.998 0.000 | −0.952 0.003 | −0.969 0.001 | 0.984 0.000 | 0.987 0.000 | 0.971 0.001 | −0.971 0.001 | 0.959 0.002 |
T. | r p | 0.933 0.006 | 0.975 0.000 | −0.902 0.013 | 0.968 0.001 | 0.955 0.003 | 0.962 0.002 | 0.919 0.009 | 1 | −0.965 0.001 | 0.9267 0.008 | 0.972 0.001 | 0.913 0.011 | −0.926 0.008 | −0.965 0.002 | 0.953 0.003 | 0.932 0.007 | 0.911 0.011 | −0.967 0.002 | −0.921 0.009 | 0.940 0.005 | 0.936 0.006 | 0.943 0.004 | −0.949 0.003 | 0.977 0.001 |
GnIH | r p | −0.867 0.025 | −0.975 0.001 | 0.950 0.003 | −0.949 0.003 | −0.925 0.009 | −0.964 0.002 | −0.915 0.010 | −0.965 0.002 | 1 | −0.943 0.004 | −0.938 0.005 | −0.962 0.002 | 0.975 0.001 | 0.954 0.003 | −0.979 0.001 | −0.959 0.003 | −0.914 0.011 | 0.949 0.004 | 0.968 0.002 | −0.964 0.002 | −0.954 0.003 | −0.974 0.001 | 0.970 0.001 | −0.984 0.000 |
GnRH | r p | 0.895 0.015 | 0.974 0.001 | −0.943 0.004 | 0.955 0.002 | 0.946 0.004 | 0.972 0.001 | 0.994 0.000 | 0.926 0.008 | −0.943 0.004 | 1 | 0.959 0.002 | 0.989 0.000 | −0.949 0.004 | −0.976 0.001 | 0.987 0.000 | 0.962 0.002 | 0.994 0.000 | −0.962 0.002 | −0.986 0.000 | 0.993 0.000 | 0.993 0.000 | 0.984 0.000 | −0.981 0.000 | 0.973 0.001 |
Kiss1 | r p | 0.978 0.001 | 0.988 0.001 | −0.885 0.019 | 0.973 0.001 | 0.967 0.002 | 0.947 0.004 | 0.956 0.002 | 0.972 0.001 | −0.938 0.005 | 0.959 0.002 | 1 | 0.928 0.007 | −0.916 0.010 | −0.996 0.000 | 0.963 0.002 | 0.905 0.013 | 0.944 0.004 | −0.991 0.000 | −0.928 0.007 | 0.951 0.003 | 0.952 0.003 | 0.942 0.005 | −0.944 0.004 | 0.973 0.001 |
Kiss1r | r p | 0.842 0.035 | 0.962 0.002 | −0.968 0.001 | 0.942 0.004 | 0.926 0.008 | 0.969 0.001 | 0.972 0.001 | 0.913 0.011 | −0.962 0.002 | 0.989 0.000 | 0.928 0.007 | 1 | −0.973 0.001 | −0.954 0.003 | 0.987 0.000 | 0.977 0.001 | 0.975 0.001 | −0.937 0.005 | −0.999 0.000 | 0.994 0.000 | 0.990 0.000 | 0.993 0.000 | −0.987 0.000 | 0.972 0.001 |
mTOR | r p | −0.818 0.046 | −0.947 0.004 | 0.991 0.002 | −0.964 0.002 | −0.949 0.004 | −0.935 0.006 | −0.927 0.007 | −0.926 0.008 | 0.975 0.001 | −0.949 0.003 | −0.916 0.010 | −0.973 0.001 | 1 | 0.938 0.005 | −0.959 0.002 | −0.963 0.002 | −0.922 0.009 | 0.906 0.012 | 0.980 0.006 | −0.975 0.001 | −0.973 0.001 | −0.986 0.000 | 0.985 0.000 | −0.980 0.001 |
P62 | r p | −0.99 0.001 | −0.953 0.003 | 0.909 0.012 | −0.975 0.001 | −0.966 0.002 | −0.958 0.002 | −0.968 0.001 | −0.965 0.002 | 0.954 0.003 | −0.976 0.001 | −0.996 0.000 | −0.954 0.003 | 0.938 0.005 | 1 | −0.979 0.001 | −0.816 0.048 | −0.959 0.003 | 0.992 0.000 | 0.953 0.003 | −0.875 0.022 | −0.875 0.022 | −0.859 0.028 | 0.861 0.027 | −0.912 0.011 |
Beclin1 | r p | 0.902 0.014 | 0.990 0.001 | −0.941 0.005 | 0.952 0.003 | 0.933 0.006 | 0.986 0.001 | 0.970 0.001 | 0.954 0.003 | −0.979 0.001 | 0.987 0.000 | 0.963 0.002 | 0.987 0.000 | −0.959 0.002 | −0.979 0.000 | 1 | 0.968 0.002 | 0.971 0.001 | −0.976 0.001 | −0.986 0.000 | 0.988 0.000 | 0.981 0.000 | 0.985 0.000 | −0.980 0.001 | 0.984 0.000 |
LC3II | r p | 0.917 0.010 | 0.940 0.005 | −0.974 0.001 | 0.939 0.005 | 0.924 0.008 | 0.981 0.001 | 0.953 0.003 | 0.932 0.006 | −0.959 0.002 | 0.962 0.002 | 0.905 0.013 | 0.977 0.001 | −0.963 0.002 | −0.816 0.047 | 0.968 0.002 | 1 | 0.960 0.002 | −0.911 0.012 | −0.982 0.000 | 0.986 0.000 | 0.981 0.000 | 0.985 0.000 | −0.979 0.001 | 0.981 0.000 |
miR- 20a-5p | r p | 0.880 0.020 | 0.954 0.003 | −0.927 0.007 | 0.940 0.005 | 0.935 0.006 | 0.970 0.001 | 0.998 0.000 | 0.911 0.011 | −0.914 0.011 | 0.994 0.000 | 0.944 0.005 | 0.975 0.001 | −0.922 0.009 | −0.959 0.002 | 0.971 0.001 | 0.960 0.002 | 1 | −0.946 0.004 | −0.971 0.001 | 0.984 0.000 | 0.986 0.000 | 0.971 0.001 | −0.970 0.001 | 0.954 0.003 |
miR-137-3p Hypoth. | r p | −0.971 0.001 | −0.993 0.001 | 0.871 0.023 | −0.947 0.004 | −0.933 0.006 | −0.963 0.002 | −0.952 0.003 | −0.967 0.001 | 0.949 0.004 | −0.962 0.002 | −0.991 0.000 | −0.937 0.005 | 0.906 0.013 | 0.992 0.000 | −0.976 0.001 | −0.910 0.011 | −0.946 0.004 | 1 | 0.934 0.006 | −0.950 0.004 | −0.946 0.004 | −0.940 0.005 | 0.938 0.005 | −0.966 0.001 |
miR-137-3p Testes | r p | −0.839 0.037 | −0.962 0.002 | 0.977 0.001 | −0.949 0.003 | −0.933 0.006 | −0.970 0.001 | −0.969 0.001 | −0.921 0.008 | 0.968 0.001 | −0.986 0.000 | −0.928 0.007 | −0.999 0.000 | 0.980 0.001 | 0.953 0.003 | −0.986 0.000 | −0.982 0.000 | −0.971 0.001 | 0.934 0.006 | 1 | −0.995 0.000 | −0.991 0.000 | −0.996 0.000 | 0.992 0.000 | −0.978 0.001 |
Tes. w. | r p | 0.872 0.023 | 0.972 0.001 | −0.973 0.001 | 0.969 0.001 | 0.958 0.002 | 0.977 0.001 | 0.984 0.000 | 0.940 0.005 | −0.964 0.002 | 0.993 0.000 | 0.951 0.003 | 0.994 0.000 | −0.975 0.001 | −0.875 0.022 | 0.988 0.000 | 0.986 0.000 | 0.984 0.000 | −0.950 0.004 | −0.995 0.000 | 1 | 0.999 0.000 | 0.997 0.000 | −0.996 0.000 | 0.996 0.000 |
Sp. count | r p | 0.873 0.022 | 0.968 0.001 | −0.972 0.001 | 0.973 0.001 | 0.965 0.002 | 0.970 0.001 | 0.987 0.000 | 0.936 0.006 | −0.954 0.003 | 0.993 0.000 | 0.952 0.003 | 0.990 0.000 | −0.973 0.001 | −0.875 0.022 | 0.981 0.000 | 0.981 0.000 | 0.986 0.000 | −0.946 0.004 | −0.991 0.000 | 0.999 0.000 | 1 | 0.995 0.000 | −0.995 0.000 | 0.995 0.000 |
Live Sp. | r p | 0.855 0.030 | 0.968 0.001 | −0.983 0.000 | 0.969 0.001 | 0.955 0.003 | 0.975 0.001 | 0.971 0.001 | 0.943 0.004 | −0.974 0.001 | 0.984 0.000 | 0.942 0.005 | 0.993 0.000 | −0.986 0.000 | −0.859 0.028 | 0.985 0.000 | 0.985 0.000 | 0.971 0.001 | −0.940 0.005 | −0.996 0.000 | 0.997 0.000 | 0.995 0.000 | 1 | −0.999 0.000 | 0.999 0.000 |
Ab. Sp. | r p | −0.857 0.029 | −0.966 0.001 | 0.985 0.000 | −0.975 0.001 | −0.964 0.001 | −0.974 0.001 | −0.971 0.001 | −0.949 0.003 | 0.970 0.001 | −0.981 0.000 | −0.944 0.004 | −0.987 0.000 | 0.985 0.000 | 0.861 0.027 | −0.980 0.001 | −0.979 0.001 | −0.970 0.001 | 0.938 0.005 | 0.992 0.000 | −0.996 0.000 | −0.995 0.000 | −0.999 0.000 | 1 | −0.989 0.000 |
Prog. Sp. Motility | r p | 0.907 0.012 | 0.987 0.000 | −0.963 0.002 | 0.988 0.000 | 0.975 0.001 | 0.972 0.001 | 0.959 0.002 | 0.977 0.001 | −0.984 0.000 | 0.973 0.001 | 0.973 0.001 | 0.972 0.001 | −0.980 0.001 | −0.912 0.011 | 0.984 0.000 | 0.981 0.000 | 0.954 0.003 | −0.966 0.001 | −0.978 0.001 | 0.996 0.000 | 0.995 0.000 | 0.999 0.000 | −0.989 0.000 | 1 |
Gene Name | Forward Primer (5′-3′) | Reverse Primer (5′-3′) | Product Size | Accession No. |
---|---|---|---|---|
Primers for mRNAs | ||||
GnIH | AGAGCAACCTAGGAAACGGGTGTT | AGGACTGGCTGGAGGTTTCCTATT | 84 | NM_023952.1 |
GnRH | AGGAGCTCTGGAACGTCTGAT | AGCGTCAATGTCACACTCGG | 100 | NM_012767.2 |
GnRHr | TCAGGACCCACGCAAACTAC | CTGGCTCTGACACCCTGTTT | 182 | NM_031038.3 |
Kiss1 | TGCTGCTTCTCCTCTGTGTGG | ATTAACGAGTTCCTGGGGTCC | 110 | NM_181692.1 |
Kiss1r | CTTTCCTTCTGTGCTGCGTA | CCTGCTGGATGTAGTTGACG | 102 | NM_023992.1 |
LHβ1 | AGAATGGAGAGGCTCCAGGG | CCATGCTAGGACAGTAGCCG | 187 | NM_012858.2 |
FSHβ1 | ACCAGCTTTCTCTCCCATGC | GAGAAGCAGGGGGTCCTAGA | 171 | NM_001007597.2 |
STAR | CCCAAATGTCAAGGAAATCA | AGGCATCTCCCCAAAGTG | 187 | NM_031558.3 |
HSD17β3 | AGTGTGTGAGGTTCTCCCGGTACCT | TACAACATTGAGTCCATGTCTGGCCAG | 161 | NM_054007.1 |
CYP11A1 | AAGTATCCGTGATGTGGG | TCATACAGTGTCGCCTTTTCT | 127 | NM_017286.3 |
CYP17A1 | TGGCTTTCCTGGTGCACAATC | TGAAAGTTGGTGTTCGGCTGAAG | 90 | NM_012753.2 |
CYP19A1 | GCTGAGAGACGTGGAGACCTG | CTCTGTCACCAACAACAGTGTGG | 178 | NM_017085.2 |
mTOR | GCAATGGGCACGAGTTTGTT | AGTGTGTTCACCAGGCCAAA | 94 | NM_019906.2 |
P62 | GGAAGCTGAAACATGGGCAC | CCAAGGGTCCACCTGAACAA | 183 | NM_181550.2 |
Beclin1 | GAATGGAGGGGTCTAAGGCG | CTTCCTCCTGGCTCTCTCT | 180 | NM_001034117.1 |
LC3-II | GAAATGGTCACCCCACGAGT | ACACAGTTTTCCCATGCCCA | 147 | NM_012823.2 |
GAPDH | GGCACAGTCAAGGCTGAGAATG | ATGGTGGTGAAGACGCCAGTA | 143 | NM_017008.4 |
Primers for miRNAs and internal control | ||||
miR-137-3p | AGCCAGCGTTATTGCTTAAGAAT | GTCGTATCCAGTGCAGGGT | ||
miR-20a-5p | AAGCGCCTTAAAGTGCTTATAGT | GTCGTATCCAGTGCAGGGT | ||
U6 | GCTCGCTTCGGCAGCACA | GAGGTATTCGCACCAGAGGA | ||
Stem-loop primers for miRNAs and internal control | ||||
miR-137-3p | 5′-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCTACGC-3′ | |||
miR-20a-5p | 5′-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCTACCT-3′ | |||
U6 | 5′-AACGCTTCACGAATTTGCGTG-3′ |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Alahwany, A.M.; Arisha, A.H.; Abdelkhalek, A.; Khamis, T.; Miyasho, T.; Kirat, D. Impact of Ultraviolet C Radiation on Male Fertility in Rats: Suppression of Autophagy, Stimulation of Gonadotropin-Inhibiting Hormone, and Alteration of miRNAs. Int. J. Mol. Sci. 2025, 26, 316. https://doi.org/10.3390/ijms26010316
Alahwany AM, Arisha AH, Abdelkhalek A, Khamis T, Miyasho T, Kirat D. Impact of Ultraviolet C Radiation on Male Fertility in Rats: Suppression of Autophagy, Stimulation of Gonadotropin-Inhibiting Hormone, and Alteration of miRNAs. International Journal of Molecular Sciences. 2025; 26(1):316. https://doi.org/10.3390/ijms26010316
Chicago/Turabian StyleAlahwany, Ahmed Mohamed, Ahmed Hamed Arisha, Adel Abdelkhalek, Tarek Khamis, Taku Miyasho, and Doaa Kirat. 2025. "Impact of Ultraviolet C Radiation on Male Fertility in Rats: Suppression of Autophagy, Stimulation of Gonadotropin-Inhibiting Hormone, and Alteration of miRNAs" International Journal of Molecular Sciences 26, no. 1: 316. https://doi.org/10.3390/ijms26010316
APA StyleAlahwany, A. M., Arisha, A. H., Abdelkhalek, A., Khamis, T., Miyasho, T., & Kirat, D. (2025). Impact of Ultraviolet C Radiation on Male Fertility in Rats: Suppression of Autophagy, Stimulation of Gonadotropin-Inhibiting Hormone, and Alteration of miRNAs. International Journal of Molecular Sciences, 26(1), 316. https://doi.org/10.3390/ijms26010316