On the Possible Effect of Phytic Acid (Myo-Inositol Hexaphosphoric Acid, IP6) on Cytochromes P450 and Systems of Xenobiotic Metabolism in Different Hepatic Models
Abstract
1. Introduction
2. Results
2.1. Difference Spectra Indicate an Interaction of IP6 with the Human Liver Microsomal Fraction (HLM) CYP
2.2. IP6 Does Bind to CYP1A2 According to Molecular Docking
2.3. IP6 Does Not Directly Decrease the Enzyme Activity of CYP1A1/2 in the HLM; However, It Can Increase the mRNA Level and Activity of CYP1A1/2 in Primary Human Hepatocytes (PHH) and HepG2 Cells
2.4. IP6 Does Not Activate AhR
3. Discussion
4. Materials and Methods
4.1. Chemicals
4.2. Human Liver Microsomal Fractions (HLMs)
4.3. Spectroscopic Study of Interaction of IP6 with Human Microsomal CYP Enzymes
4.4. Molecular Docking of IP6 to Structure of CYP1A2
4.5. Effect of IP6 on CYP1A1/2 Activity in the HLM
4.6. Human Liver Samples and Preparation of Primary Human Hepatocytes (PHHs)
4.7. Cell Cultures
4.8. RNA Isolation and PCR
4.9. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Humer, E.; Schwarz, C.; Schedle, K. Phytate in pig and poultry nutrition. J. Anim. Physiol. Anim. Nutr. 2015, 99, 605–625. [Google Scholar] [CrossRef]
- Brinch-Pedersen, H.; Madsen, C.K.; Holme, I.B.; Dionisio, G. Increased understanding of the cereal phytase complement for better mineral bio-availability and resource management. J. Cereal Sci. 2014, 59, 373–381. [Google Scholar] [CrossRef]
- Iqbal, T.H.; Lewis, K.O.; Cooper, B.T. Phytase activity in the human and rat small intestine. Gut 1994, 35, 1233–1236. [Google Scholar] [CrossRef]
- Kumar, A.; Singh, B.; Raigond, P.; Sahu, C.; Mishra, U.N.; Sharma, S.; Lal, M.K. Phytic acid: Blessing in disguise, a prime compound required for both plant and human nutrition. Food Res. Int. 2021, 142, 110193. [Google Scholar] [CrossRef] [PubMed]
- Ran, X.; Hu, G.; He, F.; Li, K.; Li, F.; Xu, D.; Liu, J.; Fu, S. Phytic acid improves hepatic steatosis, inflammation, and oxidative stress in high-fat diet (HFD)-fed mice by modulating the gut-liver axis. J. Agric. Food Chem. 2022, 70, 11401–11411. [Google Scholar] [CrossRef] [PubMed]
- Brehm, M.A.; Windhorst, S. New options of cancer treatment employing InsP6. Biochem. Pharmacol. 2019, 163, 206–214. [Google Scholar] [CrossRef] [PubMed]
- Chakkour, M.; Greenberg, M.L. Insights into the roles of inositol hexakisphosphate kinase (IP6K1) in mammalian cellular processes. J. Biol. Chem. 2024, 107116. [Google Scholar] [CrossRef] [PubMed]
- Anzenbacher, P.; Anzenbacherová, E. Cytochromes P450 and metabolism of xenobiotics. Cell Mol. Life Sci. 2001, 58, 737–747. [Google Scholar] [CrossRef] [PubMed]
- Guengerich, F.P. Human Cytochrome P450 Enzymes. In Cytochrome P450: Structure, Mechanism, and Biochemistry; Ortiz de Montellano, P.R., Ed.; Springer: Boston, MA, USA, 2005; pp. 377–530. [Google Scholar] [CrossRef]
- Zanger, U.M.; Schwab, M. Cytochrome P450 enzymes in drug metabolism: Regulation of gene expression, enzyme activities, and impact of genetic variation. Pharmacol. Ther. 2013, 138, 103–141. [Google Scholar] [CrossRef] [PubMed]
- Santes-Palacios, R.; Ornelas-Ayala, D.; Cabañas, N.; Marroquín-Pérez, A.; Hernández-Magaña, A.; Del Rosario Olguín-Reyes, S.; Camacho-Carranza, R.; Espinosa-Aguirre, J.J. Regulation of Human Cytochrome P4501A1 (hCYP1A1): A Plausible Target for Chemoprevention? Biomed Res. Int. 2016, 2016, 5341081. [Google Scholar] [CrossRef]
- Chen, Y.; Zeng, L.; Wang, Y.; Tolleson, W.H.; Knox, B.; Chen, S.; Ren, Z.; Guo, L.; Mei, N.; Qian, F.; et al. The expression, induction and pharmacological activity of CYP1A2 are post-transcriptionally regulated by microRNA hsa-miR-132-5p. Biochem. Pharmacol. 2017, 145, 178–191. [Google Scholar] [CrossRef]
- Jourova, L.; Anzenbacherova, E.; Dostal, Z.; Anzenbacher, P.; Briolotti, P.; Rigal, E.; Daujat-Chavanieu, M.; Gerbal-Chaloin, S. Butyrate, a typical product of gut microbiome, affects function of the AhR gene, being a possible agent of crosstalk between gut microbiome, and hepatic drug metabolism. J. Nutr. Biochem. 2022, 107, 109042. [Google Scholar] [CrossRef] [PubMed]
- Srovnalova, A.; Vanduchova, A.; Svecarova, M.; Anzenbacherova, E.; Tomankova, V.; Anzenbacher, P.; Dvorak, Z. Effects of sulforaphane and its S- and R-enantiomers on the expression and activities of human drug-metabolizing cytochromes P450. J. Funct. Foods 2015, 14, 487–501. [Google Scholar] [CrossRef]
- Guengerich, F.P. Inhibition of cytochrome P450 enzymes by drugs-molecular basis and practical applications. Biomol. Ther. 2022, 30, 1–18. [Google Scholar] [CrossRef] [PubMed]
- Schenkman, J.B.; Jansson, I. Spectral analyses of cytochromes P450. Methods Mol. Biol. 2006, 320, 11–18. [Google Scholar] [CrossRef] [PubMed]
- Kumaki, K.; Sato, M.; Kon, H.; Nebert, D.W. Correlation of type I, type II, and reverse type I difference spectra with absolute changes in spin state of hepatic microsomal cytochrome P-450 iron from five mammalian species. J. Biol. Chem. 1978, 253, 1048–1058. [Google Scholar] [CrossRef] [PubMed]
- Schenkman, J.B.; Cinti, D.L.; Orrenius, S.; Moldeus, P.; Kraschnitz, R. The nature of the reverse type I (modified type II) spectral change in liver microsomes. Biochemistry 1972, 11, 4243–4251. [Google Scholar] [CrossRef] [PubMed]
- Chang, T.K.; Waxman, D.J. Enzymatic analysis of cDNA-expressed human CYP1A1, CYP1A2, and CYP1B1 with 7-ethoxyresorufin as substrate. Methods Mol. Biol. 2006, 320, 85–90. [Google Scholar] [CrossRef]
- Miller, K.P.; Ramos, K.S. Impact of cellular metabolism on the biological effects of benzo[a]pyrene and related hydrocarbons. Drug Metab. Rev. 2001, 33, 1–35. [Google Scholar] [CrossRef]
- Frybortova, V.S.S.; Jourova, L.; Anzenbacher, P.; Anzenbacherova, E. Phytic acid. In Proceedings of the Kvetina Day, Interdisciplinary Conference of Young Pharmacologists and Toxicologists, Brno, Czech Republic, 25 May 2023; Abstract Book. ISBN 978-80280-0305-0. [Google Scholar]
- Safe, S.; Jayaraman, A.; Chapkin, R.S. Ah receptor ligands and their impacts on gut resilience: Structure-activity effects. Crit. Rev. Toxicol 2020, 50, 463–473. [Google Scholar] [CrossRef]
- Jefcoate, C.R. Measurement of substrate and inhibitor binding to microsomal cytochrome P-450 by optical-difference spectroscopy. Methods Enzymol. 1978, 52, 258–279. [Google Scholar] [CrossRef]
- Wang, R.; Guo, S. Phytic acid and its interactions: Contributions to protein functionality, food processing, and safety. Compr. Rev. Food Sci. Food Saf. 2021, 20, 2081–2105. [Google Scholar] [CrossRef]
- Šrejber, M.; Navrátilová, V.; Paloncýová, M.; Bazgier, V.; Berka, K.; Anzenbacher, P.; Otyepka, M. Membrane-attached mammalian cytochromes P450: An overview of the membrane’s effects on structure, drug binding, and interactions with redox partners. J. Inorg. Biochem. 2018, 183, 117–136. [Google Scholar] [CrossRef]
- Irvine, R.F. Inositide evolution-towards turtle domination? J. Physiol. 2005, 566, 295–300. [Google Scholar] [CrossRef]
- Shamsuddin, A.M. Metabolism and cellular functions of IP6: A review. Anticancer Res. 1999, 19, 3733–3736. [Google Scholar] [PubMed]
- Stuart, J.A.; Anderson, K.L.; French, P.J.; Kirk, C.J.; Michell, R.H. The intracellular distribution of inositol polyphosphates in HL60 promyeloid cells. Biochem. J. 1994, 303, 517–525. [Google Scholar] [CrossRef] [PubMed]
- Gerbal-Chaloin, S.; Dumé, A.S.; Briolotti, P.; Klieber, S.; Raulet, E.; Duret, C.; Fabre, J.M.; Ramos, J.; Maurel, P.; Daujat-Chavanieu, M. The WNT/β-catenin pathway is a transcriptional regulator of CYP2E1, CYP1A2, and aryl hydrocarbon receptor gene expression in primary human hepatocytes. Mol. Pharmacol. 2014, 86, 624–634. [Google Scholar] [CrossRef] [PubMed]
- Xu, L.; Li, A.P.; Kaminski, D.L.; Ruh, M.F. 2,3,7,8 Tetrachlorodibenzo-p-dioxin induction of cytochrome P4501A in cultured rat and human hepatocytes. Chem. Biol. Interact. 2000, 124, 173–189. [Google Scholar] [CrossRef] [PubMed]
- Guo, L.; Dial, S.; Shi, L.; Branham, W.; Liu, J.; Fang, J.L.; Green, B.; Deng, H.; Kaput, J.; Ning, B. Similarities and differences in the expression of drug-metabolizing enzymes between human hepatic cell lines and primary human hepatocytes. Drug Metab. Dispos. 2011, 39, 528–538. [Google Scholar] [CrossRef] [PubMed]
- Beedanagari, S.R.; Bebenek, I.; Bui, P.; Hankinson, O. Resveratrol inhibits dioxin-induced expression of human CYP1A1 and CYP1B1 by inhibiting recruitment of the aryl hydrocarbon receptor complex and RNA polymerase II to the regulatory regions of the corresponding genes. Toxicol. Sci. 2009, 110, 61–67. [Google Scholar] [CrossRef] [PubMed]
- Murphy, K.A.; Villano, C.M.; Dorn, R.; White, L.A. Interaction between the aryl hydrocarbon receptor and retinoic acid pathways increases matrix metalloproteinase-1 expression in keratinocytes. J. Biol. Chem. 2004, 279, 25284–25293. [Google Scholar] [CrossRef] [PubMed]
- Gupta, R.C.; Lall, R.; Srivastava, A. Index. In Nutraceuticals, 2nd ed.; Academic Press: Cambridge, MA, USA, 2021; pp. 1321–1363. [Google Scholar] [CrossRef]
- Vanduchova, A.; Tomankova, V.; Anzenbacher, P.; Anzenbacherova, E. Influence of sulforaphane metabolites on activities of human drug-metabolizing cytochrome P450 and determination of sulforaphane in human liver cells. J. Med. Food 2016, 19, 1141–1146. [Google Scholar] [CrossRef] [PubMed]
- Schenkman, J.B.; Remmer, H.; Estabrook, R.W. Spectral studies of drug interaction with hepatic microsomal cytochrome. Mol. Pharmacol. 1967, 3, 113–123. [Google Scholar] [PubMed]
- Locuson, C.W.; Hutzler, J.M.; Tracy, T.S. Visible spectra of type II cytochrome P450-drug complexes: Evidence that "incomplete" heme coordination is common. Drug Metab. Dispos. 2007, 35, 614–622. [Google Scholar] [CrossRef] [PubMed]
- Kumar, V.; Wahlstrom, J.L.; Rock, D.A.; Warren, C.J.; Gorman, L.A.; Tracy, T.S. CYP2C9 inhibition: Impact of probe selection and pharmacogenetics on in vitro inhibition profiles. Drug Metab. Dispos. 2006, 34, 1966–1975. [Google Scholar] [CrossRef] [PubMed]
- Tornio, A.; Backman, J.T. Cytochrome P450 in Pharmacogenetics: An Update. Adv. Pharmacol. 2018, 83, 3–32. [Google Scholar] [CrossRef] [PubMed]
- Delescluse, C.; Lemaire, G.; de Sousa, G.; Rahmani, R. Is CYP1A1 induction always related to AHR signaling pathway? Toxicology 2000, 153, 73–82. [Google Scholar] [CrossRef]
- Vrba, J.; Vrublova, E.; Modriansky, M.; Ulrichova, J. Protopine and allocryptopine increase mRNA levels of cytochromes P450 1A in human hepatocytes and HepG2 cells independently of AhR. Toxicol. Lett. 2011, 203, 135–141. [Google Scholar] [CrossRef]
- Monostory, K.; Pascussi, J.M.; Kóbori, L.; Dvorak, Z. Hormonal regulation of CYP1A expression. Drug Metab. Rev. 2009, 41, 547–572. [Google Scholar] [CrossRef]
- Pandey, M.; Gupta, K.P. Epigenetics, an early event in the modulation of gene expression by inositol hexaphosphate in ethylnitrosourea exposed mouse lungs. Nutr. Cancer 2011, 63, 89–99. [Google Scholar] [CrossRef]
- Watson, P.J.; Millard, C.J.; Riley, A.M.; Robertson, N.S.; Wright, L.C.; Godage, H.Y.; Cowley, S.M.; Jamieson, A.G.; Potter, B.V.; Schwabe, J.W. Insights into the activation mechanism of class I HDAC complexes by inositol phosphates. Nat. Commun. 2016, 7, 11262. [Google Scholar] [CrossRef] [PubMed]
- Wu, S.E.; Hashimoto-Hill, S.; Woo, V.; Eshleman, E.M.; Whitt, J.; Engleman, L.; Karns, R.; Denson, L.A.; Haslam, D.B.; Alenghat, T. Microbiota-derived metabolite promotes HDAC3 activity in the gut. Nature 2020, 586, 108–112. [Google Scholar] [CrossRef] [PubMed]
- Green, E.S.; Zangerl, A.R.; Berenbaum, M.R. Effects of phytic acid and xanthotoxin on growth and detoxification in caterpillars. J. Chem. Ecol. 2001, 27, 1763–1773. [Google Scholar] [CrossRef] [PubMed]
- Lake, B.G. Preparation and characterization of microsomal fractions for studies on xenobiotic metabolism. In Biochemical Toxicology, A Practical Approach; BMK, S., Ed.; Oxford University Press: Oxford, UK, 1987; pp. 183–215. [Google Scholar]
- Omura, T.; Sato, R. The carbon monoxide-binding pigment of liver microsomes. I. evidence for its hemoprotein nature. J. Biol. Chem. 1964, 239, 2370–2378. [Google Scholar] [CrossRef] [PubMed]
- Sansen, S.; Yano, J.K.; Reynald, R.L.; Schoch, G.A.; Griffin, K.J.; Stout, C.D.; Johnson, E.F. Adaptations for the oxidation of polycyclic aromatic hydrocarbons exhibited by the structure of human P450 1A2. J. Biol. Chem. 2007, 282, 14348–14355. [Google Scholar] [CrossRef]
- Eswar, N.; Webb, B.; Marti-Renom, M.A.; Madhusudhan, M.S.; Eramian, D.; Shen, M.Y.; Pieper, U.; Sali, A. Comparative protein structure modeling using Modeller. Curr. Protoc. Bioinform. 2006, 5, Unit-5.6. [Google Scholar] [CrossRef]
- Pettersen, E.F.; Goddard, T.D.; Huang, C.C.; Couch, G.S.; Greenblatt, D.M.; Meng, E.C.; Ferrin, T.E. UCSF Chimera—A visualization system for exploratory research and analysis. J. Comput. Chem. 2004, 25, 1605–1612. [Google Scholar] [CrossRef]
- Morris, G.M.; Huey, R.; Lindstrom, W.; Sanner, M.F.; Belew, R.K.; Goodsell, D.S.; Olson, A.J. AutoDock4 and AutoDockTools4: Automated docking with selective receptor flexibility. J. Comput. Chem. 2009, 30, 2785–2791. [Google Scholar] [CrossRef]
- Trott, O.; Olson, A.J. AutoDock Vina: Improving the speed and accuracy of docking with a new scoring function, efficient optimization, and multithreading. J. Comput. Chem. 2010, 31, 455–461. [Google Scholar] [CrossRef]
- Isom, H.C.; Secott, T.; Georgoff, I.; Woodworth, C.; Mummaw, J. Maintenance of differentiated rat hepatocytes in primary culture. Proc. Natl. Acad. Sci. USA 1985, 82, 3252–3256. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔC(T) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
Liver Identification | Gender | Age | Pathology |
---|---|---|---|
Liv1 | Man | 58 | Hepatocellular carcinoma |
Liv2 | Man | 80 | Organ donor |
LH93 | Man | 56 | Organ donor |
LH94 | Woman | 78 | Organ donor |
LH95 | Woman | 79 | Organ donor |
Gene | Forward Primer | Reverse Primer |
---|---|---|
RPLP0 | TCGACAATGGCAGCATCTAC | GCCTTGACCTTTTCAGCAAG |
AhR | GTCGTCTAAGGTGTCTGCTGGA | CGCAAACAAAGCCAACTGAGGTG |
AhRR | TGACCTTGTCCTTGACCC | CCATCCTCACTGTGCTTTC |
CYP1A1 | TCCGGGACATCACAGACAGC | ACCCTGGGGTTCATCACCAA |
CYP1A2 | CATCCCCCACAGCACAACAA | TCCCACTTGGCCAGGACTTC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Frybortova, V.; Satka, S.; Jourova, L.; Zapletalova, I.; Srejber, M.; Briolotti, P.; Daujat-Chavanieu, M.; Gerbal-Chaloin, S.; Anzenbacher, P.; Otyepka, M.; et al. On the Possible Effect of Phytic Acid (Myo-Inositol Hexaphosphoric Acid, IP6) on Cytochromes P450 and Systems of Xenobiotic Metabolism in Different Hepatic Models. Int. J. Mol. Sci. 2024, 25, 3610. https://doi.org/10.3390/ijms25073610
Frybortova V, Satka S, Jourova L, Zapletalova I, Srejber M, Briolotti P, Daujat-Chavanieu M, Gerbal-Chaloin S, Anzenbacher P, Otyepka M, et al. On the Possible Effect of Phytic Acid (Myo-Inositol Hexaphosphoric Acid, IP6) on Cytochromes P450 and Systems of Xenobiotic Metabolism in Different Hepatic Models. International Journal of Molecular Sciences. 2024; 25(7):3610. https://doi.org/10.3390/ijms25073610
Chicago/Turabian StyleFrybortova, Veronika, Stefan Satka, Lenka Jourova, Iveta Zapletalova, Martin Srejber, Philippe Briolotti, Martine Daujat-Chavanieu, Sabine Gerbal-Chaloin, Pavel Anzenbacher, Michal Otyepka, and et al. 2024. "On the Possible Effect of Phytic Acid (Myo-Inositol Hexaphosphoric Acid, IP6) on Cytochromes P450 and Systems of Xenobiotic Metabolism in Different Hepatic Models" International Journal of Molecular Sciences 25, no. 7: 3610. https://doi.org/10.3390/ijms25073610
APA StyleFrybortova, V., Satka, S., Jourova, L., Zapletalova, I., Srejber, M., Briolotti, P., Daujat-Chavanieu, M., Gerbal-Chaloin, S., Anzenbacher, P., Otyepka, M., & Anzenbacherova, E. (2024). On the Possible Effect of Phytic Acid (Myo-Inositol Hexaphosphoric Acid, IP6) on Cytochromes P450 and Systems of Xenobiotic Metabolism in Different Hepatic Models. International Journal of Molecular Sciences, 25(7), 3610. https://doi.org/10.3390/ijms25073610