Co-Culture of P. gingivalis and F. nucleatum Synergistically Elevates IL-6 Expression via TLR4 Signaling in Oral Keratinocytes
Abstract
1. Introduction
2. Results
2.1. Standardizing the Culture Conditions and Characterizing the Co-Culture of P. gingivalis and F. nucleatum
2.2. The Co-Culture of P. gingivalis and F. nucleatum Synergistically Increases the Expressions of Pro-Inflammatory Cytokines in OKs
2.3. The Co-Culture of P. gingivalis and F. nucleatum Increases NF-kB Phosphorylation in Oral Keratinocytes
2.4. The Co-Culture of P. gingivalis and F. nucleatum Promotes the Nuclear Translocation of NF-kB
2.5. The Co-Culture of P. gingivalis and F. nucleatum Increases the Migration of Infected OKs
2.6. The Co-Culture of P. gingivalis and F. nucleatum Does Not Affect TLR4 Levels
2.7. The Roles of TLR4 in Pro-Inflammatory Cytokine Expression and Cell Migration
3. Discussion
4. Materials and Methods
4.1. Bacterial Strains and Monoculture Conditions
4.2. Bacterial Co-Culture Conditions
4.3. Colony-Forming-Unit Assay (CFU/mL)
4.4. Cell Line and Culture Conditions
4.5. TLR4 Knockdown
4.6. Infection and Co-Incubation of P. gingivalis and F. nucleatum
4.7. Scanning Electron Microscopy (SEM)
4.8. MTS Cell Viability Assay
4.9. Western Blot Assay
4.10. Genomic DNA Purification (gDNA)
4.11. Immunofluorescence Assay
4.12. Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)
4.13. Migration Assays
4.14. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Larsson, L.; Kavanagh, N.M.; Nguyen, T.V.N.; Castilho, R.M.; Berglundh, T.; Giannobile, W.V. Influence of epigenetics on periodontitis and peri-implantitis pathogenesis. Periodontol. 2000 2022, 90, 125–137. [Google Scholar] [CrossRef]
- Papapanou, P.N.; Susin, C. Periodontitis epidemiology: Is periodontitis under-recognized, over-diagnosed, or both? Periodontol. 2000 2017, 75, 45–51. [Google Scholar] [CrossRef]
- Abusleme, L.; Dupuy, A.K.; Dutzan, N.; Silva, N.; Burleson, J.A.; Strausbaugh, L.D.; Gamonal, J.; Diaz, P.I. The subgingival microbiome in health and periodontitis and its relationship with community biomass and inflammation. ISME J. 2013, 7, 1016–1025. [Google Scholar] [CrossRef]
- Ferlay, J.; Colombet, M.; Soerjomataram, I.; Mathers, C.; Parkin, D.M.; Pineros, M.; Znaor, A.; Bray, F. Estimating the global cancer incidence and mortality in 2018: GLOBOCAN sources and methods. Int. J. Cancer 2019, 144, 1941–1953. [Google Scholar] [CrossRef]
- Ye, L.; Jiang, Y.; Liu, W.; Tao, H. Correlation between periodontal disease and oral cancer risk: A meta-analysis. J. Cancer Res. Ther. 2016, 12, C237–C240. [Google Scholar] [CrossRef]
- La Rosa, G.R.M.; Gattuso, G.; Pedulla, E.; Rapisarda, E.; Nicolosi, D.; Salmeri, M. Association of oral dysbiosis with oral cancer development. Oncol. Lett. 2020, 19, 3045–3058. [Google Scholar] [CrossRef] [PubMed]
- Hu, X.; Zhang, Q.; Hua, H.; Chen, F. Changes in the salivary microbiota of oral leukoplakia and oral cancer. Oral Oncol. 2016, 56, e6–e8. [Google Scholar] [CrossRef] [PubMed]
- Yilmaz, O.; Verbeke, P.; Lamont, R.J.; Ojcius, D.M. Intercellular spreading of Porphyromonas gingivalis infection in primary gingival epithelial cells. Infect. Immun. 2006, 74, 703–710. [Google Scholar] [CrossRef] [PubMed]
- Fiorillo, L.; Cervino, G.; Laino, L.; D’Amico, C.; Mauceri, R.; Tozum, T.F.; Gaeta, M.; Cicciu, M. Porphyromonas gingivalis, Periodontal and Systemic Implications: A Systematic Review. Dent. J. 2019, 7, 114. [Google Scholar] [CrossRef] [PubMed]
- Hajishengallis, G.; Liang, S.; Payne, M.A.; Hashim, A.; Jotwani, R.; Eskan, M.A.; McIntosh, M.L.; Alsam, A.; Kirkwood, K.L.; Lambris, J.D.; et al. Low-abundance biofilm species orchestrates inflammatory periodontal disease through the commensal microbiota and complement. Cell Host Microbe 2011, 10, 497–506. [Google Scholar] [CrossRef]
- Lunar Silva, I.; Cascales, E. Molecular Strategies Underlying Porphyromonas gingivalis Virulence. J. Mol. Biol. 2021, 433, 166836. [Google Scholar] [CrossRef]
- Lafuente Ibanez de Mendoza, I.; Maritxalar Mendia, X.; Garcia de la Fuente, A.M.; Quindos Andres, G.; Aguirre Urizar, J.M. Role of Porphyromonas gingivalis in oral squamous cell carcinoma development: A systematic review. J. Periodontal Res. 2020, 55, 13–22. [Google Scholar] [CrossRef]
- Jia, L.; Han, N.; Du, J.; Guo, L.; Luo, Z.; Liu, Y. Pathogenesis of Important Virulence Factors of Porphyromonas gingivalis via Toll-Like Receptors. Front. Cell. Infect. Microbiol. 2019, 9, 262. [Google Scholar] [CrossRef]
- Park, J.; Shokeen, B.; Haake, S.K.; Lux, R. Characterization of Fusobacterium nucleatum ATCC 23726 adhesins involved in strain-specific attachment to Porphyromonas gingivalis. Int. J. Oral Sci. 2016, 8, 138–144. [Google Scholar] [CrossRef]
- Tan, K.H.; Seers, C.A.; Dashper, S.G.; Mitchell, H.L.; Pyke, J.S.; Meuric, V.; Slakeski, N.; Cleal, S.M.; Chambers, J.L.; McConville, M.J.; et al. Porphyromonas gingivalis and Treponema denticola exhibit metabolic symbioses. PLoS Pathog. 2014, 10, e1003955. [Google Scholar] [CrossRef] [PubMed]
- Soto, C.; Rojas, V.; Yanez, L.; Hidalgo, A.; Olivera, M.; Pacheco, M.; Venegas, D.; Salinas, D.; Bravo, D.; Quest, A.F.G. Porphyromonas gingivalis-Helicobacter pylori co-incubation enhances Porphyromonas gingivalis virulence and increases migration of infected human oral keratinocytes. J. Oral Microbiol. 2022, 14, 2107691. [Google Scholar] [CrossRef] [PubMed]
- Bradshaw, D.J.; Marsh, P.; Watson, G.K.; Allison, C. Role of Fusobacterium nucleatum and coaggregation in anaerobe survival in planktonic and biofilm oral microbial communities during aeration. Infect. Immun. 1998, 66, 4729–4732. [Google Scholar] [CrossRef] [PubMed]
- Brennan, C.A.; Garrett, W.S. Fusobacterium nucleatum—Symbiont, opportunist and oncobacterium. Nat. Rev. Microbiol. 2019, 17, 156–166. [Google Scholar] [CrossRef] [PubMed]
- Kuboniwa, M.; Hendrickson, E.L.; Xia, Q.; Wang, T.; Xie, H.; Hackett, M.; Lamont, R.J. Proteomics of Porphyromonas gingivalis within a model oral microbial community. BMC Microbiol. 2009, 9, 98. [Google Scholar] [CrossRef] [PubMed]
- Yoshioka, H.; Yoshimura, A.; Kaneko, T.; Golenbock, D.T.; Hara, Y. Analysis of the activity to induce toll-like receptor (TLR)2- and TLR4-mediated stimulation of supragingival plaque. J. Periodontol. 2008, 79, 920–928. [Google Scholar] [CrossRef] [PubMed]
- Al-Qutub, M.N.; Braham, P.H.; Karimi-Naser, L.M.; Liu, X.; Genco, C.A.; Darveau, R.P. Hemin-dependent modulation of the lipid A structure of Porphyromonas gingivalis lipopolysaccharide. Infect. Immun. 2006, 74, 4474–4485. [Google Scholar] [CrossRef]
- Okuda, T.; Kokubu, E.; Kawana, T.; Saito, A.; Okuda, K.; Ishihara, K. Synergy in biofilm formation between Fusobacterium nucleatum and Prevotella species. Anaerobe 2012, 18, 110–116. [Google Scholar] [CrossRef]
- Saito, A.; Inagaki, S.; Kimizuka, R.; Okuda, K.; Hosaka, Y.; Nakagawa, T.; Ishihara, K. Fusobacterium nucleatum enhances invasion of human gingival epithelial and aortic endothelial cells by Porphyromonas gingivalis. FEMS Immunol. Med. Microbiol. 2008, 54, 349–355. [Google Scholar] [CrossRef] [PubMed]
- Mountcastle, S.E.; Cox, S.C.; Sammons, R.L.; Jabbari, S.; Shelton, R.M.; Kuehne, S.A. A review of co-culture models to study the oral microenvironment and disease. J. Oral Microbiol. 2020, 12, 1773122. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.H.; Baek, D.H. Characteristics of Porphyromonas gingivalis lipopolysaccharide in co-culture with Fusobacterium nucleatum. Mol. Oral Microbiol. 2013, 28, 230–238. [Google Scholar] [CrossRef] [PubMed]
- Polak, D.; Wilensky, A.; Shapira, L.; Halabi, A.; Goldstein, D.; Weiss, E.I.; Houri-Haddad, Y. Mouse model of experimental periodontitis induced by Porphyromonas gingivalis/Fusobacterium nucleatum infection: Bone loss and host response. J. Clin. Periodontol. 2009, 36, 406–410. [Google Scholar] [CrossRef] [PubMed]
- Binder Gallimidi, A.; Fischman, S.; Revach, B.; Bulvik, R.; Maliutina, A.; Rubinstein, A.M.; Nussbaum, G.; Elkin, M. Periodontal pathogens Porphyromonas gingivalis and Fusobacterium nucleatum promote tumor progression in an oral-specific chemical carcinogenesis model. Oncotarget 2015, 6, 22613–22623. [Google Scholar] [CrossRef] [PubMed]
- Ramadan, D.E.; Hariyani, N.; Indrawati, R.; Ridwan, R.D.; Diyatri, I. Cytokines and Chemokines in Periodontitis. Eur. J. Dent. 2020, 14, 483–495. [Google Scholar] [CrossRef] [PubMed]
- Tang, D.; Tao, D.; Fang, Y.; Deng, C.; Xu, Q.; Zhou, J. TNF-Alpha Promotes Invasion and Metastasis via NF-Kappa B Pathway in Oral Squamous Cell Carcinoma. Med. Sci. Monit. Basic Res. 2017, 23, 141–149. [Google Scholar] [CrossRef]
- Irwin, C.R.; Myrillas, T.T. The role of IL-6 in the pathogenesis of periodontal disease. Oral Dis. 1998, 4, 43–47. [Google Scholar] [CrossRef]
- Garlet, G.P. Destructive and protective roles of cytokines in periodontitis: A re-appraisal from host defense and tissue destruction viewpoints. J. Dent. Res. 2010, 89, 1349–1363. [Google Scholar] [CrossRef] [PubMed]
- Cai, J.; Chen, J.; Guo, H.; Pan, Y.; Zhang, Y.; Zhao, W.; Li, X.; Li, Y. Recombinant fimbriae protein of Porphyromonas gingivalis induces an inflammatory response via the TLR4/NF-kappaB signaling pathway in human peripheral blood mononuclear cells. Int. J. Mol. Med. 2019, 43, 1430–1440. [Google Scholar] [CrossRef] [PubMed]
- Chen, T.; Li, Q.; Wu, J.; Wu, Y.; Peng, W.; Li, H.; Wang, J.; Tang, X.; Peng, Y.; Fu, X. Fusobacterium nucleatum promotes M2 polarization of macrophages in the microenvironment of colorectal tumours via a TLR4-dependent mechanism. Cancer Immunol. Immunother. 2018, 67, 1635–1646. [Google Scholar] [CrossRef]
- Groeger, S.; Jarzina, F.; Domann, E.; Meyle, J. Porphyromonas gingivalis activates NFkappaB and MAPK pathways in human oral epithelial cells. BMC Immunol. 2017, 18, 1. [Google Scholar] [CrossRef]
- Jia, Y.P.; Wang, K.; Zhang, Z.J.; Tong, Y.N.; Han, D.; Hu, C.Y.; Li, Q.; Xiang, Y.; Mao, X.H.; Tang, B. TLR2/TLR4 activation induces Tregs and suppresses intestinal inflammation caused by Fusobacterium nucleatum in vivo. PLoS ONE 2017, 12, e0186179. [Google Scholar] [CrossRef] [PubMed]
- Liu, H.; Redline, R.W.; Han, Y.W. Fusobacterium nucleatum induces fetal death in mice via stimulation of TLR4-mediated placental inflammatory response. J. Immunol. 2007, 179, 2501–2508. [Google Scholar] [CrossRef] [PubMed]
- Aduse-Opoku, J.; Joseph, S.; Devine, D.A.; Marsh, P.D.; Curtis, M.A. Molecular basis for avirulence of spontaneous variants of Porphyromonas gingivalis: Genomic analysis of strains W50, BE1 and BR1. Mol. Oral Microbiol. 2022, 37, 122–132. [Google Scholar] [CrossRef]
- Diaz, P.I.; Dupuy, A.K.; Abusleme, L.; Reese, B.; Obergfell, C.; Choquette, L.; Dongari-Bagtzoglou, A.; Peterson, D.E.; Terzi, E.; Strausbaugh, L.D. Using high throughput sequencing to explore the biodiversity in oral bacterial communities. Mol. Oral Microbiol. 2012, 27, 182–201. [Google Scholar] [CrossRef] [PubMed]
- Flanagan, L.; Schmid, J.; Ebert, M.; Soucek, P.; Kunicka, T.; Liska, V.; Bruha, J.; Neary, P.; Dezeeuw, N.; Tommasino, M.; et al. Fusobacterium nucleatum associates with stages of colorectal neoplasia development, colorectal cancer and disease outcome. Eur. J. Clin. Microbiol. Infect. Dis. 2014, 33, 1381–1390. [Google Scholar] [CrossRef]
- Grenier, D.; Grignon, L. Response of human macrophage-like cells to stimulation by Fusobacterium nucleatum ssp. nucleatum lipopolysaccharide. Oral Microbiol. Immunol. 2006, 21, 190–196. [Google Scholar] [CrossRef]
- Groeger, S.; Zhou, Y.; Ruf, S.; Meyle, J. Pathogenic Mechanisms of Fusobacterium nucleatum on Oral Epithelial Cells. Front Oral Health 2022, 3, 831607. [Google Scholar] [CrossRef]
- Kawai, T.; Akira, S. TLR signaling. Cell Death Differ. 2006, 13, 816–825. [Google Scholar] [CrossRef]
- Kocgozlu, L.; Elkaim, R.; Tenenbaum, H.; Werner, S. Variable cell responses to P. gingivalis lipopolysaccharide. J. Dent. Res. 2009, 88, 741–745. [Google Scholar] [CrossRef] [PubMed]
- Nichols, T.C.; Fischer, T.H.; Deliargyris, E.N.; Baldwin, A.S., Jr. Role of nuclear factor-kappa B (NF-kappa B) in inflammation, periodontitis, and atherogenesis. Ann. Periodontol. 2001, 6, 20–29. [Google Scholar] [CrossRef] [PubMed]
- Tampa, M.; Mitran, M.I.; Mitran, C.I.; Sarbu, M.I.; Matei, C.; Nicolae, I.; Caruntu, A.; Tocut, S.M.; Popa, M.I.; Caruntu, C.; et al. Mediators of Inflammation—A Potential Source of Biomarkers in Oral Squamous Cell Carcinoma. J. Immunol. Res. 2018, 2018, 1061780. [Google Scholar] [CrossRef]
- Grivennikov, S.I.; Karin, M. Inflammation and oncogenesis: A vicious connection. Curr. Opin. Genet. Dev. 2010, 20, 65–71. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.; Weng, W.; Peng, J.; Hong, L.; Yang, L.; Toiyama, Y.; Gao, R.; Liu, M.; Yin, M.; Pan, C.; et al. Fusobacterium nucleatum Increases Proliferation of Colorectal Cancer Cells and Tumor Development in Mice by Activating Toll-Like Receptor 4 Signaling to Nuclear Factor-kappaB, and Up-regulating Expression of MicroRNA-21. Gastroenterology 2017, 152, 851–866. [Google Scholar] [CrossRef]
- Dommisch, H.; Chung, W.O.; Jepsen, S.; Hacker, B.M.; Dale, B.A. Phospholipase C, p38/MAPK, and NF-kappaB-mediated induction of MIP-3alpha/CCL20 by Porphyromonas gingivalis. Innate Immun. 2010, 16, 226–234. [Google Scholar] [CrossRef]
- Kang, W.; Jia, Z.; Tang, D.; Zhang, Z.; Gao, H.; He, K.; Feng, Q. Fusobacterium nucleatum Facilitates Apoptosis, ROS Generation, and Inflammatory Cytokine Production by Activating AKT/MAPK and NF-kappaB Signaling Pathways in Human Gingival Fibroblasts. Oxid. Med. Cell. Longev. 2019, 2019, 1681972. [Google Scholar] [CrossRef] [PubMed]
- Milward, M.R.; Chapple, I.L.; Carter, K.; Matthews, J.B.; Cooper, P.R. Micronutrient modulation of NF-kappaB in oral keratinocytes exposed to periodontal bacteria. Innate Immun. 2013, 19, 140–151. [Google Scholar] [CrossRef]
- Liu, J.; Kern, J.A. Neuregulin-1 activates the JAK-STAT pathway and regulates lung epithelial cell proliferation. Am. J. Respir. Cell Mol. Biol. 2002, 27, 306–313. [Google Scholar] [CrossRef] [PubMed]
- Lin, C.W.; Hsieh, Y.S.; Hsin, C.H.; Su, C.W.; Lin, C.H.; Wei, L.H.; Yang, S.F.; Chien, M.H. Effects of NFKB1 and NFKBIA gene polymorphisms on susceptibility to environmental factors and the clinicopathologic development of oral cancer. PLoS ONE 2012, 7, e35078. [Google Scholar] [CrossRef] [PubMed]
- Reber, L.; Vermeulen, L.; Haegeman, G.; Frossard, N. Ser276 phosphorylation of NF-kB p65 by MSK1 controls SCF expression in inflammation. PLoS ONE 2009, 4, e4393. [Google Scholar] [CrossRef] [PubMed]
- Atanasova, K.R.; Yilmaz, O. Looking in the Porphyromonas gingivalis cabinet of curiosities: The microbium, the host and cancer association. Mol. Oral Microbiol. 2014, 29, 55–66. [Google Scholar] [CrossRef] [PubMed]
- Soto, C.; Bugueno, I.; Hoare, A.; Gonzalez, S.; Venegas, D.; Salinas, D.; Melgar-Rodriguez, S.; Vernal, R.; Gamonal, J.; Quest, A.F.; et al. The Porphyromonas gingivalis O antigen is required for inhibition of apoptosis in gingival epithelial cells following bacterial infection. J. Periodontal Res. 2016, 51, 518–528. [Google Scholar] [CrossRef]
- Abusleme, L.; Hoare, A.; Hong, B.Y.; Diaz, P.I. Microbial signatures of health, gingivitis, and periodontitis. Periodontol. 2000 2021, 86, 57–78. [Google Scholar] [CrossRef]
- Kolenbrander, P.E.; Andersen, R.N.; Moore, L.V. Coaggregation of Fusobacterium nucleatum, Selenomonas flueggei, Selenomonas infelix, Selenomonas noxia, and Selenomonas sputigena with strains from 11 genera of oral bacteria. Infect. Immun. 1989, 57, 3194–3203. [Google Scholar] [CrossRef]
- McIlvanna, E.; Linden, G.J.; Craig, S.G.; Lundy, F.T.; James, J.A. Fusobacterium nucleatum and oral cancer: A critical review. BMC Cancer 2021, 21, 1212. [Google Scholar] [CrossRef]
- Nagy, K.N.; Sonkodi, I.; Szoke, I.; Nagy, E.; Newman, H.N. The microflora associated with human oral carcinomas. Oral Oncol. 1998, 34, 304–308. [Google Scholar] [CrossRef]
- Zhang, L.; Liu, Y.; Zheng, H.J.; Zhang, C.P. The Oral Microbiota May Have Influence on Oral Cancer. Front. Cell. Infect. Microbiol. 2019, 9, 476. [Google Scholar] [CrossRef]
- Zijnge, V.; van Leeuwen, M.B.; Degener, J.E.; Abbas, F.; Thurnheer, T.; Gmur, R.; Harmsen, H.J. Oral biofilm architecture on natural teeth. PLoS ONE 2010, 5, e9321. [Google Scholar] [CrossRef]
- Alves, A.; Diel, L.; Ramos, G.; Pinto, A.; Bernardi, L.; Yates, J., 3rd; Lamers, M. Tumor microenvironment and Oral Squamous Cell Carcinoma: A crosstalk between the inflammatory state and tumor cell migration. Oral Oncol. 2021, 112, 105038. [Google Scholar] [CrossRef]
- Feller, L.; Altini, M.; Lemmer, J. Inflammation in the context of oral cancer. Oral Oncol. 2013, 49, 887–892. [Google Scholar] [CrossRef]
- Sahibzada, H.A.; Khurshid, Z.; Khan, R.S.; Naseem, M.; Siddique, K.M.; Mali, M.; Zafar, M.S. Salivary IL-8, IL-6 and TNF-alpha as Potential Diagnostic Biomarkers for Oral Cancer. Diagnostics 2017, 7, 21. [Google Scholar] [CrossRef] [PubMed]
- Unus, S.; Ramabadran, S.; Lakshmi, P.; Narasimham, A.; Gunasekaran, N.; Krishnan, R. Role of cytokines in oral malignancies. SMR J. Res. Dent. Sci. 2014, 5, 274–279. [Google Scholar] [CrossRef]
- Bramanti, T.E.; Holt, S.C. Roles of porphyrins and host iron transport proteins in regulation of growth of Porphyromonas gingivalis W50. J. Bacteriol. 1991, 173, 7330–7339. [Google Scholar] [CrossRef] [PubMed]
- Robrish, S.A.; Oliver, C.; Thompson, J. Amino acid-dependent transport of sugars by Fusobacterium nucleatum ATCC 10953. J. Bacteriol. 1987, 169, 3891–3897. [Google Scholar] [CrossRef]
- de Andrade, K.Q.; Almeida-da-Silva, C.L.C.; Coutinho-Silva, R. Immunological Pathways Triggered by Porphyromonas gingivalis and Fusobacterium nucleatum: Therapeutic Possibilities? Mediat. Inflamm. 2019, 2019, 7241312. [Google Scholar] [CrossRef]
- Dosseva-Panova, V.T.; Popova, C.L.; Panov, V.E. Subgingival microbial profile and production of proinflammatory cytokines in chronic periodontitis. Folia Med. 2014, 56, 152–160. [Google Scholar] [CrossRef] [PubMed]
- Gasche, J.A.; Hoffmann, J.; Boland, C.R.; Goel, A. Interleukin-6 promotes tumorigenesis by altering DNA methylation in oral cancer cells. Int. J. Cancer 2011, 129, 1053–1063. [Google Scholar] [CrossRef]
- Babiuch, K.; Kusnierz-Cabala, B.; Kesek, B.; Okon, K.; Darczuk, D.; Chomyszyn-Gajewska, M. Evaluation of Proinflammatory, NF-kappaB Dependent Cytokines: IL-1alpha, IL-6, IL-8, and TNF-alpha in Tissue Specimens and Saliva of Patients with Oral Squamous Cell Carcinoma and Oral Potentially Malignant Disorders. J. Clin. Med. 2020, 9, 867. [Google Scholar] [CrossRef]
- Fujita, T.; Yoshimoto, T.; Matsuda, S.; Kajiya, M.; Kittaka, M.; Imai, H.; Iwata, T.; Uchida, Y.; Shiba, H.; Kurihara, H. Interleukin-8 induces DNA synthesis, migration and down-regulation of cleaved caspase-3 in cultured human gingival epithelial cells. J. Periodontal Res. 2015, 50, 479–485. [Google Scholar] [CrossRef]
- Waugh, D.J.; Wilson, C. The interleukin-8 pathway in cancer. Clin. Cancer Res. 2008, 14, 6735–6741. [Google Scholar] [CrossRef]
- Krisanaprakornkit, S.; Kimball, J.R.; Weinberg, A.; Darveau, R.P.; Bainbridge, B.W.; Dale, B.A. Inducible expression of human beta-defensin 2 by Fusobacterium nucleatum in oral epithelial cells: Multiple signaling pathways and role of commensal bacteria in innate immunity and the epithelial barrier. Infect. Immun. 2000, 68, 2907–2915. [Google Scholar] [CrossRef]
- Yadav, A.; Kumar, B.; Datta, J.; Teknos, T.N.; Kumar, P. IL-6 promotes head and neck tumor metastasis by inducing epithelial-mesenchymal transition via the JAK-STAT3-SNAIL signaling pathway. Mol. Cancer Res. 2011, 9, 1658–1667. [Google Scholar] [CrossRef] [PubMed]
- Bendre, M.; Gaddy, D.; Nicholas, R.W.; Suva, L.J. Breast cancer metastasis to bone: It is not all about PTHrP. Clin. Orthop. Relat. Res. 2003, 415, S39–S45. [Google Scholar] [CrossRef]
- Gallucci, R.M.; Sloan, D.K.; Heck, J.M.; Murray, A.R.; O’Dell, S.J. Interleukin 6 indirectly induces keratinocyte migration. J. Investig. Dermatol. 2004, 122, 764–772. [Google Scholar] [CrossRef] [PubMed]
- Jiang, G.X.; Zhong, X.Y.; Cui, Y.F.; Liu, W.; Tai, S.; Wang, Z.D.; Shi, Y.G.; Zhao, S.Y.; Li, C.L. IL-6/STAT3/TFF3 signaling regulates human biliary epithelial cell migration and wound healing in vitro. Mol. Biol. Rep. 2010, 37, 3813–3818. [Google Scholar] [CrossRef] [PubMed]
- Jotwani, R.; Moonga, B.S.; Gupta, S.; Cutler, C.W. Nuclear factor-kappaB p50 subunits in chronic periodontitis and Porphyromonas gingivalis lipopolysaccharide-pulsed dendritic cells. Ann. N. Y. Acad. Sci. 2010, 1192, 278–285. [Google Scholar] [CrossRef] [PubMed][Green Version]









| Gene | Forward Primer (Fw) | Reverse Primer (Rv) |
|---|---|---|
| 16S rRNA Pg | TGTAGATGACTGATGGTGAAAACC | ACGTCATCCCCACCTTCCTC |
| Fn nusG * | CAACCATTACTTTAACTCTACCATGTTCA | TACTGAGGGAGATTATGTAAAAATC |
| β-actin | CACCATTGGCAATGACGCGTTC | AGGTCTTTGCGGATGTCCACGT |
| TNF-α | CAGCCTCTTCTCCTTCCTGAT | GCCAGAGGGCTGATTAGAGA |
| IL-1β | CCACAGACCTTCCAGGAGAATG | GTGCAGTTCAGTGATCGTACAGG |
| IL-6 | AGACAGCCACTCACCTCTTCAG | TTCTGCCAGTGCCTCTTTGCTG |
| IL-8 | GGCACAAACTTTCAGAGACAG | ACACAGAGCTGCAGAAATCAGG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yáñez, L.; Soto, C.; Tapia, H.; Pacheco, M.; Tapia, J.; Osses, G.; Salinas, D.; Rojas-Celis, V.; Hoare, A.; Quest, A.F.G.; et al. Co-Culture of P. gingivalis and F. nucleatum Synergistically Elevates IL-6 Expression via TLR4 Signaling in Oral Keratinocytes. Int. J. Mol. Sci. 2024, 25, 3611. https://doi.org/10.3390/ijms25073611
Yáñez L, Soto C, Tapia H, Pacheco M, Tapia J, Osses G, Salinas D, Rojas-Celis V, Hoare A, Quest AFG, et al. Co-Culture of P. gingivalis and F. nucleatum Synergistically Elevates IL-6 Expression via TLR4 Signaling in Oral Keratinocytes. International Journal of Molecular Sciences. 2024; 25(7):3611. https://doi.org/10.3390/ijms25073611
Chicago/Turabian StyleYáñez, Lucas, Cristopher Soto, Héctor Tapia, Martín Pacheco, Javiera Tapia, Gabriela Osses, Daniela Salinas, Victoria Rojas-Celis, Anilei Hoare, Andrew F. G. Quest, and et al. 2024. "Co-Culture of P. gingivalis and F. nucleatum Synergistically Elevates IL-6 Expression via TLR4 Signaling in Oral Keratinocytes" International Journal of Molecular Sciences 25, no. 7: 3611. https://doi.org/10.3390/ijms25073611
APA StyleYáñez, L., Soto, C., Tapia, H., Pacheco, M., Tapia, J., Osses, G., Salinas, D., Rojas-Celis, V., Hoare, A., Quest, A. F. G., Díaz-Elizondo, J., Pérez-Donoso, J. M., & Bravo, D. (2024). Co-Culture of P. gingivalis and F. nucleatum Synergistically Elevates IL-6 Expression via TLR4 Signaling in Oral Keratinocytes. International Journal of Molecular Sciences, 25(7), 3611. https://doi.org/10.3390/ijms25073611

