Attenuation of Polycyclic Aromatic Hydrocarbon (PAH)-Induced Carcinogenesis and Tumorigenesis by Omega-3 Fatty Acids in Mice In Vivo
Abstract
1. Introduction
2. Results
2.1. Dietary Omega-3 Fatty Acids Modulate Levels of Pulmonary PAH-DNA Adducts in WT and Cyp1a1-Null Mice (Experiment 1)
2.2. EPA/DHA Decreases the Levels of PAH-DNA Adducts and Inhibits CYP1B1 Expression
2.3. EPA/DHA Decreases the Formation of Lung Tumors in A/J Mice
2.4. Inhibition of sEH Enhances EPA/DHA-Mediated Prevention of Pulmonary Carcinogenesis
2.5. Attenuation of Expression of PAH-Induced Genes Associated with Epigenetic Regulation by EPA/DHA In Vivo
3. Discussion
4. Materials and Methods
4.1. Chemicals
4.2. Animals
4.3. Diet
4.4. Animal Experiments
4.4.1. Experiment 1: Effects of Dietary Omega-3 Fatty Acids on Formation of DNA Adducts
4.4.2. Experiment 2: Effects of EPA/DHA on Lung DNA Adducts and Tumor Formation
4.4.3. Experiment 3: Inhibition of CYP1B1 Expression by EPA and DHA
4.4.4. Experiment 4: Inhibition of sEH Enhances EPA/DHA-Mediated Prevention of BP-Induced Lung Carcinogenesis
4.5. DNA Adduct Analysis
4.6. qRT-PCR Analysis
4.7. Histological Examination
4.8. Statistical Analysis
5. Conclusions
Limitations of the Study
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Siegel, R.L.; Miller, K.D.; Wagle, N.S.; Jemal, A. Cancer statistics, 2023. CA Cancer J. Clin. 2023, 73, 17–48. [Google Scholar] [CrossRef]
- Sung, H.; Ferlay, J.; Siegel, R.L.; Laversanne, M.; Soerjomataram, I.; Jemal, A.; Bray, F. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J. Clin. 2021, 71, 209–249. [Google Scholar] [CrossRef]
- Stading, R.; Gastelum, G.; Chu, C.; Jiang, W.; Moorthy, B. Molecular mechanisms of pulmonary carcinogenesis by polycyclic aromatic hydrocarbons (PAHs): Implications for human lung cancer. Semin. Cancer Biol. 2021, 76, 3–16. [Google Scholar] [CrossRef] [PubMed]
- Moorthy, B.; Chu, C.; Carlin, D.J. Polycyclic aromatic hydrocarbons: From metabolism to lung cancer. Toxicol. Sci. 2015, 145, 5–15. [Google Scholar] [CrossRef]
- Sarigiannis, D.; Karakitsios, S.P.; Zikopoulos, D.; Nikolaki, S.; Kermenidou, M. Lung cancer risk from PAHs emitted from biomass combustion. Environ. Res. 2015, 137, 147–156. [Google Scholar] [CrossRef]
- Bansal, V.; Kim, K.H. Review of PAH contamination in food products and their health hazards. Environ. Int. 2015, 84, 26–38. [Google Scholar] [CrossRef]
- Li, F.; Gu, J.; Xin, J.; Schnelle-Kreis, J.; Wang, Y.; Liu, Z.; Shen, R.; Michalke, B.; Abbaszade, G.; Zimmermann, R. Characteristics of chemical profile, sources and PAH toxicity of PM(2.5) in beijing in autumn-winter transit season with regard to domestic heating, pollution control measures and meteorology. Chemosphere 2021, 276, 130143. [Google Scholar] [CrossRef]
- Androutsopoulos, V.P.; Tsatsakis, A.M.; Spandidos, D.A. Cytochrome P450 CYP1A1: Wider roles in cancer progression and prevention. BMC Cancer 2009, 9, 187. [Google Scholar] [CrossRef] [PubMed]
- Hecht, S.S. Tobacco carcinogens, their biomarkers and tobacco-induced cancer. Nat. Rev. 2003, 3, 733–744. [Google Scholar] [CrossRef]
- Wogan, G.N.; Hecht, S.S.; Felton, J.S.; Conney, A.H.; Loeb, L.A. Environmental and chemical carcinogenesis. Semin. Cancer Biol. 2004, 14, 473–486. [Google Scholar] [CrossRef]
- Hecht, S.S. Lung carcinogenesis by tobacco smoke. Int. J. Cancer 2012, 131, 2724–2732. [Google Scholar] [CrossRef] [PubMed]
- Phillips, T.D.; Richardson, M.; Cheng, Y.S.; He, L.; McDonald, T.J.; Cizmas, L.H.; Safe, S.H.; Donnelly, K.C.; Wang, F.; Moorthy, B.; et al. Mechanistic relationships between hepatic genotoxicity and carcinogenicity in male B6C3F1 mice treated with polycyclic aromatic hydrocarbon mixtures. Arch. Toxicol. 2015, 89, 967–977. [Google Scholar] [CrossRef] [PubMed]
- Basu, A.K. DNA Damage, Mutagenesis and Cancer. Int. J. Mol. Sci. 2018, 19, 970. [Google Scholar] [CrossRef] [PubMed]
- Poirier, M.C.; Beland, F.A. DNA adduct measurements and tumor incidence during chronic carcinogen exposure in animal models: Implications for DNA adduct-based human cancer risk assessment. Chem. Res. Toxicol. 1992, 5, 749–755. [Google Scholar] [CrossRef]
- Gastelum, G.; Jiang, W.; Wang, L.; Zhou, G.; Borkar, R.; Putluri, N.; Moorthy, B. Polycyclic Aromatic Hydrocarbon-induced Pulmonary Carcinogenesis in Cytochrome P450 (CYP)1A1- and 1A2-Null Mice: Roles of CYP1A1 and CYP1A2. Toxicol. Sci. 2020, 177, 347–361. [Google Scholar] [CrossRef]
- Ceppi, M.; Munnia, A.; Cellai, F.; Bruzzone, M.; Peluso, M.E.M. Linking the generation of DNA adducts to lung cancer. Toxicology 2017, 390, 160–166. [Google Scholar] [CrossRef]
- Hang, B. Repair of exocyclic DNA adducts: Rings of complexity. Bioessays 2004, 26, 1195–1208. [Google Scholar] [CrossRef]
- Wang, L.E.; Hu, Z.; Sturgis, E.M.; Spitz, M.R.; Strom, S.S.; Amos, C.I.; Guo, Z.; Qiao, Y.; Gillenwater, A.M.; Myers, J.N.; et al. Reduced DNA repair capacity for removing tobacco carcinogen-induced DNA adducts contributes to risk of head and neck cancer but not tumor characteristics. Clin. Cancer Res. 2010, 16, 764–774. [Google Scholar] [CrossRef]
- Foresta, M.; Izzotti, A.; La Maestra, S.; Micale, R.; Poggi, A.; Vecchio, D.; Frosina, G. Accelerated repair and reduced mutagenicity of DNA damage induced by cigarette smoke in human bronchial cells transfected with E. coli formamidopyrimidine DNA glycosylase. PLoS ONE 2014, 9, e87984. [Google Scholar] [CrossRef]
- Green, D.R.; Martin, S.J. The killer and the executioner: How apoptosis controls malignancy. Curr. Opin. Immunol. 1995, 7, 694–703. [Google Scholar] [CrossRef]
- Vermeulen, K.; Van Bockstaele, D.R.; Berneman, Z.N. Apoptosis: Mechanisms and relevance in cancer. Ann. Hematol. 2005, 84, 627–639. [Google Scholar] [CrossRef] [PubMed]
- Kim, S.; Jing, K.; Shin, S.; Jeong, S.; Han, S.H.; Oh, H.; Yoo, Y.S.; Han, J.; Jeon, Y.J.; Heo, J.Y.; et al. omega3-polyunsaturated fatty acids induce cell death through apoptosis and autophagy in glioblastoma cells: In vitro and in vivo. Oncol. Rep. 2018, 39, 239–246. [Google Scholar] [PubMed]
- Chun, Y.J.; Kim, S.; Kim, D.; Lee, S.K.; Guengerich, F.P. A new selective and potent inhibitor of human cytochrome P450 1B1 and its application to antimutagenesis. Cancer Res. 2001, 61, 8164–8170. [Google Scholar] [PubMed]
- Chen, C.; Min, Y.; Li, X.; Chen, D.; Shen, J.; Zhang, D.; Sun, H.; Bian, Q.; Yuan, H.; Wang, S.L. Mutagenicity risk prediction of PAH and derivative mixtures by in silico simulations oriented from CYP compound I-mediated metabolic activation. Sci. Total Environ. 2021, 787, 147596. [Google Scholar] [CrossRef] [PubMed]
- Peter Guengerich, F.; Chun, Y.J.; Kim, D.; Gillam, E.M.; Shimada, T. Cytochrome P450 1B1: A target for inhibition in anticarcinogenesis strategies. Mutat. Res. 2003, 523–524, 173–182. [Google Scholar] [CrossRef] [PubMed]
- Li, C.; Long, B.; Qin, X.; Li, W.; Zhou, Y. Cytochrome P1B1 (CYP1B1) polymorphisms and cancer risk: A meta-analysis of 52 studies. Toxicology 2015, 327, 77–86. [Google Scholar] [CrossRef] [PubMed]
- Chun, Y.J.; Kim, D. Cancer Activation and Polymorphisms of Human Cytochrome P450 1B1. Toxicol. Res. 2016, 32, 89–93. [Google Scholar] [CrossRef] [PubMed]
- Kwon, Y.J.; Baek, H.S.; Ye, D.J.; Shin, S.; Kim, D.; Chun, Y.J. CYP1B1 Enhances Cell Proliferation and Metastasis through Induction of EMT and Activation of Wnt/beta-Catenin Signaling via Sp1 Upregulation. PLoS ONE 2016, 11, e0151598. [Google Scholar] [CrossRef] [PubMed]
- Zhou, G.; Jiang, W.; Xia, G.; Wang, L.; Richardson, M.; Chu, C.; Moorthy, B. Attenuation of Polycyclic Aromatic Hydrocarbon (PAH)-Mediated Pulmonary DNA Adducts and Cytochrome P450 (CYP)1B1 by Dietary Antioxidants, Omega-3 Fatty Acids, in Mice. Antioxidants 2022, 11, 119. [Google Scholar] [CrossRef]
- Zhang, G.; Panigrahy, D.; Mahakian, L.M.; Yang, J.; Liu, J.Y.; Stephen Lee, K.S.; Wettersten, H.I.; Ulu, A.; Hu, X.; Tam, S.; et al. Epoxy metabolites of docosahexaenoic acid (DHA) inhibit angiogenesis, tumor growth, and metastasis. Proc. Natl. Acad. Sci. USA 2013, 110, 6530–6535. [Google Scholar] [CrossRef]
- Das, D.N.; Ravi, N. Influences of polycyclic aromatic hydrocarbon on the epigenome toxicity and its applicability in human health risk assessment. Environ. Res. 2022, 213, 113677. [Google Scholar] [CrossRef]
- Teng, P.C.; Liang, Y.; Yarmishyn, A.A.; Hsiao, Y.J.; Lin, T.Y.; Lin, T.W.; Teng, Y.C.; Yang, Y.P.; Wang, M.L.; Chien, C.S.; et al. RNA Modifications and Epigenetics in Modulation of Lung Cancer and Pulmonary Diseases. Int. J. Mol. Sci. 2021, 22, 10592. [Google Scholar] [CrossRef]
- Fujii, R.; Yamada, H.; Munetsuna, E.; Yamazaki, M.; Mizuno, G.; Ando, Y.; Maeda, K.; Tsuboi, Y.; Ohashi, K.; Ishikawa, H.; et al. Dietary fish and omega-3 polyunsaturated fatty acids are associated with leukocyte ABCA1 DNA methylation levels. Nutrition 2021, 81, 110951. [Google Scholar] [CrossRef]
- Gullett, N.P.; Ruhul Amin, A.R.; Bayraktar, S.; Pezzuto, J.M.; Shin, D.M.; Khuri, F.R.; Aggarwal, B.B.; Surh, Y.J.; Kucuk, O. Cancer prevention with natural compounds. Semin. Oncol. 2010, 37, 258–281. [Google Scholar] [CrossRef]
- Lands, W.E. Biosynthesis of prostaglandins. Annu. Rev. Nutr. 1991, 11, 41–60. [Google Scholar] [CrossRef] [PubMed]
- Sauter, E.R. Cancer prevention and treatment using combination therapy with natural compounds. Expert. Rev. Clin. Pharmacol. 2020, 13, 265–285. [Google Scholar] [CrossRef] [PubMed]
- Zhou, G.D.; Zhu, H.; Phillips, T.D.; Wang, J.; Wang, S.Z.; Wang, F.; Amendt, B.A.; Couroucli, X.I.; Donnelly, K.C.; Moorthy, B. Effects of dietary fish oil on the depletion of carcinogenic PAH-DNA adduct levels in the liver of B6C3F1 mouse. PLoS ONE 2011, 6, e26589. [Google Scholar] [CrossRef]
- Bansal, S.; Leu, A.N.; Gonzalez, F.J.; Guengerich, F.P.; Chowdhury, A.R.; Anandatheerthavarada, H.K.; Avadhani, N.G. Mitochondrial targeting of cytochrome P450 (CYP) 1B1 and its role in polycyclic aromatic hydrocarbon-induced mitochondrial dysfunction. J. Biol. Chem. 2014, 289, 9936–9951. [Google Scholar] [CrossRef] [PubMed]
- Harris, T.R.; Kodani, S.; Yang, J.; Imai, D.M.; Hammock, B.D. An omega-3-enriched diet alone does not attenuate CCl4-induced hepatic fibrosis. J. Nutr. Biochem. 2016, 38, 93–101. [Google Scholar] [CrossRef]
- Hwa Yun, B.; Guo, J.; Bellamri, M.; Turesky, R.J. DNA adducts: Formation, biological effects, and new biospecimens for mass spectrometric measurements in humans. Mass. Spectrom. Rev. 2020, 39, 55–82. [Google Scholar] [CrossRef]
- Shimada, T.; Fujii-Kuriyama, Y. Metabolic activation of polycyclic aromatic hydrocarbons to carcinogens by cytochromes P450 1A1 and 1B1. Cancer Sci. 2004, 95, 1–6. [Google Scholar] [CrossRef] [PubMed]
- Uppstad, H.; Ovrebo, S.; Haugen, A.; Mollerup, S. Importance of CYP1A1 and CYP1B1 in bioactivation of benzo[a]pyrene in human lung cell lines. Toxicol. Lett. 2010, 192, 221–228. [Google Scholar] [CrossRef] [PubMed]
- Habano, W.; Gamo, T.; Sugai, T.; Otsuka, K.; Wakabayashi, G.; Ozawa, S. CYP1B1, but not CYP1A1, is downregulated by promoter methylation in colorectal cancers. Int. J. Oncol. 2009, 34, 1085–1091. [Google Scholar] [CrossRef]
- Gelboin, H.V. Benzo[alpha]pyrene metabolism, activation and carcinogenesis: Role and regulation of mixed-function oxidases and related enzymes. Physiol. Rev. 1980, 60, 1107–1166. [Google Scholar] [CrossRef] [PubMed]
- Uno, S.; Dalton, T.P.; Derkenne, S.; Curran, C.P.; Miller, M.L.; Shertzer, H.G.; Nebert, D.W. Oral exposure to benzo[a]pyrene in the mouse: Detoxication by inducible cytochrome P450 is more important than metabolic activation. Mol. Pharmacol. 2004, 65, 1225–1237. [Google Scholar] [CrossRef] [PubMed]
- Uno, S.; Dalton, T.P.; Dragin, N.; Curran, C.P.; Derkenne, S.; Miller, M.L.; Shertzer, H.G.; Gonzalez, F.J.; Nebert, D.W. Oral benzo[a]pyrene in Cyp1 knockout mouse lines: CYP1A1 important in detoxication, CYP1B1 metabolism required for immune damage independent of total-body burden and clearance rate. Mol. Pharmacol. 2006, 69, 1103–1114. [Google Scholar] [CrossRef] [PubMed]
- Wiest, E.F.; Walsh-Wilcox, M.T.; Rothe, M.; Schunck, W.H.; Walker, M.K. Dietary Omega-3 Polyunsaturated Fatty Acids Prevent Vascular Dysfunction and Attenuate Cytochrome P4501A1 Expression by 2,3,7,8-Tetrachlorodibenzo-P-Dioxin. Toxicol. Sci. 2016, 154, 43–54. [Google Scholar] [CrossRef]
- Fer, M.; Dreano, Y.; Lucas, D.; Corcos, L.; Salaun, J.P.; Berthou, F.; Amet, Y. Metabolism of eicosapentaenoic and docosahexaenoic acids by recombinant human cytochromes P450. Arch. Biochem. Biophys. 2008, 471, 116–125. [Google Scholar] [CrossRef] [PubMed]
- Cui, P.H.; Petrovic, N.; Murray, M. The omega-3 epoxide of eicosapentaenoic acid inhibits endothelial cell proliferation by p38 MAP kinase activation and cyclin D1/CDK4 down-regulation. Br. J. Pharmacol. 2011, 162, 1143–1155. [Google Scholar] [CrossRef]
- Hankinson, O. The role of AHR-inducible cytochrome P450s in metabolism of polyunsaturated fatty acids. Drug Metab. Rev. 2016, 48, 342–350. [Google Scholar] [CrossRef]
- Huerta-Yepez, S.; Tirado-Rodriguez, A.; Montecillo-Aguado, M.R.; Yang, J.; Hammock, B.D.; Hankinson, O. Aryl Hydrocarbon Receptor-Dependent inductions of omega-3 and omega-6 polyunsaturated fatty acid metabolism act inversely on tumor progression. Sci. Rep. 2020, 10, 7843. [Google Scholar] [CrossRef] [PubMed]
- Mao, M.; Wu, Z.; Chen, J. MicroRNA-187-5p suppresses cancer cell progression in non-small cell lung cancer (NSCLC) through down-regulation of CYP1B1. Biochem. Biophys. Res. Commun. 2016, 478, 649–655. [Google Scholar] [CrossRef] [PubMed]
- Lin, J.; Peng, J.; Liu, G.; Deng, L. Overexpression of MECP2 attenuates cigarette smoke extracts induced lung epithelial cell injury by promoting CYP1B1 methylation. J. Toxicol. Sci. 2020, 45, 177–186. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Li, Y.; Zheng, G.; Zhu, L.; Wang, J.; Mu, S.; Ren, Q.; Feng, F. Cytochrome P450 1A1 and 1B1 promoter CpG island methylation regulates rat liver injury induced by isoniazid. Mol. Med. Rep. 2018, 17, 753–762. [Google Scholar] [CrossRef] [PubMed]
- Li, F.; Zhu, W.; Gonzalez, F.J. Potential role of CYP1B1 in the development and treatment of metabolic diseases. Pharmacol. Ther. 2017, 178, 18–30. [Google Scholar] [CrossRef] [PubMed]
- Lopez-Vicario, C.; Alcaraz-Quiles, J.; Garcia-Alonso, V.; Rius, B.; Hwang, S.H.; Titos, E.; Lopategi, A.; Hammock, B.D.; Arroyo, V.; Claria, J. Inhibition of soluble epoxide hydrolase modulates inflammation and autophagy in obese adipose tissue and liver: Role for omega-3 epoxides. Proc. Natl. Acad. Sci. USA 2015, 112, 536–541. [Google Scholar] [CrossRef] [PubMed]
- Morisseau, C.; Hammock, B.D. Impact of soluble epoxide hydrolase and epoxyeicosanoids on human health. Annu. Rev. Pharmacol. Toxicol. 2013, 53, 37–58. [Google Scholar] [CrossRef] [PubMed]
- Xia, R.; Sun, L.; Liao, J.; Li, H.; You, X.; Xu, D.; Yang, J.; Hwang, S.H.; Jones, R.D.; Hammock, B.; et al. Inhibition of Pancreatic Carcinoma Growth Through Enhancing omega-3 Epoxy Polyunsaturated Fatty Acid Profile by Inhibition of Soluble Epoxide Hydrolase. Anticancer Res. 2019, 39, 3651–3660. [Google Scholar] [CrossRef]
- Zhang, G.; Kodani, S.; Hammock, B.D. Stabilized epoxygenated fatty acids regulate inflammation, pain, angiogenesis and cancer. Prog. Lipid Res. 2014, 53, 108–123. [Google Scholar] [CrossRef]
- Wagner, K.; Inceoglu, B.; Hammock, B.D. Soluble epoxide hydrolase inhibition, epoxygenated fatty acids and nociception. Prostaglandins Other Lipid Mediat. 2011, 96, 76–83. [Google Scholar] [CrossRef]
- Zhang, J.; Zhang, W.H.; Morisseau, C.; Zhang, M.; Dong, H.J.; Zhu, Q.M.; Huo, X.K.; Sun, C.P.; Hammock, B.D.; Ma, X.C. Genetic deletion or pharmacological inhibition of soluble epoxide hydrolase attenuated particulate matter 2.5 exposure mediated lung injury. J. Hazard. Mater. 2023, 458, 131890. [Google Scholar] [CrossRef]
- Spector, A.A.; Kim, H.Y. Cytochrome P450 epoxygenase pathway of polyunsaturated fatty acid metabolism. Biochim. Biophys. Acta 2015, 1851, 356–365. [Google Scholar] [CrossRef] [PubMed]
- Arnold, C.; Konkel, A.; Fischer, R.; Schunck, W.H. Cytochrome P450-dependent metabolism of omega-6 and omega-3 long-chain polyunsaturated fatty acids. Pharmacol. Rep. 2010, 62, 536–547. [Google Scholar] [CrossRef] [PubMed]
- Kodani, S.D.; Hammock, B.D. The 2014 Bernard B. Brodie award lecture-epoxide hydrolases: Drug metabolism to therapeutics for chronic pain. Drug Metab Dispos 2015, 43, 788–802. [Google Scholar] [CrossRef] [PubMed]
- Xu, X.; Li, R.; Chen, G.; Hoopes, S.L.; Zeldin, D.C.; Wang, D.W. The Role of Cytochrome P450 Epoxygenases, Soluble Epoxide Hydrolase, and Epoxyeicosatrienoic Acids in Metabolic Diseases. Adv. Nutr. 2016, 7, 1122–1128. [Google Scholar] [CrossRef] [PubMed]
- Hye Khan, M.A.; Hwang, S.H.; Sharma, A.; Corbett, J.A.; Hammock, B.D.; Imig, J.D. A dual COX-2/sEH inhibitor improves the metabolic profile and reduces kidney injury in Zucker diabetic fatty rat. Prostaglandins Other Lipid Mediat. 2016, 125, 40–47. [Google Scholar] [CrossRef][Green Version]
- Hayashita, Y.; Osada, H.; Tatematsu, Y.; Yamada, H.; Yanagisawa, K.; Tomida, S.; Yatabe, Y.; Kawahara, K.; Sekido, Y.; Takahashi, T. A polycistronic microRNA cluster, miR-17-92, is overexpressed in human lung cancers and enhances cell proliferation. Cancer Res. 2005, 65, 9628–9632. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Gan, Y.; Liu, J.; Li, J.; Zhou, Z.; Tian, R.; Sun, R.; Liu, J.; Xiao, Q.; Li, Y.; et al. Downregulation of MEIS1 mediated by ELFN1-AS1/EZH2/DNMT3a axis promotes tumorigenesis and oxaliplatin resistance in colorectal cancer. Signal Transduct. Target. Ther. 2022, 7, 87. [Google Scholar] [CrossRef] [PubMed]
- Maryam, M.; Naemi, M.; Hasani, S.S. A comprehensive review on oncogenic miRNAs in breast cancer. J. Genet. 2021, 100, 15. [Google Scholar]
- Lee, Y.S.; Lee, J.W.; Jang, J.W.; Chi, X.Z.; Kim, J.H.; Li, Y.H.; Kim, M.K.; Kim, D.M.; Choi, B.S.; Kim, E.G.; et al. Runx3 inactivation is a crucial early event in the development of lung adenocarcinoma. Cancer Cell 2013, 24, 603–616. [Google Scholar] [CrossRef]
- Lee, K.S.; Lee, Y.S.; Lee, J.M.; Ito, K.; Cinghu, S.; Kim, J.H.; Jang, J.W.; Li, Y.H.; Goh, Y.M.; Chi, X.Z.; et al. Runx3 is required for the differentiation of lung epithelial cells and suppression of lung cancer. Oncogene 2010, 29, 3349–3361. [Google Scholar] [CrossRef]
- Kim, K.H.; Roberts, C.W. Targeting EZH2 in cancer. Nat. Med. 2016, 22, 128–134. [Google Scholar] [CrossRef] [PubMed]
- Duan, R.; Du, W.; Guo, W. EZH2: A novel target for cancer treatment. J. Hematol. Oncol. 2020, 13, 104. [Google Scholar] [CrossRef]
- Yan, F.; Shen, N.; Pang, J.; Xie, D.; Deng, B.; Molina, J.R.; Yang, P.; Liu, S. Restoration of miR-101 suppresses lung tumorigenesis through inhibition of DNMT3a-dependent DNA methylation. Cell Death Dis. 2014, 5, e1413. [Google Scholar] [CrossRef]
- Xu, L.; Lan, H.; Su, Y.; Li, J.; Wan, J. Clinicopathological significance and potential drug target of RUNX3 in non-small cell lung cancer: A meta-analysis. Drug Des. Devel Ther. 2015, 9, 2855–2865. [Google Scholar] [CrossRef]
- Fujii, S.; Ito, K.; Ito, Y.; Ochiai, A. Enhancer of zeste homologue 2 (EZH2) down-regulates RUNX3 by increasing histone H3 methylation. J. Biol. Chem. 2008, 283, 17324–17332. [Google Scholar] [CrossRef] [PubMed]
- Kodach, L.L.; Jacobs, R.J.; Heijmans, J.; van Noesel, C.J.; Langers, A.M.; Verspaget, H.W.; Hommes, D.W.; Offerhaus, G.J.; van den Brink, G.R.; Hardwick, J.C. The role of EZH2 and DNA methylation in the silencing of the tumour suppressor RUNX3 in colorectal cancer. Carcinogenesis 2010, 31, 1567–1575. [Google Scholar] [CrossRef]
- Ciavatta, D.J.; Yang, J.; Preston, G.A.; Badhwar, A.K.; Xiao, H.; Hewins, P.; Nester, C.M.; Pendergraft, W.F., 3rd; Magnuson, T.R.; Jennette, J.C.; et al. Epigenetic basis for aberrant upregulation of autoantigen genes in humans with ANCA vasculitis. J. Clin. Investig. 2010, 120, 3209–3219. [Google Scholar] [CrossRef] [PubMed]
- Veith, M.; McAlarney, D.; Xue, X.; Rohan, T.E.; Hosgood, H.D., 3rd. Characterizing Trends in Lung Cancer Mortality Attributable to Airborne Environmental Carcinogens. Int. J. Environ. Res. Public. Health 2021, 18, 13162. [Google Scholar] [CrossRef]
- Reddy, M.V.; Randerath, K. Nuclease P1-mediated enhancement of sensitivity of 32P-postlabeling test for structurally diverse DNA adducts. Carcinogenesis 1986, 7, 1543–1551. [Google Scholar] [CrossRef]
- Zhou, G.D.; Hernandez, N.S.; Randerath, E.; Randerath, K. Acute elevation by short-term dietary restriction or food deprivation of type I I-compound levels in rat liver DNA. Nutr. Cancer 1999, 35, 87–95. [Google Scholar] [CrossRef]
- Gupta, R.C. Nonrandom binding of the carcinogen N-hydroxy-2-acetylaminofluorene to repetitive sequences of rat liver DNA in vivo. Proc. Natl. Acad. Sci. USA 1984, 81, 6943–6947. [Google Scholar] [CrossRef]
- Randerath, K.; Reddy, M.V.; Gupta, R.C. 32P-labeling test for DNA damage. Proc. Natl. Acad. Sci. USA 1981, 78, 6126–6129. [Google Scholar] [CrossRef] [PubMed]
- Zhu, H.; Cabrera, R.M.; Wlodarczyk, B.J.; Bozinov, D.; Wang, D.; Schwartz, R.J.; Finnell, R.H. Differentially expressed genes in embryonic cardiac tissues of mice lacking Folr1 gene activity. BMC Dev. Biol. 2007, 7, 128. [Google Scholar] [CrossRef]
- Zhou, G.D.; Randerath, K.; Donnelly, K.C.; Jaiswal, A.K. Effects of NQO1 deficiency on levels of cyclopurines and other oxidative DNA lesions in liver and kidney of young mice. Int. J. Cancer 2004, 112, 877–883. [Google Scholar] [CrossRef] [PubMed]
- Randerath, K.; Randerath, E.; Zhou, G.D.; Supunpong, N.; He, L.Y.; McDonald, T.J.; Donnelly, K.C. Genotoxicity of complex PAH mixtures recovered from contaminated lake sediments as assessed by three different methods. Environ. Mol. Mutagen. 1999, 33, 303–312. [Google Scholar] [CrossRef]
- Zhou, G.D.; Popovic, N.; Lupton, J.R.; Turner, N.D.; Chapkin, R.S.; Donnelly, K.C. Tissue-specific attenuation of endogenous DNA I-compounds in rats by carcinogen azoxymethane: Possible role of dietary fish oil in colon cancer prevention. Cancer Epidemiol. Biomarkers Prev. 2005, 14, 1230–1235. [Google Scholar] [CrossRef][Green Version]
- Mabon, N.; Moorthy, B.; Randerath, E.; Randerath, K. Monophosphate 32P-postlabeling assay of DNA adducts from 1,2:3,4-diepoxybutane, the most genotoxic metabolite of 1,3-butadiene: In vitro methodological studies and in vivo dosimetry. Mutat. Res. 1996, 371, 87–104. [Google Scholar] [CrossRef]
- Zar, J.H. Biostatistical Analysis, 5th ed.; Prentice-Hall: Saddle River, NJ, USA, 2009. [Google Scholar]
Ingredients | CO | FO | EPA | DHA | EPA + DHA |
---|---|---|---|---|---|
Dextrose | 54.06 | 54.06 | 54.06 | 54.06 | 54.06 |
Casein | 26.35 | 26.35 | 26.35 | 26.35 | 26.35 |
DL-Methionine | 0.34 | 0.34 | 0.34 | 0.34 | 0.34 |
Corn Oil (CO) | 5.00 | 0 | 4.99 | 4.99 | 4.75 |
Fish Oil * | 0 | 5.00 | 0 | 0 | 0 |
EPA | 0 | 0 | 0.075 | 0 | 0.08 |
DHA | 0 | 0 | 0 | 0.05 | 0.05 |
Mineral mix, AIN-76 (Harlan Teklad) | 3.91 | 3.91 | 3.91 | 3.91 | 3.91 |
Vitamin mix, AIN 76-A (Harlan Teklad) | 1.12 | 1.12 | 1.12 | 1.12 | 1.12 |
Choline bitartrate | 0.22 | 0.22 | 0.22 | 0.22 | 0.22 |
Pectin | 9.00 | 9.00 | 9.00 | 9.00 | 9.00 |
Gene Name | Forword | Reverse |
---|---|---|
Runx3 | ACCACGAGCCACTTCAGCAG | CGATGGTGTGGCGCTGTA |
DNMT1 | CCA AGC TCC GGA CCC TGG ATG TGT | CGA GGC CGG TAG TAG TCA CA G TAG |
DNMT 3a | CGACCCATGCCAAGACTCACCTTCCAG | AGACTCTCCAGAGGCCTGGT |
Ezh2 | CTAATTGGTACTTACTACGATAACTTT | ACTCTAAACTCATACACCTGTCTACAT |
miRNA 17 | TGTCAAAGTGCTTACAGTGCAG | GCATAATGCTACAAGTGCCCTC |
miRNA 19b-1 | AGTTTTGCAGGTTTGCATCC | CCACCACAGTCAGTTTTGCAT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xia, G.; Zhou, G.; Jiang, W.; Chu, C.; Wang, L.; Moorthy, B. Attenuation of Polycyclic Aromatic Hydrocarbon (PAH)-Induced Carcinogenesis and Tumorigenesis by Omega-3 Fatty Acids in Mice In Vivo. Int. J. Mol. Sci. 2024, 25, 3781. https://doi.org/10.3390/ijms25073781
Xia G, Zhou G, Jiang W, Chu C, Wang L, Moorthy B. Attenuation of Polycyclic Aromatic Hydrocarbon (PAH)-Induced Carcinogenesis and Tumorigenesis by Omega-3 Fatty Acids in Mice In Vivo. International Journal of Molecular Sciences. 2024; 25(7):3781. https://doi.org/10.3390/ijms25073781
Chicago/Turabian StyleXia, Guobin, Guodong Zhou, Weiwu Jiang, Chun Chu, Lihua Wang, and Bhagavatula Moorthy. 2024. "Attenuation of Polycyclic Aromatic Hydrocarbon (PAH)-Induced Carcinogenesis and Tumorigenesis by Omega-3 Fatty Acids in Mice In Vivo" International Journal of Molecular Sciences 25, no. 7: 3781. https://doi.org/10.3390/ijms25073781
APA StyleXia, G., Zhou, G., Jiang, W., Chu, C., Wang, L., & Moorthy, B. (2024). Attenuation of Polycyclic Aromatic Hydrocarbon (PAH)-Induced Carcinogenesis and Tumorigenesis by Omega-3 Fatty Acids in Mice In Vivo. International Journal of Molecular Sciences, 25(7), 3781. https://doi.org/10.3390/ijms25073781