A Precision Therapy Approach for Retinitis Pigmentosa 11 Using Splice-Switching Antisense Oligonucleotides to Restore the Open Reading Frame of PRPF31
Abstract
1. Introduction
2. Results
2.1. PRPF31 Level Is Linked to Incomplete Disease Penetrance in an RP11 Family with PRPF31 c.1205 C>A Mutation
2.2. PRPF31 Transcript Harboring c.1205 C>A Mutation Is Highly Susceptible to mRNA Degradation via Nonsense-Mediated mRNA Decay
2.3. Strategic Design of Antisense Oligonucleotide to Bypass a Premature Termination Codon in PRPF31 Exon 12
2.4. Screening of Splice-Switching AO to Mediate PRPF31 Exon 12 Exclusion and Restore the Open Reading Frame in Fibroblasts Derived from an RP11 Patient
2.5. PMO-Induced Exclusion of Exon 12 Bypasses the Disease-Causing PTC and Rescues PRPF31 Expression
2.6. Truncated PRPF31 Protein Retains the Ability to Translocate into the Nucleus
3. Discussion
4. Materials and Methods
4.1. Dermal Fibroblast Culture
4.2. iPSC-RPE Generation
4.3. Nonsense-Mediated Decay Inhibitor Treatment
4.4. Antisense Oligonucleotide Design and Synthesis
4.5. AO Transfection
4.6. RNA Purification and RT-PCR
4.7. Quantitative Determination of PRPF31 Transcript
4.8. Immunofluorescence Assay
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Farkas, M.H.; Lew, D.S.; Sousa, M.E.; Bujakowska, K.; Chatagnon, J.; Bhattacharya, S.S.; Pierce, E.A.; Nandrot, E.F. Mutations in Pre-MRNA Processing Factors 3, 8, and 31 Cause Dysfunction of the Retinal Pigment Epithelium. Am. J. Pathol. 2014, 184, 2641–2652. [Google Scholar] [CrossRef] [Scilit]
- Martin-Merida, I.; Aguilera-Garcia, D.; Fernandez-San, J.P.; Blanco-Kelly, F.; Zurita, O.; Almoguera, B.; Garcia-Sandoval, B.; Avila-Fernandez, A.; Arteche, A.; Minguez, P.; et al. Toward the Mutational Landscape of Autosomal Dominant Retinitis Pigmentosa: A Comprehensive Analysis of 258 Spanish Families. Investig. Ophthalmol. Vis. Sci. 2018, 59, 2345–2354. [Google Scholar] [CrossRef] [Scilit]
- Kiser, K.; Webb-Jones, K.D.; Bowne, S.J.; Sullivan, L.S.; Daiger, S.P.; Birch, D.G. Time Course of Disease Progression of PRPF31-Mediated Retinitis Pigmentosa. Am. J. Ophthalmol. 2019, 200, 76–84. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Roshandel, D.; Thompson, J.A.; Heath Jeffery, R.C.; Zhang, D.; Lamey, T.M.; McLaren, T.L.; De Roach, J.N.; McLenachan, S.; Mackey, D.A.; Chen, F.K. Clinical Evidence for the Importance of the Wild-Type PRPF31 Allele in the Phenotypic Expression of RP11. Genes 2021, 12, 915. [Google Scholar] [CrossRef] [Scilit]
- Lisbjerg, K.; Bertelsen, M.; Lyng Forman, J.; Grønskov, K.; Prener Holtan, J.; Kessel, L. Disease Progression of Retinitis Pigmentosa Caused by PRPF31 Variants in a Nordic Population: A Retrospective Study with up to 36 Years Follow-Up. Ophthalmic Genet. 2023, 44, 139–146. [Google Scholar] [CrossRef] [Scilit]
- Cao, H.; Wu, J.; Lam, S.; Duan, R.; Newnham, C.; Molday, R.S.; Graziotto, J.J.; Pierce, E.A.; Hu, J. Temporal and Tissue Specific Regulation of RP-Associated Splicing Factor Genes PRPF3, PRPF31 and PRPC8-Implications in the Pathogenesis of RP. PLoS ONE 2011, 6, e15860. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ciampi, L.; Serrano, L.; Irimia, M. Unique Transcriptomes of Sensory and Non-Sensory Neurons: Insights from Splicing Regulatory States. Mol. Syst. Biol. 2024. [Google Scholar] [CrossRef] [Scilit]
- Abu-Safieh, L.; Vithana, E.N.; Mantel, I.; Holder, G.E.; Pelosini, L.; Bird, A.C.; Bhattacharya, S.S. A Large Deletion in the AdRP Gene PRPF31: Evidence That Haploinsufficiency Is the Cause of Disease. Mol. Vis. 2006, 12, 384–388. [Google Scholar]
- Rio Frio, T.; Wade, N.M.; Ransijn, A.; Berson, E.L.; Beckmann, J.S.; Rivolta, C. Premature Termination Codons in PRPF31 Cause Retinitis Pigmentosa via Haploinsufficiency Due to Nonsense-Mediated MRNA Decay. J. Clin. Investig. 2008, 118, 1519–1531. [Google Scholar] [CrossRef] [Scilit]
- Venturini, G.; Rose, A.M.; Shah, A.Z.; Bhattacharya, S.S.; Rivolta, C. CNOT3 Is a Modifier of PRPF31 Mutations in Retinitis Pigmentosa with Incomplete Penetrance. PLoS Genet. 2012, 8, e1003040. [Google Scholar] [CrossRef] [Scilit]
- Rose, A.M.; Shah, A.Z.; Venturini, G.; Rivolta, C.; Rose, G.E.; Bhattacharya, S.S. Dominant PRPF31 Mutations Are Hypostatic to a Recessive CNOT3 Polymorphism in Retinitis Pigmentosa: A Novel Phenomenon of “Linked Trans-Acting Epistasis”. Ann. Hum. Genet. 2014, 78, 62–71. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rose, A.M.; Shah, A.Z.; Venturini, G.; Krishna, A.; Chakravarti, A.; Rivolta, C.; Bhattacharya, S.S. Transcriptional Regulation of PRPF31 Gene Expression by MSR1 Repeat Elements Causes Incomplete Penetrance in Retinitis Pigmentosa. Sci. Rep. 2016, 6, 19450. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Frio, T.R.; Civic, N.; Ransijn, A.; Beckmann, J.S.; Rivolta, C. Two Trans-Acting EQTLs Modulate the Penetrance of PRPF31 Mutations. Hum. Mol. Genet. 2008, 17, 3154–3165. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Grainok, J.; Pitout, I.; Wilton, S.; Chen, F.K.; Mitrpant, C.; Fletcher, S. Modulation of CNOT3 Expression Using Antisense Oligomers to Treat Retinitis Pigmentosa 11. Investig. Ophthalmol. Vis. Sci. 2021, 62, 1181. [Google Scholar]
- ClinicalTrials.gov. SAD of IVT VP-001 in PRPF31 Mutation-Associated Retinal Dystrophy Subjects (Platypus). Available online: https://clinicaltrials.gov/study/NCT05902962?cond=RP11&rank=1 (accessed on 10 March 2024).
- Xi, Z.; Vats, A.; Sahel, J.-A.; Chen, Y.; Byrne, L.C. Gene Augmentation Prevents Retinal Degeneration in a CRISPR/Cas9-Based Mouse Model of PRPF31 Retinitis Pigmentosa. Nat. Commun. 2022, 13, 7695. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dias, N.; Stein, C.A. Antisense Oligonucleotides: Basic Concepts and Mechanisms. Mol. Cancer Ther. 2002, 1, 347–355. [Google Scholar] [PubMed]
- Kole, R.; Krainer, A.R.; Altman, S. RNA Therapeutics: Beyond RNA Interference and Antisense Oligonucleotides. Nat. Rev. Drug Discov. 2012, 11, 125–140. [Google Scholar] [CrossRef] [Scilit]
- Brunet de Courssou, J.-B.; Durr, A.; Adams, D.; Corvol, J.-C.; Mariani, L.-L. Antisense Therapies in Neurological Diseases. Brain 2022, 145, 816–831. [Google Scholar] [CrossRef] [Scilit]
- Rinaldi, C.; Wood, M.J.A. Antisense Oligonucleotides: The next Frontier for Treatment of Neurological Disorders. Nat. Rev. Neurol. 2018, 14, 9–21. [Google Scholar] [CrossRef] [Scilit]
- Syed, Y.Y. Eteplirsen: First Global Approval. Drugs 2016, 76, 1699–1704. [Google Scholar] [CrossRef] [Scilit]
- Heo, Y.-A. Golodirsen: First Approval. Drugs 2020, 80, 329–333. [Google Scholar] [CrossRef] [Scilit]
- Shirley, M. Casimersen: First Approval. Drugs 2021, 81, 875–879. [Google Scholar] [CrossRef] [Scilit]
- U.S. Food and Drug Administration. (2021, February 21). Approves Targeted Treatment for Rare Duchenne Muscular Dystrophy Mutation. Available online: https://www.fda.gov/news-events/press-announcements/fda-approves-targeted-treatment-rare-duchenne-muscular-dystrophy-mutation-0 (accessed on 10 March 2024).
- Garanto, A.; Chung, D.C.; Duijkers, L.; Corral-Serrano, J.C.; Messchaert, M.; Xiao, R.; Bennett, J.; Vandenberghe, L.H.; Collin, R.W.J. In Vitro and in Vivo Rescue of Aberrant Splicing in CEP290-Associated LCA by Antisense Oligonucleotide Delivery. Hum. Mol. Genet. 2016, 25, 2552–2563. [Google Scholar] [CrossRef] [Scilit]
- Hinrich, A.J.; Jodelka, F.M.; Chang, J.L.; Brutman, D.; Bruno, A.M.; Briggs, C.A.; James, B.D.; Stutzmann, G.E.; Bennett, D.A.; Miller, S.A.; et al. Therapeutic Correction of ApoER2 Splicing in Alzheimer’s Disease Mice Using Antisense Oligonucleotides. EMBO Mol. Med. 2016, 8, 328–345. [Google Scholar] [CrossRef] [Scilit]
- Lim, K.H.; Han, Z.; Jeon, H.Y.; Kach, J.; Jing, E.; Weyn-Vanhentenryck, S.; Downs, M.; Corrionero, A.; Oh, R.; Scharner, J.; et al. Antisense Oligonucleotide Modulation of Non-Productive Alternative Splicing Upregulates Gene Expression. Nat. Commun. 2020, 11, 3501. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- McLenachan, S.; Zhang, D.; Grainok, J.; Zhang, X.; Huang, Z.; Chen, S.-C.; Zaw, K.; Lima, A.; Jennings, L.; Roshandel, D.; et al. Determinants of Disease Penetrance in PRPF31-Associated Retinopathy. Genes 2021, 12, 1542. [Google Scholar] [CrossRef] [Scilit]
- Nagy, E.; Maquat, L.E. A Rule for Termination-Codon Position within Intron-Containing Genes: When Nonsense Affects RNA Abundance. Trends Biochem. Sci. 1998, 23, 198–199. [Google Scholar] [CrossRef] [Scilit]
- Dulla, K.; Slijkerman, R.; van Diepen, H.C.; Albert, S.; Dona, M.; Beumer, W.; Turunen, J.J.; Chan, H.L.; Schulkens, I.A.; Vorthoren, L.; et al. Antisense Oligonucleotide-Based Treatment of Retinitis Pigmentosa Caused by USH2A Exon 13 Mutations. Mol. Ther. 2021, 29, 2441–2455. [Google Scholar] [CrossRef] [Scilit]
- Arechavala-Gomeza, V.; Graham, I.R.; Popplewell, L.J.; Adams, A.M.; Aartsma-Rus, A.; Kinali, M.; Morgan, J.E.; van Deutekom, J.C.; Wilton, S.D.; Dickson, G.; et al. Comparative Analysis of Antisense Oligonucleotide Sequences for Targeted Skipping of Exon 51 During Dystrophin Pre-MRNA Splicing in Human Muscle. Hum. Gene Ther. 2007, 18, 798–810. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- McDonald, C.M.; Wong, B.; Flanigan, K.M.; Wilson, R.; de Kimpe, S.; Lourbakos, A.; Lin, Z.; Campion, G. Placebo-controlled Phase 2 Trial of Drisapersen for Duchenne Muscular Dystrophy. Ann. Clin. Transl. Neurol. 2018, 5, 913–926. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Makarova, O.V.; Makarov, E.M.; Liu, S.; Vornlocher, H.-P.; Lührmann, R. Protein 61K, Encoded by a Gene (PRPF31) Linked to Autosomal Dominant Retinitis Pigmentosa, Is Required for U4/U6*U5 Tri-SnRNP Formation and Pre-MRNA Splicing. EMBO J. 2002, 21, 1148–1157. [Google Scholar] [CrossRef] [Scilit]
- Passini, M.A.; Bu, J.; Richards, A.M.; Kinnecom, C.; Sardi, S.P.; Stanek, L.M.; Hua, Y.; Rigo, F.; Matson, J.; Hung, G.; et al. Antisense Oligonucleotides Delivered to the Mouse CNS Ameliorate Symptoms of Severe Spinal Muscular Atrophy. Sci. Transl. Med. 2011, 3, 72ra18. [Google Scholar] [CrossRef] [Scilit]
- Porensky, P.N.; Mitrpant, C.; McGovern, V.L.; Bevan, A.K.; Foust, K.D.; Kaspar, B.K.; Wilton, S.D.; Burghes, A.H.M. A Single Administration of Morpholino Antisense Oligomer Rescues Spinal Muscular Atrophy in Mouse. Hum. Mol. Genet. 2012, 21, 1625–1638. [Google Scholar] [CrossRef] [Scilit]
- Wheway, G.; Douglas, A.; Baralle, D.; Guillot, E. Mutation Spectrum of PRPF31, Genotype-Phenotype Correlation in Retinitis Pigmentosa, and Opportunities for Therapy. Exp. Eye Res. 2020, 192, 107950. [Google Scholar] [CrossRef] [Scilit]
- Buskin, A.; Zhu, L.; Chichagova, V.; Basu, B.; Mozaffari-Jovin, S.; Dolan, D.; Droop, A.; Collin, J.; Bronstein, R.; Mehrotra, S.; et al. Disrupted Alternative Splicing for Genes Implicated in Splicing and Ciliogenesis Causes PRPF31 Retinitis Pigmentosa. Nat. Commun. 2018, 9, 4234. [Google Scholar] [CrossRef] [Scilit]
- Li, D.; Mastaglia, F.L.; Fletcher, S.; Wilton, S.D. Precision Medicine through Antisense Oligonucleotide-Mediated Exon Skipping. Trends Pharmacol. Sci. 2018, 39, 982–994. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pitout, I.; Flynn, L.L.; Wilton, S.D.; Fletcher, S. Antisense-Mediated Splice Intervention to Treat Human Disease: The Odyssey Continues. F1000Research 2019, 8, 710. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sato, H.; Wada, Y.; Itabashi, T.; Nakamura, M.; Kawamura, M.; Tamai, M. Mutations in the Pre-MRNA Splicing Gene, PRPF31, in Japanese Families With Autosomal Dominant Retinitis Pigmentosa. Am. J. Ophthalmol. 2005, 140, 537–540. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhao, C.; Bellur, D.L.; Lu, S.; Zhao, F.; Grassi, M.A.; Bowne, S.J.; Sullivan, L.S.; Daiger, S.P.; Chen, L.J.; Pang, C.P.; et al. Autosomal-Dominant Retinitis Pigmentosa Caused by a Mutation in SNRNP200, a Gene Required for Unwinding of U4/U6 SnRNAs. Am. J. Hum. Genet. 2009, 85, 617–627. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dong, B.; Chen, J.; Zhang, X.; Pan, Z.; Bai, F.; Li, Y. Two Novel PRP31 Premessenger Ribonucleic Acid Processing Factor 31 Homolog Mutations Including a Complex Insertion-Deletion Identified in Chinese Families with Retinitis Pigmentosa. Mol. Vis. 2013, 19, 2426–2435. [Google Scholar] [PubMed]
- Glöckle, N.; Kohl, S.; Mohr, J.; Scheurenbrand, T.; Sprecher, A.; Weisschuh, N.; Bernd, A.; Rudolph, G.; Schubach, M.; Poloschek, C.; et al. Panel-Based next Generation Sequencing as a Reliable and Efficient Technique to Detect Mutations in Unselected Patients with Retinal Dystrophies. Eur. J. Hum. Genet. 2014, 22, 99–104. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jespersgaard, C.; Fang, M.; Bertelsen, M.; Dang, X.; Jensen, H.; Chen, Y.; Bech, N.; Dai, L.; Rosenberg, T.; Zhang, J.; et al. Molecular Genetic Analysis Using Targeted NGS Analysis of 677 Individuals with Retinal Dystrophy. Sci. Rep. 2019, 9, 1219. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Aweidah, H.; Xi, Z.; Sahel, J.-A.; Byrne, L.C. PRPF31-Retinitis Pigmentosa: Challenges and Opportunities for Clinical Translation. Vis. Res. 2023, 213, 108315. [Google Scholar] [CrossRef] [Scilit]
- Shamshad, A.; Kang, C.; Jenny, L.A.; Persad-Paisley, E.M.; Tsang, S.H. Translatability Barriers between Preclinical and Clinical Trials of AAV Gene Therapy in Inherited Retinal Diseases. Vis. Res. 2023, 210, 108258. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nuzbrokh, Y.; Kassotis, A.S.; Ragi, S.D.; Jauregui, R.; Tsang, S.H. Treatment-Emergent Adverse Events in Gene Therapy Trials for Inherited Retinal Diseases: A Narrative Review. Ophthalmol. Ther. 2020, 9, 709–724. [Google Scholar] [CrossRef] [Scilit]
- Takakusa, H.; Iwazaki, N.; Nishikawa, M.; Yoshida, T.; Obika, S.; Inoue, T. Drug Metabolism and Pharmacokinetics of Antisense Oligonucleotide Therapeutics: Typical Profiles, Evaluation Approaches, and Points to Consider Compared with Small Molecule Drugs. Nucleic Acid Ther. 2023, 33, 83–94. [Google Scholar] [CrossRef] [Scilit]
- Centa, J.L.; Jodelka, F.M.; Hinrich, A.J.; Johnson, T.B.; Ochaba, J.; Jackson, M.; Duelli, D.M.; Weimer, J.M.; Rigo, F.; Hastings, M.L. Therapeutic Efficacy of Antisense Oligonucleotides in Mouse Models of CLN3 Batten Disease. Nat. Med. 2020, 26, 1444–1451. [Google Scholar] [CrossRef] [Scilit]
- Matos, L.; Vilela, R.; Rocha, M.; Santos, J.I.; Coutinho, M.F.; Gaspar, P.; Prata, M.J.; Alves, S. Development of an Antisense Oligonucleotide-Mediated Exon Skipping Therapeutic Strategy for Mucolipidosis II: Validation at RNA Level. Hum. Gene Ther. 2020, 31, 775–783. [Google Scholar] [CrossRef] [Scilit]
- Kim, Y.J.; Sivetz, N.; Layne, J.; Voss, D.M.; Yang, L.; Zhang, Q.; Krainer, A.R. Exon-Skipping Antisense Oligonucleotides for Cystic Fibrosis Therapy. Proc. Natl. Acad. Sci. USA 2022, 119, e2114858118. [Google Scholar] [CrossRef] [Scilit]
- Aartsma-Rus, A.; Corey, D.R. The 10th Oligonucleotide Therapy Approved: Golodirsen for Duchenne Muscular Dystrophy. Nucleic Acid Ther. 2020, 30, 67–70. [Google Scholar] [CrossRef] [Scilit]
- U.S. Food and Drug Administration. (2020, August 12). Approves Targeted Treatment for Rare Duchenne Muscular Dystrophy Mutation. Available online: https://www.fda.gov/news-events/press-announcements/fda-approves-targeted-treatment-rare-duchenne-muscular-dystrophy-mutation (accessed on 10 March 2024).
- Liu, S.; Li, P.; Dybkov, O.; Nottrott, S.; Hartmuth, K.; Luhrmann, R.; Carlomagno, T.; Wahl, M.C. Binding of the Human Prp31 Nop Domain to a Composite RNA-Protein Platform in U4 SnRNP. Science 2007, 316, 115–120. [Google Scholar] [CrossRef] [Scilit]
- Goyenvalle, A.; Jimenez-Mallebrera, C.; van Roon, W.; Sewing, S.; Krieg, A.M.; Arechavala-Gomeza, V.; Andersson, P. Considerations in the Preclinical Assessment of the Safety of Antisense Oligonucleotides. Nucleic Acid Ther. 2023, 33, 1–16. [Google Scholar] [CrossRef] [Scilit]
- Roshandel, D.; Thompson, J.A.; Charng, J.; Zhang, D.; Chelva, E.; Arunachalam, S.; Attia, M.S.; Lamey, T.M.; McLaren, T.L.; De Roach, J.N.; et al. Exploring Microperimetry and Autofluorescence Endpoints for Monitoring Disease Progression in PRPF31 -Associated Retinopathy. Ophthalmic Genet. 2021, 42, 1–14. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- McLenachan, S.; Zhang, D.; Zhang, X.; Chen, S.-C.; Lamey, T.; Thompson, J.A.; McLaren, T.; De Roach, J.N.; Fletcher, S.; Chen, F.K. Generation of Two Induced Pluripotent Stem Cell Lines from a Patient with Dominant PRPF31 Mutation and a Related Non-Penetrant Carrier. Stem Cell Res. 2019, 34, 101357. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Flynn, L.L.; Mitrpant, C.; Adams, A.; Pitout, I.L.; Stirnweiss, A.; Fletcher, S.; Wilton, S.D. Targeted SMN Exon Skipping: A Useful Control to Assess in Vitro and in Vivo Splice-Switching Studies. Biomedicines 2021, 9, 552. [Google Scholar] [CrossRef] [Scilit] [PubMed]






| AO/PMO Name | AO Coordinate | AO Sequence (5′>3′) |
|---|---|---|
| AO1 | PRPF31_H12A(−14+11) | UCCUCCUCGAUCUAGGGGGAAGAGG |
| AO2 | PRPF31_H12A(+17+41) | AGGCUGAAUCCCAGGUCCUCCUGGU |
| AO3 | PRPF31_H12A(+43+67) | CACUGCCCGACUUGCCCAGGUGGCC |
| AO4 1 | PRPF31_H12A(+70+94) | CGUUUACCUGUGUCUGCCGCACACG |
| AO5 | PRPF31_H12D(+18−7) | CCCAUACCUGCAGCGUCUUGGAGAU |
| Control 1 AO | SMN H7A(+07+31) | ACCUUCCUUCUUUUUGAUUUUGUCU |
| PMO4 1 | PRPF31_H12A(+70+94) | CGTTTACCTGTGTCTGCCGCACACG |
| Control 1 PMO | SMN_H7A(+07+31) | ACCTTCCTTCTTTTTGATTTTGTCT |
| Control 2 PMO | GTC | CCTCTTACCTCAGTTACAATTTATA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Grainok, J.; Pitout, I.L.; Chen, F.K.; McLenachan, S.; Heath Jeffery, R.C.; Mitrpant, C.; Fletcher, S. A Precision Therapy Approach for Retinitis Pigmentosa 11 Using Splice-Switching Antisense Oligonucleotides to Restore the Open Reading Frame of PRPF31. Int. J. Mol. Sci. 2024, 25, 3391. https://doi.org/10.3390/ijms25063391
Grainok J, Pitout IL, Chen FK, McLenachan S, Heath Jeffery RC, Mitrpant C, Fletcher S. A Precision Therapy Approach for Retinitis Pigmentosa 11 Using Splice-Switching Antisense Oligonucleotides to Restore the Open Reading Frame of PRPF31. International Journal of Molecular Sciences. 2024; 25(6):3391. https://doi.org/10.3390/ijms25063391
Chicago/Turabian StyleGrainok, Janya, Ianthe L. Pitout, Fred K. Chen, Samuel McLenachan, Rachael C. Heath Jeffery, Chalermchai Mitrpant, and Sue Fletcher. 2024. "A Precision Therapy Approach for Retinitis Pigmentosa 11 Using Splice-Switching Antisense Oligonucleotides to Restore the Open Reading Frame of PRPF31" International Journal of Molecular Sciences 25, no. 6: 3391. https://doi.org/10.3390/ijms25063391
APA StyleGrainok, J., Pitout, I. L., Chen, F. K., McLenachan, S., Heath Jeffery, R. C., Mitrpant, C., & Fletcher, S. (2024). A Precision Therapy Approach for Retinitis Pigmentosa 11 Using Splice-Switching Antisense Oligonucleotides to Restore the Open Reading Frame of PRPF31. International Journal of Molecular Sciences, 25(6), 3391. https://doi.org/10.3390/ijms25063391

