Zosuquidar: An Effective Molecule for Intracellular Ca2+ Measurement in P-gp Positive Cells
Abstract
1. Introduction
2. Results
2.1. Characterization of ABC Transporter Expression in Parental Cell Lines and Their Resistant Variants
2.2. Effect of ZSQ and TQR on Leukemic Cells Overexpressing P-Glycoprotein
2.3. Evaluation of the Inhibitory Effects of Zosuquidar and Tariquidar
2.4. Flow Cytometric Evaluation of Intracellular Calcium Levels
2.5. Observation of Intracellular Fluo-3/Ca2+ Complex in Confocal Microscopy
3. Discussion
4. Materials and Methods
4.1. Cell Lines
4.2. Apoptosis and Necrosis Detection Assay
4.3. Calcein/AM Assay
4.4. Evaluation of Cytoplasmic Calcium Kinetics
4.5. Detection of Intracellular Calcium Transport
4.6. Quantitative PCR
4.7. Statistical Analysis and Data Processing
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
| AM | Acetoxymethyl (group) |
| A-V | Annexin V FLUOS |
| EMT | epithelial-mesenchymal transition |
| FSC | Forward scatter |
| L1210 | murine acute lymphoid leukemia cell line |
| MDR | Multidrug resistance |
| MOLM-13 | human acute myeloid leukemia cell line |
| MOLM-13/vcr | P-gp positive/vincristine-resistant variant of the MOLM-13 cell line |
| P-gp | P-glycoprotein, ABCB1 protein |
| PI | Propidium Iodide |
| R | P-gp positive variant of L1210 cells obtained by selection with vincristine |
| S | sensitive, P-gp negative L1210 cells |
| SKM-1 | human acute myeloid leukemia cell line |
| SKM-1/vcr | P-gp positive/vincristine-resistant variant of the MOLM-13 cell line |
| SSC | Side scatter |
| T | P-gp positive variants of L1210 cells obtained by gene transfection encoding P-gp |
| TQR | Tariquidar, P-gp inhibitor |
| VCR | Vincristine |
| ZSQ | Zosuquidar, P-gp inhibitor |
References
- Fan, X.X.; Yao, X.J.; Xu, S.W.; Wong, V.K.W.; He, J.X.; Ding, J.; Xue, W.W.; Mujtaba, T.; Michelangeli, F.; Huang, M.; et al. (Z)3,4,5,4′-Trans-Tetramethoxystilbene, a New Analogue of Resveratrol, Inhibits Gefitinb-Resistant Non-Small Cell Lung Cancer via Selectively Elevating Intracellular Calcium Level. Sci. Rep. 2015, 5, 16348. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bittremieux, M.; Parys, J.B.; Pinton, P.; Bultynck, G. ER Functions of Oncogenes and Tumor Suppressors: Modulators of Intracellular Ca2+ Signaling. Biochim. Biophys. Acta Mol. Cell Res. 2016, 1863, 1364–1378. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- McCombs, J.E.; Palmer, A.E. Measuring Calcium Dynamics in Living Cells with Genetically Encodable Calcium Indicators. Methods 2008, 46, 152–159. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bagur, R.; Hajnóczky, G. Intracellular Ca2+ Sensing: Its Role in Calcium Homeostasis and Signaling. Mol. Cell 2017, 66, 780–788. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bai, S.; Lan, Y.; Fu, S.; Cheng, H.; Lu, Z.; Liu, G. Connecting Calcium-Based Nanomaterials and Cancer: From Diagnosis to Therapy. Nanomicro. Lett. 2022, 14, 145. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Whitaker, M. Chapter 6—Genetically Encoded Probes for Measurement of Intracellular Calcium. Methods Cell Biol. 2010, 99, 153–182. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wendt, E.R.; Ferry, H.; Greaves, D.R.; Keshav, S. Ratiometric Analysis of Fura Red by Flow Cytometry: A Technique for Monitoring Intracellular Calcium Flux in Primary Cell Subsets. PLoS ONE 2015, 10, e0119532. [Google Scholar] [CrossRef] [Scilit]
- Besanger, T.R.; Bhanabhai, H.; Brennan, J.D. Interferences in Fluo-3 Based Ion-Flux Assays for Ligand-Gated-Ion Channels. Anal. Chim. Acta 2005, 537, 125–134. [Google Scholar] [CrossRef] [Scilit]
- Schepers, E.; Glorieux, G.; Dhondt, A.; Leybaert, L.; Vanholder, R. Flow Cytometric Calcium Flux Assay: Evaluation of Cytoplasmic Calcium Kinetics in Whole Blood Leukocytes. J. Immunol. Methods 2009, 348, 74–82. [Google Scholar] [CrossRef] [Scilit]
- Russell, J.T. Themed Section: Imaging-the Interface with Pharmacology Imaging Calcium Signals in Vivo: A Powerful Tool in Physiology and Pharmacology. Br. J. Pharmacol. 2011, 163, 1605–1625. [Google Scholar] [CrossRef] [Scilit]
- Rosa, R.; Monteleone, F.; Zambrano, N.; Bianco, R. In Vitro and In Vivo Models for Analysis of Resistance to Anticancer Molecular Therapies. Curr. Med. Chem. 2014, 21, 1595–1606. [Google Scholar] [CrossRef] [Scilit]
- Robey, R.W.; Pluchino, K.M.; Hall, M.D.; Fojo, A.T.; Bates, S.E.; Gottesman, M.M. Revisiting the Role of ABC Transporters in Multidrug-Resistant Cancer. Nat. Rev. Cancer 2018, 18, 452–464. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pote, M.S.; Gacche, R.N. ATP-Binding Cassette Efflux Transporters and MDR in Cancer. Drug Discov. Today 2023, 28, 103537. [Google Scholar] [CrossRef] [Scilit]
- Sato, H.; Kusel, J.R.; Thornhill, J. Excretion of Fluorescent Substrates of Mammalian Multidrug Resistance-Associated Protein (MRP) in the Schistosoma Mansoni Excretory System. Parasitology 2004, 128, 43–52. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Koizumi, S.; Konishi, M.; Ichihara, T.; Wada, H.; Matsukawa, H.; Goi, K.; Mizutani, S. Flow Cytometric Functional Analysis of Multidrug Resistance by Fluo-3: A Comparison With Rhodamine. Eur. J. Cancer 1995, 31, 1682–1688. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nelson, E.J.; Zinkin, N.T.; Hinkle, P.M. Fluorescence Methods to Assess Multidrug Resistance in Individual Cells. Cancer Chemother. Pharmacol. 1998, 42, 292–299. [Google Scholar] [CrossRef] [Scilit]
- Orlický, J.; Sulová, Z.; Dovinová, I.; Fiala, R.; Zahradníková, A.; Breier, A. Functional Fluo-3/AM Assay on P-Glycoprotein Transport Activity in L1210/VCR Cells by Confocal Microscopy. Gen. Physiol. Biophys. 2004, 23, 357–366. [Google Scholar] [PubMed]
- Sulová, Z.; Orlický, J.; Fiala, R.; Dovinová, I.; Uhrík, B.; Šereš, M.; Gibalová, L.; Breier, A. Expression of P-Glycoprotein in L1210 Cells Is Linked with Rise in Sensitivity to Ca2+. Biochem. Biophys. Res. Commun. 2005, 335, 777–784. [Google Scholar] [CrossRef] [Scilit]
- Imrichova, D.; Messingerova, L.; Seres, M.; Kavcova, H.; Pavlikova, L.; Coculova, M.; Breier, A.; Sulova, Z. Selection of Resistant Acute Myeloid Leukemia SKM-1 and MOLM-13 Cells by Vincristine-, Mitoxantrone- and Lenalidomide-Induced Upregulation of P-Glycoprotein Activity and Downregulation of CD33 Cell Surface Exposure. Eur. J. Pharm. Sci. 2015, 77, 29–39. [Google Scholar] [CrossRef] [Scilit]
- Elefantova, K.; Lakatos, B.; Kubickova, J.; Sulova, Z.; Breier, A. Detection of the Mitochondrial Membrane Potential by the Cationic Dye JC-1 in L1210 Cells with Massive Overexpression of the Plasma Membrane ABCB1 Drug Transporter. Int. J. Mol. Sci. 2018, 19, 1985. [Google Scholar] [CrossRef] [Scilit]
- Sulova, Z.; Ditte, P.; Kurucova, T.; Polakova, E.; Rogozanova, K.; Gibalova, L.; Seres, M.; Skvarkova, L.; Sedlák, J.; Pastorek, J.; et al. The Presence of P-Glycoprotein in L1210 Cells Directly Induces Down-Regulation of Cell Surface Saccharide Targets of Concanavalin A. Anticancer. Res. 2010, 30, 3661–3668. [Google Scholar]
- Tiberghein, F.; Loor, F. Ranking of P-Glycoprotein Substrates and Inhibitors by a Calcein-AM Fluorometry Screening Assay. Anticancer. Drugs 1996, 7, 568–578. [Google Scholar] [CrossRef] [Scilit]
- Szerémy, P.; Pál, Á.; Méhn, D.; Tóth, B.; Fülöp, F.; Krajcsi, P.; Herédi-Szabó, K. Comparison of 3 Assay Systems Using a Common Probe Substrate, Calcein AM, for Studying P-Gp Using a Selected Set of Compounds. J. Biomol. Screen 2011, 16, 112–119. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yin, Y.; Shen, H. Common Methods in Mitochondrial Research (Review). Int. J. Mol. Med. 2022, 50, 126. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Homolya, L.; Hollo, M.; Muller, M. A New Method for Quantitative Assessment of P-Glycoprotein-Related Multidrug Resistance in Tumour Cells. Br. J. Cancer 1996, 37, 849–855. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Invitrogen European Headquarters: Fluo Calcium Indicators. In Molecular Probes—Invitrogen detection technologies. Manual No. 01240. (2011.) Retrieved 6.4.2024. Available online: https://www.thermofisher.com/document-connect/document-connect.html?url=https://assets.thermofisher.com/TFS-Assets%2FLSG%2Fmanuals%2Fmp01240.pdf (accessed on 23 January 2024).
- Sulová, Z.; Šereš, M.; Barančík, M.; Gibalová, L.; Uhrík, B.; Poleková, L.; Breier, A. Does Any Relationship Exist between P-Glycoprotein-Mediated Multidrug Resistance and Intracellular Calcium Homeostasis. Gen. Physiol. Biophys. 2009, 28, 89–95. [Google Scholar]
- Sukumaran, P.; Nascimento Da Conceicao, V.; Sun, Y.; Ahamad, N.; Saraiva, L.R.; Selvaraj, S.; Singh, B.B. Calcium Signaling Regulates Autophagy and Apoptosis. Cells 2021, 10, 2125. [Google Scholar] [CrossRef] [Scilit]
- Shoshan-Barmatz, V.; De, S.; Meir, A. The Mitochondrial Voltage-Dependent Anion Channel 1, Ca2+ Transport, Apoptosis, and Their Regulation. Front. Oncol 2017, 7, 60. [Google Scholar] [CrossRef] [Scilit]
- Stewart, T.A.; Azimi, I.; Thompson, E.W.; Roberts-Thomson, S.J.; Monteith, G.R. A Role for Calcium in the Regulation of ATP-Binding Cassette, Sub-Family C, Member 3 (ABCC3) Gene Expression in a Model of Epidermal Growth Factor-Mediated Breast Cancer Epithelial-Mesenchymal Transition. Biochem. Biophys. Res. Commun. 2015, 458, 509–514. [Google Scholar] [CrossRef] [Scilit]
- Szakács, G.; Paterson, J.K.; Ludwig, J.A.; Booth-Genthe, C.; Gottesman, M.M. Targeting Multidrug Resistance in Cancer. Nat. Rev. Drug Discov. 2006, 5, 219–234. [Google Scholar] [CrossRef] [Scilit]
- Hamed, A.R.; Abdel-Azim, N.S.; Shams, K.A.; Hammouda, F.M. Targeting Multidrug Resistance in Cancer by Natural Chemosensitizers. Bull Natl. Res. Cent. 2019, 43, 219–234. [Google Scholar] [CrossRef] [Scilit]
- Weidner, L.D.; Fung, K.L.; Kannan, P.; Moen, J.K.; Kumar, J.S.; Mulder, J.; Innis, R.B.; Gottesman, M.M.; Hall, M.D. Tariquidar Is an Inhibitor and Not a Substrate of Human and Mouse P-Glycoprotein. Drug Metab. Dispos. 2016, 44, 275–282. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fox, E.; Bates, S.E. Tariquidar (XR9576): A P-Glycoprotein Drug Efflux Pump Inhibitor. Expert Rev. Anticancer Ther. 2007, 7, 447–459. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Alam, A.; Kowal, J.; Broude, E.; Roninson, I.; Locher, K.P. Structural Insight into Substrate and Inhibitor Discrimination by Human P-Glycoprotein. Science 2019, 363, 753–756. [Google Scholar] [CrossRef] [Scilit]
- Stewart, T.A.; Yapa, K.T.D.S.; Monteith, G.R. Altered Calcium Signaling in Cancer Cells. Biochim. Biophys. Acta Biomembr. 2015, 1848, 2502–2511. [Google Scholar] [CrossRef] [Scilit]
- Eneroth, A.; Aström, E.; Hoogstraate, J.; Schrenk, D.; Conrad, S.; Kauffmann, H.-M.; Gjellan, K. Evaluation of a Vincristine Resistant Caco-2 Cell Line for Use in a Calcein AM Extrusion Screening Assay for P-Glycoprotein Interaction. Eur. J. Pharm. Sci. 2001, 12, 205–214. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Singh, B.N.; Ellrodt, G.; Peter, C.T. Verapamil: A Review of Its Pharmacological Properties and Therapeutic Use. Drugs 1978, 15, 169–197. [Google Scholar] [CrossRef] [Scilit]
- Hagen, B.M.; Boyman, L.; Kao, J.P.Y.; Lederer, W.J. A Comparative Assessment of Fluo Ca2+ Indicators in Rat Ventricular Myocytes. Cell Calcium 2012, 52, 170–181. [Google Scholar] [CrossRef] [Scilit]
- Romito, O.; Guéguinou, M.; Raoul, W.; Champion, O.; Robert, A.; Trebak, M.; Goupille, C.; Potier-Cartereau, M. Calcium Signaling: A Therapeutic Target to Overcome Resistance to Therapies in Cancer. Cell Calcium 2022, 108, 102673. [Google Scholar] [CrossRef] [Scilit]







| Cell Variant | Control (Unstained) | Control (Calcein-AM) | ZSQ (0.25 μM) | ZSQ (0.50 μM) | |
|---|---|---|---|---|---|
| S | means ± SD p-value | 3.36 ± 0.02 | 6.04 ± 0.19 0.027 * | 6.31 ± 0.30 0.126 | 6.31 ± 0.35 0.079 |
| R | means ± SD p-value | 3.34 ± 0.01 | 4.51 ± 0.16 0.029 * | 5.91 ± 0.24 0.056 | 5.85 ± 0.29 0.102 |
| T | means ± SD p-value | 3.22 ± 0.01 | 5.32 ± 0.20 0.038 * | 5.74 ± 0.18 0.037 * | 5.88 ± 0.18 0.031 * |
| SKM-1 | means ± SD p-value | 3,26 ± 0,03 | 5.95 ± 0.15 0.004 ** | 5.85 ± 1.09 0.060 | 5.98 ± 0.14 0.002 ** |
| SKM-1/vcr | means ± SD p-value | 3.28 ± 0.01 | 5.35 ± 0.20 0.020 * | 6.16 ± 0.12 0.001 *** | 6.18 ± 0.01 0.001 *** |
| MOLM-13 | means ± SD p-value | 3.36 ± 0.04 | 6.04 ± 0.22 0.028 * | 6.09 ± 0.30 0.072 | 6.06 ± 0.20 0.022 |
| MOLM-13/vcr | means ± SD p-value | 3.36 ± 0.15 | 5.16 ± 0.34 0.067 | 5.83 ± 0.42 0.111 | 5.86 ± 0.36 0.128 |
| Gene | Forward Primer | Reverse Primer | Size (bp) |
|---|---|---|---|
| Human GAPDH | ATCGTGGAAGGACTCATGACC | GCCATCACGCCACAGTTTC | 90 |
| Mouse GAPDH | AGCTTCGGCACATATTTCATCTG | CGTTCACTCCCATGACAAACA | 89 |
| Human ABCB1 | GACAGCTACAGCACGGAAGG | CTGAAGCACTGGGATGTCCG | 108 |
| Mouse Abcb1 | GGCTGTTAAAGGTAACTCC | TGTTCTCTTATGAATCACGTA | 152 |
| Human MRP1 | CCGTGTACTCCAACGCTGACAT | ATGCTGTGCGTGACCAAGATCC | 145 |
| Mouse MRP1 | ACCAGCAACCCCGACTTTAC | TGGTTTTGTTGAGGTGTGTCA | 151 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pelegrinova, L.; Sofrankova, L.; Spaldova, J.; Stefik, P.; Sulova, Z.; Breier, A.; Elefantova, K. Zosuquidar: An Effective Molecule for Intracellular Ca2+ Measurement in P-gp Positive Cells. Int. J. Mol. Sci. 2024, 25, 3107. https://doi.org/10.3390/ijms25063107
Pelegrinova L, Sofrankova L, Spaldova J, Stefik P, Sulova Z, Breier A, Elefantova K. Zosuquidar: An Effective Molecule for Intracellular Ca2+ Measurement in P-gp Positive Cells. International Journal of Molecular Sciences. 2024; 25(6):3107. https://doi.org/10.3390/ijms25063107
Chicago/Turabian StylePelegrinova, Livia, Lucia Sofrankova, Jana Spaldova, Pavol Stefik, Zdena Sulova, Albert Breier, and Katarina Elefantova. 2024. "Zosuquidar: An Effective Molecule for Intracellular Ca2+ Measurement in P-gp Positive Cells" International Journal of Molecular Sciences 25, no. 6: 3107. https://doi.org/10.3390/ijms25063107
APA StylePelegrinova, L., Sofrankova, L., Spaldova, J., Stefik, P., Sulova, Z., Breier, A., & Elefantova, K. (2024). Zosuquidar: An Effective Molecule for Intracellular Ca2+ Measurement in P-gp Positive Cells. International Journal of Molecular Sciences, 25(6), 3107. https://doi.org/10.3390/ijms25063107

