Improvement of Osteogenic Differentiation of Mouse Pre-Osteoblastic MC3T3-E1 Cells on Core–Shell Polylactic Acid/Chitosan Electrospun Scaffolds for Bone Defect Repair
Abstract
:1. Introduction
2. Results and Discussion
2.1. Coating Efficacy, Morphology, and Wettability of Scaffolds
2.2. Mechanical Properties of Hybrid Scaffolds
2.3. Thermal Properties of the Scaffolds
2.4. Chitosan Coating Resistance in PBS
2.5. Scaffolds Mineralization in SBF
2.6. Scaffolds Biocompatibility
2.7. Effect of Chitosan Coating and Plasma Treatment in Cell Differentiation
3. Materials and Methods
3.1. Materials
3.2. PLA Electrospun Scaffolds Fabrication
3.3. Plasma Pretreatment of the PLA Scaffolds
3.4. Density, Porosity, and Water Uptake Measurements
3.5. Morphological Analysis
3.6. Chitosan Solution Preparation and PLA Microfibers Coating
3.7. Chitosan Concentration in Hybrid Scaffolds
3.8. Water Contact Angle Measurements
3.9. Mechanical Properties
3.10. FT-IR/ATR Analysis
3.11. X-ray Photoelectron Spectroscopy Analysis
3.12. Chitosan Stability
3.13. Differential Scanning Calorimetry
3.14. Incubation of Scaffold in SBF
3.15. Biological Evaluation
3.16. Cell Proliferation Assay
3.17. SEM Analysis on Cellularized Scaffolds
3.18. Mineralization Detection and Quantification: Alizarin Red S Assay
3.19. RNA Isolation and cDNA Synthesis
3.20. qPCR Analyses
3.21. Statistical Analysis
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Lopresti, F.; Campora, S.; Tirri, G.; Capuana, E.; Carfì Pavia, F.; Brucato, V.; Ghersi, G.; La Carrubba, V. Core-Shell PLA/Kef Hybrid Scaffolds for Skin Tissue Engineering Applications Prepared by Direct Kefiran Coating on PLA Electrospun Fibers Optimized via Air-Plasma Treatment. Mater. Sci. Eng. C 2021, 127, 112248. [Google Scholar] [CrossRef] [PubMed]
- Xie, Y.; Zhang, F.; Akkus, O.; King, M.W. A Collagen/PLA Hybrid Scaffold Supports Tendon-Derived Cell Growth for Tendon Repair and Regeneration. J. Biomed. Mater. Res. B Appl. Biomater. 2022, 110, 2624–2635. [Google Scholar] [CrossRef] [PubMed]
- Tóth, K.; Nagy, K.S.; Güler, Z.; Juhász, Á.G.; Pállinger, É.; Varga, G.; Sarac, A.S.; Zrínyi, M.; Jedlovszky-Hajdú, A.; Juriga, D. Characterization of Electrospun Polysuccinimide-Dopamine Conjugates and Effect on Cell Viability and Uptake. Macromol. Biosci. 2023, 23, e2200397. [Google Scholar] [CrossRef] [PubMed]
- Shi, X.; Zhou, T.; Huang, S.; Yao, Y.; Xu, P.; Hu, S.; Tu, C.; Yin, W.; Gao, C.; Ye, J. An Electrospun Scaffold Functionalized with a ROS-Scavenging Hydrogel Stimulates Ocular Wound Healing. Acta Biomater. 2023, 158, 266–280. [Google Scholar] [CrossRef] [PubMed]
- Ebrahimi, Z.; Irani, S.; Ardeshirylajimi, A.; Seyedjafari, E. Enhanced Osteogenic Differentiation of Stem Cells by 3D Printed PCL Scaffolds Coated with Collagen and Hydroxyapatite. Sci. Rep. 2022, 12, 12359. [Google Scholar] [CrossRef] [PubMed]
- Homaeigohar, S.; Boccaccini, A.R. Antibacterial Biohybrid Nanofibers for Wound Dressings. Acta Biomater. 2020, 107, 25–49. [Google Scholar] [CrossRef] [PubMed]
- Rahmati, M.; Mills, D.K.; Urbanska, A.M.; Saeb, M.R.; Venugopal, J.R.; Ramakrishna, S.; Mozafari, M. Electrospinning for Tissue Engineering Applications. Prog. Mater. Sci. 2021, 117, 100721. [Google Scholar] [CrossRef]
- Lopresti, F.; Pavia, F.C.; Vitrano, I.; Kersaudy-Kerhoas, M.; Brucato, V.; La Carrubba, V. Effect of Hydroxyapatite Concentration and Size on Morpho-Mechanical Properties of PLA-Based Randomly Oriented and Aligned Electrospun Nanofibrous Mats. J. Mech. Behav. Biomed. Mater. 2020, 101, 103449. [Google Scholar] [CrossRef] [PubMed]
- Shi, S.; Si, Y.; Han, Y.; Wu, T.; Iqbal, M.I.; Fei, B.; Li, R.K.Y.; Hu, J.; Qu, J. Recent Progress in Protective Membranes Fabricated via Electrospinning: Advanced Materials, Biomimetic Structures, and Functional Applications. Adv. Mater. 2022, 34, 2107938. [Google Scholar] [CrossRef] [PubMed]
- Mosher, C.Z.; Brudnicki, P.A.P.; Gong, Z.; Childs, H.R.; Lee, S.W.; Antrobus, R.M.; Fang, E.C.; Schiros, T.N.; Lu, H.H. Green Electrospinning for Biomaterials and Biofabrication. Biofabrication 2021, 13, 035049. [Google Scholar] [CrossRef] [PubMed]
- Parham, S.; Kharazi, A.Z.; Bakhsheshi-Rad, H.R.; Ghayour, H.; Ismail, A.F.; Nur, H.; Berto, F. Electrospun Nano-Fibers for Biomedical and Tissue Engineering Applications: A Comprehensive Review. Materials 2020, 13, 2153. [Google Scholar] [CrossRef] [PubMed]
- Pi, W.; Zhang, Y.; Li, L.; Li, C.; Zhang, M.; Zhang, W.; Cai, Q.; Zhang, P. Polydopamine-Coated Polycaprolactone/Carbon Nanotube Fibrous Scaffolds Loaded with Brain-Derived Neurotrophic Factor for Peripheral Nerve Regeneration. Biofabrication 2022, 14, 035006. [Google Scholar] [CrossRef]
- Nagam Hanumantharao, S.; Rao, S. Multi-Functional Electrospun Nanofibers from Polymer Blends for Scaffold Tissue Engineering. Fibers 2019, 7, 66. [Google Scholar] [CrossRef]
- Doostmohammadi, M.; Forootanfar, H.; Ramakrishna, S. Regenerative Medicine and Drug Delivery: Progress via Electrospun Biomaterials. Mater. Sci. Eng. C 2020, 109, 110521. [Google Scholar] [CrossRef]
- Miranda, C.S.; Silva, A.F.G.; Pereira-Lima, S.M.M.A.; Costa, S.P.G.; Homem, N.C.; Felgueiras, H.P. Tunable Spun Fiber Constructs in Biomedicine: Influence of Processing Parameters in the Fibers’ Architecture. Pharmaceutics 2022, 14, 164. [Google Scholar] [CrossRef] [PubMed]
- Pant, B.; Park, M.; Park, S.-J. Drug Delivery Applications of Core-Sheath Nanofibers Prepared by Coaxial Electrospinning: A Review. Pharmaceutics 2019, 11, 305. [Google Scholar] [CrossRef]
- Atila, D.; Hasirci, V.; Tezcaner, A. Coaxial Electrospinning of Composite Mats Comprised of Core/Shell Poly (Methyl Methacrylate)/Silk Fibroin Fibers for Tissue Engineering Applications. J. Mech. Behav. Biomed. Mater. 2022, 128, 105105. [Google Scholar] [CrossRef] [PubMed]
- Ma, L.; Shi, X.; Zhang, X.; Li, L. Electrospinning of Polycaprolacton/Chitosan Core-Shell Nanofibers by a Stable Emulsion System. Colloids Surf. A Physicochem. Eng. Asp. 2019, 583, 123956. [Google Scholar] [CrossRef]
- Arif, Z.U.; Khalid, M.Y.; Noroozi, R.; Sadeghianmaryan, A.; Jalalvand, M.; Hossain, M. Recent Advances in 3D-Printed Polylactide and Polycaprolactone-Based Biomaterials for Tissue Engineering Applications. Int. J. Biol. Macromol. 2022, 218, 930–968. [Google Scholar] [CrossRef] [PubMed]
- de França, J.O.C.; da Silva Valadares, D.; Paiva, M.F.; Dias, S.C.L.; Dias, J.A. Polymers Based on PLA from Synthesis Using D, L-Lactic Acid (or Racemic Lactide) and Some Biomedical Applications: A Short Review. Polymers 2022, 14, 2317. [Google Scholar] [CrossRef]
- Capuana, E.; Lopresti, F.; Ceraulo, M.; La Carrubba, V. Poly-l-Lactic Acid (PLLA)-Based Biomaterials for Regenerative Medicine: A Review on Processing and Applications. Polymers 2022, 14, 1153. [Google Scholar] [CrossRef]
- Baranwal, A.; Kumar, A.; Priyadharshini, A.; Oggu, G.S.; Bhatnagar, I.; Srivastava, A.; Chandra, P. Chitosan: An Undisputed Bio-Fabrication Material for Tissue Engineering and Bio-Sensing Applications. Int. J. Biol. Macromol. 2018, 110, 110–123. [Google Scholar] [CrossRef]
- Yadav, L.R.; Chandran, S.V.; Lavanya, K.; Selvamurugan, N. Chitosan-Based 3D-Printed Scaffolds for Bone Tissue Engineering. Int. J. Biol. Macromol. 2021, 183, 1925–1938. [Google Scholar] [CrossRef]
- Ahmed, S.; Annu; Ali, A.; Sheikh, J. A Review on Chitosan Centred Scaffolds and Their Applications in Tissue Engineering. Int. J. Biol. Macromol. 2018, 116, 849–862. [Google Scholar] [CrossRef]
- Li, B.; Wang, Y.; Jia, D.; Zhou, Y. Gradient Structural Bone-like Apatite Induced by Chitosan Hydrogel via Ion Assembly. J. Biomater. Sci. Polym. Ed. 2011, 22, 505–517. [Google Scholar] [CrossRef] [PubMed]
- Wu, P.; Xi, X.; Li, R.; Sun, G. Engineering Polysaccharides for Tissue Repair and Regeneration. Macromol. Biosci. 2021, 21, 2100141. [Google Scholar] [CrossRef] [PubMed]
- Hou, J.-W.; Qian, L.; Kou, J.-M.; Zhang, C.-W.; Jia, X.-J.; Tian, W. Effect of Water-Soluble Chitosan on the Osteoblast Function in MC3T3-E1 Cells. Int. J. Biol. Macromol. 2015, 72, 1041–1043. [Google Scholar] [CrossRef]
- Mathews, S.; Gupta, P.K.; Bhonde, R.; Totey, S. Chitosan Enhances Mineralization during Osteoblast Differentiation of Human Bone Marrow-Derived Mesenchymal Stem Cells, by Upregulating the Associated Genes. Cell Prolif. 2011, 44, 537–549. [Google Scholar] [CrossRef] [PubMed]
- Singh, S.; Singh, G.; Prakash, C.; Ramakrishna, S.; Lamberti, L.; Pruncu, C.I. 3D Printed Biodegradable Composites: An Insight into Mechanical Properties of PLA/Chitosan Scaffold. Polym. Test. 2020, 89, 106722. [Google Scholar] [CrossRef]
- Radwan-Pragłowska, J.; Janus, Ł.; Piątkowski, M.; Bogdał, D.; Matýsek, D. Hybrid Bilayer PLA/Chitosan Nanofibrous Scaffolds Doped with ZnO, Fe3O4, and Au Nanoparticles with Bioactive Properties for Skin Tissue Engineering. Polymers 2020, 12, 159. [Google Scholar] [CrossRef] [PubMed]
- Azadmanesh, F.; Pourmadadi, M.; Zavar Reza, J.; Yazdian, F.; Omidi, M.; Haghirosadat, B.F. Synthesis of a Novel Nanocomposite Containing Chitosan as a Three-Dimensional Printed Wound Dressing Technique: Emphasis on Gene Expression. Biotechnol. Prog. 2021, 37, e3132. [Google Scholar] [CrossRef] [PubMed]
- Seidi, F.; Yazdi, M.K.; Jouyandeh, M.; Dominic, M.; Naeim, H.; Nezhad, M.N.; Bagheri, B.; Habibzadeh, S.; Zarrintaj, P.; Saeb, M.R.; et al. Chitosan-Based Blends for Biomedical Applications. Int. J. Biol. Macromol. 2021, 183, 1818–1850. [Google Scholar] [CrossRef] [PubMed]
- Milanesi, G.; Vigani, B.; Rossi, S.; Sandri, G.; Mele, E. Chitosan-Coated Poly(Lactic Acid) Nanofibres Loaded with Essential Oils for Wound Healing. Polymers 2021, 13, 2582. [Google Scholar] [CrossRef] [PubMed]
- Sarukawa, J.; Takahashi, M.; Abe, M.; Suzuki, D.; Tokura, S.; Furuike, T.; Tamura, H. Effects of Chitosan-Coated Fibers as a Scaffold for Three-Dimensional Cultures of Rabbit Fibroblasts for Ligament Tissue Engineering. J. Biomater. Sci. Polym. Ed. 2011, 22, 717–732. [Google Scholar] [CrossRef] [PubMed]
- Pon-On, W.; Suntornsaratoon, P.; Charoenphandhu, N.; Thongbunchoo, J.; Krishnamra, N.; Tang, I.M. Synthesis and Investigations of Mineral Ions-Loaded Apatite from Fish Scale and PLA/Chitosan Composite for Bone Scaffolds. Mater. Lett. 2018, 221, 143–146. [Google Scholar] [CrossRef]
- Singh, R.; Barwar, A.; Kumar, R.; Kumar, V. On Mechanically Recycled PLA-HAP-CS-Based Filaments for 3D Printing of Smart Biomedical Scaffolds. J. Braz. Soc. Mech. Sci. Eng. 2022, 44, 416. [Google Scholar] [CrossRef]
- Humberto Valencia, C. Hydrolytic Degradation and in Vivo Resorption of Poly-l-Lactic Acid-Chitosan Biomedical Devices in the Parietal Bones of Wistar Rats. J. Int. Med. Res. 2019, 47, 1705–1716. [Google Scholar] [CrossRef] [PubMed]
- Nazeer, M.A.; Onder, O.C.; Sevgili, I.; Yilgor, E.; Kavakli, I.H.; Yilgor, I. 3D Printed Poly(Lactic Acid) Scaffolds Modified with Chitosan and Hydroxyapatite for Bone Repair Applications. Mater. Today Commun. 2020, 25, 101515. [Google Scholar] [CrossRef]
- Chen, G.; Chen, Y.; Jin, N.; Li, J.; Dong, S.; Li, S.; Zhang, Z.; Chen, Y. Zein Films with Porous Polylactic Acid Coatings via Cold Plasma Pre-Treatment. Ind. Crops Prod. 2020, 150, 112382. [Google Scholar] [CrossRef]
- Scaffaro, R.; Lopresti, F.; Sutera, A.; Botta, L.; Fontana, R.M.; Gallo, G. Plasma Modified PLA Electrospun Membranes for Actinorhodin Production Intensification in Streptomyces Coelicolor A3(2) Immobilized-Cell Cultivations. Colloids Surf. B Biointerfaces 2017, 157, 233–241. [Google Scholar] [CrossRef] [PubMed]
- Lopresti, F.; Liga, A.; Capuana, E.; Gulfi, D.; Zanca, C.; Inguanta, R.; Brucato, V.; La Carrubba, V.; Carfì Pavia, F. Effect of Polyhydroxyalkanoate (PHA) Concentration on Polymeric Scaffolds Based on Blends of Poly-L-Lactic Acid (PLLA) and PHA Prepared via Thermally Induced Phase Separation (TIPS). Polymers 2022, 14, 2494. [Google Scholar] [CrossRef] [PubMed]
- Matet, M.; Heuzey, M.C.; Pollet, E.; Ajji, A.; Avérous, L. Innovative Thermoplastic Chitosan Obtained by Thermo-Mechanical Mixing with Polyol Plasticizers. Carbohydr. Polym. 2013, 95, 241–251. [Google Scholar] [CrossRef] [PubMed]
- Zanca, C.; Carbone, S.; Patella, B.; Lopresti, F.; Aiello, G.; Brucato, V.; Carfì Pavia, F.; La Carrubba, V.; Inguanta, R. Composite Coatings of Chitosan and Silver Nanoparticles Obtained by Galvanic Deposition for Orthopedic Implants. Polymers 2022, 14, 3915. [Google Scholar] [CrossRef] [PubMed]
- Lawrie, G.; Keen, I.; Drew, B.; Chandler-Temple, A.; Rintoul, L.; Fredericks, P.; Grøndahl, L. Interactions between Alginate and Chitosan Biopolymers Characterized Using FTIR and XPS. Biomacromolecules 2007, 8, 2533–2541. [Google Scholar] [CrossRef] [PubMed]
- Sui, W.; Huang, L.; Wang, J.; Bo, Q. Preparation and Properties of Chitosan Chondroitin Sulfate Complex Microcapsules. Colloids Surf. B Biointerfaces 2008, 65, 69–73. [Google Scholar] [CrossRef] [PubMed]
- Kurusu, R.S.; Demarquette, N.R. Surface Modification to Control the Water Wettability of Electrospun Mats. Int. Mater. Rev. 2019, 64, 249–287. [Google Scholar] [CrossRef]
- Cavallaro, G.; Donato, D.I.; Lazzara, G.; Milioto, S. Films of Halloysite Nanotubes Sandwiched between Two Layers of Biopolymer: From the Morphology to the Dielectric, Thermal, Transparency, and Wettability Properties. J. Phys. Chem. C 2011, 115, 20491–20498. [Google Scholar] [CrossRef]
- Borkotoky, S.S.; Pal, A.K.; Katiyar, V. Poly (Lactic Acid)/Modified Chitosan-Based Microcellular Foams: Thermal and Crystallization Behavior with Wettability and Porosimetric Investigations. J. Appl. Polym. Sci. 2019, 136, 47236. [Google Scholar] [CrossRef]
- Laput, O.; Vasenina, I.; Salvadori, M.C.; Savkin, K.; Zuza, D.; Kurzina, I. Low-Temperature Plasma Treatment of Polylactic Acid and PLA/HA Composite Material. J. Mater. Sci. 2019, 54, 11726–11738. [Google Scholar] [CrossRef]
- Luque-Agudo, V.; Hierro-Oliva, M.; Gallardo-Moreno, A.M.; González-Martín, M.L. Effect of Plasma Treatment on the Surface Properties of Polylactic Acid Films. Polym. Test. 2021, 96, 107097. [Google Scholar] [CrossRef]
- Baig, U.; Faizan, M.; Waheed, A. A Review on Super-Wettable Porous Membranes and Materials Based on Bio-Polymeric Chitosan for Oil-Water Separation. Adv. Colloid Interface Sci. 2022, 303, 102635. [Google Scholar] [CrossRef] [PubMed]
- Amaral, M.; Lopes, M.A.; Santos, J.D.; Silva, R.F. Wettability and Surface Charge of Si3N4–Bioglass Composites in Contact with Simulated Physiological Liquids. Biomaterials 2002, 23, 4123–4129. [Google Scholar] [CrossRef]
- Theapsak, S.; Watthanaphanit, A.; Rujiravanit, R. Preparation of Chitosan-Coated Polyethylene Packaging Films by DBD Plasma Treatment. ACS Appl. Mater. Interfaces 2012, 4, 2474–2482. [Google Scholar] [CrossRef] [PubMed]
- Lopresti, F.; Keraite, I.; Ongaro, A.E.; Howarth, N.M.; La Carrubba, V.; Kersaudy-Kerhoas, M. Engineered Membranes for Residual Cell Trapping on Microfluidic Blood Plasma Separation Systems: A Comparison between Porous and Nanofibrous Membranes. Membranes 2021, 11, 680. [Google Scholar] [CrossRef]
- Fiore, V.; Botta, L.; Scaffaro, R.; Valenza, A.; Pirrotta, A. PLA Based Biocomposites Reinforced with Arundo Donax Fillers. Compos. Sci. Technol. 2014, 105, 110–117. [Google Scholar] [CrossRef]
- Sousa, S.; Costa, A.; Silva, A.; Simões, R. Poly (Lactic Acid)/Cellulose Films Produced from Composite Spheres Prepared by Emulsion-Solvent Evaporation Method. Polymers 2019, 11, 66. [Google Scholar] [CrossRef] [PubMed]
- Qiao, C.; Ma, X.; Wang, X.; Liu, L. Structure and Properties of Chitosan Films: Effect of the Type of Solvent Acid. LWT 2021, 135, 109984. [Google Scholar] [CrossRef]
- Nair, R.S.; Morris, A.; Billa, N.; Leong, C.-O. An Evaluation of Curcumin-Encapsulated Chitosan Nanoparticles for Transdermal Delivery. AAPS PharmSciTech 2019, 20, 69. [Google Scholar] [CrossRef] [PubMed]
- Ferrero, F.; Periolatto, M. Antimicrobial Finish of Textiles by Chitosan UV-Curing. J. Nanosci. Nanotechnol. 2012, 12, 4803–4810. [Google Scholar] [CrossRef] [PubMed]
- Lin, C.-C.; Fu, S.-J.; Lin, Y.-C.; Yang, I.-K.; Gu, Y. Chitosan-Coated Electrospun PLA Fibers for Rapid Mineralization of Calcium Phosphate. Int. J. Biol. Macromol. 2014, 68, 39–47. [Google Scholar] [CrossRef] [PubMed]
- Martín-López, E.; Nieto-Díaz, M.; Nieto-Sampedro, M. Influence of Chitosan Concentration on Cell Viability and Proliferation in Vitro by Changing Film Topography. J. Appl. Biomater. Funct. Mater. 2013, 11, 151–158. [Google Scholar] [CrossRef] [PubMed]
- Brun, P.; Zamuner, A.; Battocchio, C.; Cassari, L.; Todesco, M.; Graziani, V.; Iucci, G.; Marsotto, M.; Tortora, L.; Secchi, V.; et al. Bio-Functionalized Chitosan for Bone Tissue Engineering. Int. J. Mol. Sci. 2021, 22, 5916. [Google Scholar] [CrossRef] [PubMed]
- Heinemann, C.; Heinemann, S.; Bernhardt, A.; Worch, H.; Hanke, T. Novel Textile Chitosan Scaffolds Promote Spreading, Proliferation, and Differentiation of Osteoblasts. Biomacromolecules 2008, 9, 2913–2920. [Google Scholar] [CrossRef]
- Chen, Y.; Dong, X.; Shafiq, M.; Myles, G.; Radacsi, N.; Mo, X. Recent Advancements on Three-Dimensional Electrospun Nanofiber Scaffolds for Tissue Engineering. Adv. Fiber Mater. 2022, 4, 959–986. [Google Scholar] [CrossRef]
- Filippi, M.; Born, G.; Chaaban, M.; Scherberich, A. Natural Polymeric Scaffolds in Bone Regeneration. Front. Bioeng. Biotechnol. 2020, 8, 474. [Google Scholar] [CrossRef] [PubMed]
- Venkatesan, J.; Kim, S.-K. Chitosan Composites for Bone Tissue Engineering—An Overview. Mar. Drugs 2010, 8, 2252–2266. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Kim, J.H.; Choi, E.H.; Han, I. Promotion of Osteogenic Differentiation by Non-Thermal Biocompatible Plasma Treated Chitosan Scaffold. Sci. Rep. 2019, 9, 3712. [Google Scholar] [CrossRef] [PubMed]
- Tominami, K.; Kanetaka, H.; Sasaki, S.; Mokudai, T.; Kaneko, T.; Niwano, Y. Cold Atmospheric Plasma Enhances Osteoblast Differentiation. PLoS ONE 2017, 12, e0180507. [Google Scholar] [CrossRef] [PubMed]
- Choi, B.-B.; Choi, J.-H.; Kang, T.-H.; Lee, S.-J.; Kim, G.-C. Enhancement of Osteoblast Differentiation Using No-Ozone Cold Plasma on Human Periodontal Ligament Cells. Biomedicines 2021, 9, 1542. [Google Scholar] [CrossRef] [PubMed]
- Wang, M.; Favi, P.; Cheng, X.; Golshan, N.H.; Ziemer, K.S.; Keidar, M.; Webster, T.J. Cold Atmospheric Plasma (CAP) Surface Nanomodified 3D Printed Polylactic Acid (PLA) Scaffolds for Bone Regeneration. Acta Biomater. 2016, 46, 256–265. [Google Scholar] [CrossRef]
- Kannan, S.; Ghosh, J.; Dhara, S.K. Osteogenic Differentiation Potential of Porcine Bone Marrow Mesenchymal Stem Cell Subpopulations Selected in Different Basal Media. Biol. Open 2020, 9, bio053280. [Google Scholar] [CrossRef] [PubMed]
- Ducy, P.; Karsenty, G. Two Distinct Osteoblast-Specific Cis-Acting Elements Control Expression of a Mouse Osteocalcin Gene. Mol. Cell. Biol. 1995, 15, 1858–1869. [Google Scholar] [CrossRef]
- Köllmer, M.; Buhrman, J.S.; Zhang, Y.; Gemeinhart, R.A. Markers Are Shared between Adipogenic and Osteogenic Differentiated Mesenchymal Stem Cells. J. Dev. Biol. Tissue Eng. 2013, 5, 18. [Google Scholar] [CrossRef] [PubMed]
- Morinobu, M.; Ishijima, M.; Rittling, S.R.; Tsuji, K.; Yamamoto, H.; Nifuji, A.; Denhardt, D.T.; Noda, M. Osteopontin Expression in Osteoblasts and Osteocytes during Bone Formation under Mechanical Stress in the Calvarial Suture In Vivo. J. Bone Miner. Res. 2003, 18, 1706–1715. [Google Scholar] [CrossRef] [PubMed]
- Malaval, L.; Modrowski, D.; Gupta, A.K.; Aubin, J.E. Cellular Expression of Bone-Related Proteins during in Vitro Osteogenesis in Rat Bone Marrow Stromal Cell Cultures. J. Cell. Physiol. 1994, 158, 555–572. [Google Scholar] [CrossRef] [PubMed]
- Holm, E.; Gleberzon, J.S.; Liao, Y.; Sørensen, E.S.; Beier, F.; Hunter, G.K.; Goldberg, H.A. Osteopontin Mediates Mineralization and Not Osteogenic Cell Development in Vitro. Biochem. J. 2014, 464, 355–364. [Google Scholar] [CrossRef]
- Hotaling, N.A.; Bharti, K.; Kriel, H.; Simon, C.G. DiameterJ: A Validated Open Source Nanofiber Diameter Measurement Tool. Biomaterials 2015, 61, 327–338. [Google Scholar] [CrossRef]
- Lagaron, J.M.; Fernandez-Saiz, P.; Ocio, M.J. Using ATR-FTIR Spectroscopy to Design Active Antimicrobial Food Packaging Structures Based on High Molecular Weight Chitosan Polysaccharide. J. Agric. Food Chem. 2007, 55, 2554–2562. [Google Scholar] [CrossRef] [PubMed]
- Sucharitha, K.V.; Beulah, A.M.; Ravikiran, K. Effect of Chitosan Coating on Storage Stability of Tomatoes (Lycopersicon esculentum Mill). Int. Food Res. J. 2018, 25, 93–99. [Google Scholar]
- Lopresti, F.; Pavia, F.C.; Ceraulo, M.; Capuana, E.; Brucato, V.; Ghersi, G.; Botta, L.; La Carrubba, V.; Carfì Pavia, F.; Ceraulo, M.; et al. Physical and Biological Properties of Electrospun Poly(d,l-Lactide)/Nanoclay and Poly(d,l-Lactide)/Nanosilica Nanofibrous Scaffold for Bone Tissue Engineering. J. Biomed. Mater. Res. A 2021, 109, 2120–2136. [Google Scholar] [CrossRef] [PubMed]
- Enderami, S.E.; Shafiei, S.S.; Shamsara, M.; Enderami, S.E.; Rostamian Tabari, A. Evaluation of Osteogenic Differentiation of Bone Marrow-Derived Mesenchymal Stem Cell on Highly Porous Polycaprolactone Scaffold Reinforced with Layered Double Hydroxides Nanoclay. Front. Bioeng. Biotechnol. 2022, 10, 805969. [Google Scholar] [CrossRef] [PubMed]
- Zanca, C.; Milazzo, A.; Campora, S.; Capuana, E.; Pavia, F.C.; Patella, B.; Lopresti, F.; Brucato, V.; La Carrubba, V.; Inguanta, R. Galvanic Deposition of Calcium Phosphate/Bioglass Composite Coating on AISI 316L. Coatings 2023, 13, 1006. [Google Scholar] [CrossRef]
Sample | C 1s (%) | O 1s (%) | O/C | C–C (%) ∼285 eV | C–O (%) ∼285 eV | O–C=O (%) ∼288.9 eV |
---|---|---|---|---|---|---|
PLA | 64.77 | 35.01 | 0.54 | 49.23 | 25.98 | 24.81 |
P-PLA | 62.02 | 37.21 | 0.60 | 40.43 | 29.74 | 30.12 |
Sample | C (wt%) | O (wt%) | N (wt%) |
---|---|---|---|
PLA | 17.1 | 82.9 | 0 |
PLA/Chi 0.5% | 15.1 | 81.3 | 3.6 |
PLA/Chi 1% | 15 | 81.3 | 3.7 |
PLA/Chi 2% | 14.9 | 81.3 | 3.8 |
P-PLA | 16.7 | 83.3 | 0 |
P-PLA/Chi 0.5% | 15.2 | 81.2 | 3.6 |
P-PLA/Chi 1% | 14.9 | 81.3 | 3.8 |
P-PLA/Chi 2% | 14.9 | 81.2 | 3.9 |
E (MPa) | TS (MPa) | εb (%) | |
---|---|---|---|
Dry condition | |||
PLA | 20.18 ± 1.21 a | 1.64 ± 0.19 a | 148.61 ± 11.40 a |
PLA/Chi 0.5% | 37.45 ± 2.45 b | 2.65 ± 0.31 b | 22.11 ± 1.74 b |
PLA/Chi 1% | 87.54 ± 4.76 c | 2.97 ± 0.30 b | 19.31 ± 1.53 b |
PLA/Chi 2% | 259.02 ± 15.13 d | 2.85 ± 0.18 b | 2.57 ± 0.28 c |
P-PLA | 20.95 ± 1.54 a | 1.16 ± 0.17 e | 153.70 ± 11.06 a |
P-PLA/Chi 0.5% | 41.11 ± 3.04 e | 2.86 ± 0.18 b | 14.77 ± 1.13 d |
P-PLA/Chi 1% | 110.57 ± 7.58 f | 3.75 ± 0.29 c | 11.09 ± 1.07 e |
P-PLA/Chi 2% | 892.64 ± 58.49 g | 7.37 ± 0.49 d | 1.76 ± 0.11 f |
In PBS at 37 °C | |||
PLA | 17.01 ± 1.01 a | 1.02 ± 0.13 a | 238.61 ± 23.42 a |
PLA/Chi 0.5% | 22.97 ± 2.78 b | 1.21 ± 0.18 a | 132.11 ± 12.04 b |
PLA/Chi 1% | 28.23 ± 3.96 c | 2.27 ± 0.20 b | 113.31 ± 9.98 b,c |
PLA/Chi 2% | 52.32 ± 5.66 d | 2.45 ± 0.22 b | 90.18 ± 6.28 d |
P-PLA | 18.15 ± 1.14 a | 0.91 ± 0.11 a | 249.37 ± 21.06 a |
P-PLA/Chi 0.5% | 20.50 ± 2.12 b | 1.51 ± 0.19 c | 120.14 ± 11.30 b |
P-PLA/Chi 1% | 34.39 ± 3.98 e | 2.01 ± 0.21 b | 110.9 ± 9.07 c |
P-PLA/Chi 2% | 107.57 ± 13.51 f | 2.09 ± 0.24 b | 93.09 ± 8.83 d |
Tg (°C) | Tcc (°C) | Tm1 (°C) | Tm2 (°C) | T0d-Chi (°C) | ΔHcc (j/g) | ΔHm (j/g) | Xc (%) | |
---|---|---|---|---|---|---|---|---|
PLA | 64.70 | 102.22 | 148.06 | 154.57 | - | 19.12 | 30.70 | 12.36 |
PLA/Chi 0.5% | 64.48 | 111.67 | 148.11 | 155.31 | 273 | 12.11 | 21.23 | 13.79 |
PLA/Chi 1% | 61.66 | 106.17 | 148.03 | 154.58 | 269 | 5.72 | 17.48 | 23.06 |
PLA/Chi 2% | 60.17 | - | - | 154.57 | 258 | - | 11.68 | 32.65 |
P-PLA | 64.23 | 108.84 | 147.98 | 154.38 | - | 19.31 | 31.00 | 12.48 |
P-PLA/Chi 0.5% | 63.40 | 111.68 | 148.22 | 155.09 | 272 | 13.01 | 21.11 | 12.25 |
P-PLA/Chi 1% | 62.59 | 101.18 | 147.64 | 155.08 | 268 | 9.20 | 17.3 | 15.88 |
P-PLA/Chi 2% | 62.01 | - | 150.54 | 155.07 | 265 | 3.22 | 12.21 | 25.13 |
Gene Name | Primers Sequence | Gene Bank Accession Number |
---|---|---|
18S rRNA | GCAATTATTCCCCATGAACG a GGCCTCACTAAACCATCCAA b | NR_003278.3 |
GAPDH | CATCACTGCCACCCAGAAGACTG a ATGCCAGTGAGCTTCCCGTTCAG b | NM_001289726.2 |
OPN | GCTTGGCTTATGGACTGAGGTC a CCTTAGACTCACCGCTCTTCATG b | NM_001204201.1 |
COL1A1 | TTCTGTGGGTCCTGCTGGGAAA a TTGTCACCTCGGATGCCTTGAG b | NM_007742.4 |
RUNX2 | CCTGAACTCTGCACCAAGTCCT a TCATCTGGCTCAGATAGGAGGG b | NM_001145920.2 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lopresti, F.; Campora, S.; Rigogliuso, S.; Nicosia, A.; Lo Cicero, A.; Di Marco, C.; Tornabene, S.; Ghersi, G.; La Carrubba, V. Improvement of Osteogenic Differentiation of Mouse Pre-Osteoblastic MC3T3-E1 Cells on Core–Shell Polylactic Acid/Chitosan Electrospun Scaffolds for Bone Defect Repair. Int. J. Mol. Sci. 2024, 25, 2507. https://doi.org/10.3390/ijms25052507
Lopresti F, Campora S, Rigogliuso S, Nicosia A, Lo Cicero A, Di Marco C, Tornabene S, Ghersi G, La Carrubba V. Improvement of Osteogenic Differentiation of Mouse Pre-Osteoblastic MC3T3-E1 Cells on Core–Shell Polylactic Acid/Chitosan Electrospun Scaffolds for Bone Defect Repair. International Journal of Molecular Sciences. 2024; 25(5):2507. https://doi.org/10.3390/ijms25052507
Chicago/Turabian StyleLopresti, Francesco, Simona Campora, Salvatrice Rigogliuso, Aldo Nicosia, Alessandra Lo Cicero, Chiara Di Marco, Salvatore Tornabene, Giulio Ghersi, and Vincenzo La Carrubba. 2024. "Improvement of Osteogenic Differentiation of Mouse Pre-Osteoblastic MC3T3-E1 Cells on Core–Shell Polylactic Acid/Chitosan Electrospun Scaffolds for Bone Defect Repair" International Journal of Molecular Sciences 25, no. 5: 2507. https://doi.org/10.3390/ijms25052507
APA StyleLopresti, F., Campora, S., Rigogliuso, S., Nicosia, A., Lo Cicero, A., Di Marco, C., Tornabene, S., Ghersi, G., & La Carrubba, V. (2024). Improvement of Osteogenic Differentiation of Mouse Pre-Osteoblastic MC3T3-E1 Cells on Core–Shell Polylactic Acid/Chitosan Electrospun Scaffolds for Bone Defect Repair. International Journal of Molecular Sciences, 25(5), 2507. https://doi.org/10.3390/ijms25052507