Developing a Novel and Optimized Yeast Model for Human VDAC Research
Abstract
1. Introduction
2. Results
2.1. The Phenotypes of the por1Δpor2Δ Double Mutants Derived from the M3 and BY4741 Strains Are Similar Under Restrictive Conditions
2.2. The por1Δpor2Δ Double Mutants Derived from the M3 and BY4741 Strains Differ in Complementation upon Heterologous Expression of Human VDAC Paralogs
2.3. The Effect of Cysteine Depletion in hVDAC3 on Yeast Cell Growth May Be Related to the Activity of Met15
3. Discussion
4. Materials and Methods
4.1. Plasmids
4.2. Strains and Culture Media
4.3. Yeast Genetic Modification
4.4. Analysis of Cell Growth
4.5. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Benz, R. Historical Perspective of Pore-Forming Activity Studies of Voltage-Dependent Anion Channel (Eukaryotic or Mitochondrial Porin) Since Its Discovery in the 70th of the Last Century. Front. Physiol. 2021, 12, 734226. [Google Scholar] [CrossRef] [PubMed]
- Benz, R. Permeation of Hydrophilic Solutes through Mitochondrial Outer Membranes: Review on Mitochondrial Porins. Biochim. Biophys. Acta (BBA) Rev. Biomembr. 1994, 1197, 167–196. [Google Scholar] [CrossRef]
- Colombini, M. VDAC Structure, Selectivity, and Dynamics. Biochim. Biophys. Acta 2012, 1818, 1457–1465. [Google Scholar] [CrossRef] [PubMed]
- De Pinto, V. Renaissance of VDAC: New Insights on a Protein Family at the Interface between Mitochondria and Cytosol. Biomolecules 2021, 11, 107. [Google Scholar] [CrossRef]
- Mannella, C.A. VDAC-A Primal Perspective. Int. J. Mol. Sci. 2021, 22, 1685. [Google Scholar] [CrossRef]
- Schein, S.J.; Colombini, M.; Finkelstein, A. Reconstitution in Planar Lipid Bilayers of a Voltage-Dependent Anion-Selective Channel Obtained from Paramecium Mitochondria. J. Membr. Biol. 1976, 30, 99–120. [Google Scholar] [CrossRef]
- Shoshan-Barmatz, V.; De Pinto, V.; Zweckstetter, M.; Raviv, Z.; Keinan, N.; Arbel, N. VDAC, a Multi-Functional Mitochondrial Protein Regulating Cell Life and Death. Mol. Aspects Med. 2010, 31, 227–285. [Google Scholar] [CrossRef]
- Heslop, K.A.; Milesi, V.; Maldonado, E.N. VDAC Modulation of Cancer Metabolism: Advances and Therapeutic Challenges. Front. Physiol. 2021, 12, 742839. [Google Scholar] [CrossRef]
- Homblé, F.; Krammer, E.-M.; Prévost, M. Plant VDAC: Facts and Speculations. Biochim. Biophys. Acta 2012, 1818, 1486–1501. [Google Scholar] [CrossRef]
- Bay, D.C.; Hafez, M.; Young, M.J.; Court, D.A. Phylogenetic and Coevolutionary Analysis of the β-Barrel Protein Family Comprised of Mitochondrial Porin (VDAC) and Tom40. Biochim. Biophys. Acta 2012, 1818, 1502–1519. [Google Scholar] [CrossRef]
- Young, M.J.; Bay, D.C.; Hausner, G.; Court, D.A. The Evolutionary History of Mitochondrial Porins. BMC Evol. Biol. 2007, 7, 31. [Google Scholar] [CrossRef] [PubMed]
- Ravi, B.; Kanwar, P.; Sanyal, S.K.; Bheri, M.; Pandey, G.K. VDACs: An Outlook on Biochemical Regulation and Function in Animal and Plant Systems. Front. Physiol. 2021, 12, 683920. [Google Scholar] [CrossRef] [PubMed]
- De Pinto, V.; Guarino, F.; Guarnera, A.; Messina, A.; Reina, S.; Tomasello, F.M.; Palermo, V.; Mazzoni, C. Characterization of Human VDAC Isoforms: A Peculiar Function for VDAC3? Biochim. Biophys. Acta 2010, 1797, 1268–1275. [Google Scholar] [CrossRef] [PubMed]
- Karachitos, A.; Grobys, D.; Antoniewicz, M.; Jedut, S.; Jordan, J.; Kmita, H. Human VDAC Isoforms Differ in Their Capability to Interact with Minocycline and to Contribute to Its Cytoprotective Activity. Mitochondrion 2016, 28, 38–48. [Google Scholar] [CrossRef]
- Komarov, A.G.; Graham, B.H.; Craigen, W.J.; Colombini, M. The Physiological Properties of a Novel Family of VDAC-like Proteins from Drosophila Melanogaster. Biophys. J. 2004, 86, 152–162. [Google Scholar] [CrossRef]
- Xu, X.; Decker, W.; Sampson, M.J.; Craigen, W.J.; Colombini, M. Mouse VDAC Isoforms Expressed in Yeast: Channel Properties and Their Roles in Mitochondrial Outer Membrane Permeability. J. Membr. Biol. 1999, 170, 89–102. [Google Scholar] [CrossRef]
- Blachly-Dyson, E.; Song, J.; Wolfgang, W.J.; Colombini, M.; Forte, M. Multicopy Suppressors of Phenotypes Resulting from the Absence of Yeast VDAC Encode a VDAC-like Protein. Mol. Cell. Biol. 1997, 17, 5727–5738. [Google Scholar] [CrossRef]
- Lee, A.C.; Xu, X.; Blachly-Dyson, E.; Forte, M.; Colombini, M. The Role of Yeast VDAC Genes on the Permeability of the Mitochondrial Outer Membrane. J. Membr. Biol. 1998, 161, 173–181. [Google Scholar] [CrossRef]
- Morgenstern, M.; Stiller, S.B.; Lübbert, P.; Peikert, C.D.; Dannenmaier, S.; Drepper, F.; Weill, U.; Höß, P.; Feuerstein, R.; Gebert, M.; et al. Definition of a High-Confidence Mitochondrial Proteome at Quantitative Scale. Cell Rep. 2017, 19, 2836–2852. [Google Scholar] [CrossRef]
- Magrì, A.; Di Rosa, M.C.; Orlandi, I.; Guarino, F.; Reina, S.; Guarnaccia, M.; Morello, G.; Spampinato, A.; Cavallaro, S.; Messina, A.; et al. Deletion of Voltage-Dependent Anion Channel 1 Knocks Mitochondria down Triggering Metabolic Rewiring in Yeast. Cell Mol. Life Sci. 2020, 77, 3195–3213. [Google Scholar] [CrossRef]
- Ellenrieder, L.; Dieterle, M.P.; Doan, K.N.; Mårtensson, C.U.; Floerchinger, A.; Campo, M.L.; Pfanner, N.; Becker, T. Dual Role of Mitochondrial Porin in Metabolite Transport across the Outer Membrane and Protein Transfer to the Inner Membrane. Mol. Cell 2019, 73, 1056–1065.e7. [Google Scholar] [CrossRef]
- Guardiani, C.; Magrì, A.; Karachitos, A.; Di Rosa, M.C.; Reina, S.; Bodrenko, I.; Messina, A.; Kmita, H.; Ceccarelli, M.; De Pinto, V. yVDAC2, the Second Mitochondrial Porin Isoform of Saccharomyces Cerevisiae. Biochim. Biophys. Acta Bioenerg. 2018, 1859, 270–279. [Google Scholar] [CrossRef]
- Leggio, L.; Guarino, F.; Magrì, A.; Accardi-Gheit, R.; Reina, S.; Specchia, V.; Damiano, F.; Tomasello, M.F.; Tommasino, M.; Messina, A. Mechanism of Translation Control of the Alternative Drosophila Melanogaster Voltage Dependent Anion-Selective Channel 1 mRNAs. Sci. Rep. 2018, 8, 5347. [Google Scholar] [CrossRef] [PubMed]
- Lohret, T.A.; Kinnally, K.W. Multiple Conductance Channel Activity of Wild-Type and Voltage-Dependent Anion-Selective Channel (VDAC)-Less Yeast Mitochondria. Biophys. J. 1995, 68, 2299–2309. [Google Scholar] [CrossRef] [PubMed]
- Schulte, U.; den Brave, F.; Haupt, A.; Gupta, A.; Song, J.; Müller, C.S.; Engelke, J.; Mishra, S.; Mårtensson, C.; Ellenrieder, L.; et al. Mitochondrial Complexome Reveals Quality-Control Pathways of Protein Import. Nature 2023, 614, 153–159. [Google Scholar] [CrossRef] [PubMed]
- Sousa, A.D.; Costa, A.L.; Costa, V.; Pereira, C. Prediction and Biological Analysis of Yeast VDAC1 Phosphorylation. Arch. Biochem. Biophys. 2024, 753, 109914. [Google Scholar] [CrossRef] [PubMed]
- Queralt-Martín, M.; Bergdoll, L.; Teijido, O.; Munshi, N.; Jacobs, D.; Kuszak, A.J.; Protchenko, O.; Reina, S.; Magrì, A.; De Pinto, V.; et al. A Lower Affinity to Cytosolic Proteins Reveals VDAC3 Isoform-Specific Role in Mitochondrial Biology. J. Gen. Physiol. 2020, 152, e201912501. [Google Scholar] [CrossRef]
- Trindade, D.; Pereira, C.; Chaves, S.R.; Manon, S.; Côrte-Real, M.; Sousa, M.J. VDAC Regulates AAC-Mediated Apoptosis and Cytochrome c Release in Yeast. Microb. Cell 2016, 3, 500–510. [Google Scholar] [CrossRef][Green Version]
- Messina, A.; Reina, S.; Guarino, F.; De Pinto, V. VDAC Isoforms in Mammals. Biochim. Biophys. Acta 2012, 1818, 1466–1476. [Google Scholar] [CrossRef]
- Sampson, M.J.; Decker, W.K.; Beaudet, A.L.; Ruitenbeek, W.; Armstrong, D.; Hicks, M.J.; Craigen, W.J. Immotile Sperm and Infertility in Mice Lacking Mitochondrial Voltage-Dependent Anion Channel Type 3. J. Biol. Chem. 2001, 276, 39206–39212. [Google Scholar] [CrossRef]
- Okazaki, M.; Kurabayashi, K.; Asanuma, M.; Saito, Y.; Dodo, K.; Sodeoka, M. VDAC3 Gating Is Activated by Suppression of Disulfide-Bond Formation between the N-Terminal Region and the Bottom of the Pore. Biochim. Biophys. Acta (BBA) Biomembr. 2015, 1848, 3188–3196. [Google Scholar] [CrossRef] [PubMed]
- De Pinto, V.; Reina, S.; Gupta, A.; Messina, A.; Mahalakshmi, R. Role of Cysteines in Mammalian VDAC Isoforms’ Function. Biochim. Biophys. Acta (BBA) Bioenerg. 2016, 1857, 1219–1227. [Google Scholar] [CrossRef] [PubMed]
- Karachitos, A.; Grabiński, W.; Baranek, M.; Kmita, H. Redox-Sensitive VDAC: A Possible Function as an Environmental Stress Sensor Revealed by Bioinformatic Analysis. Front. Physiol. 2021, 12, 750627. [Google Scholar] [CrossRef] [PubMed]
- Reina, S.; Palermo, V.; Guarnera, A.; Guarino, F.; Messina, A.; Mazzoni, C.; De Pinto, V. Swapping of the N-Terminus of VDAC1 with VDAC3 Restores Full Activity of the Channel and Confers Anti-Aging Features to the Cell. FEBS Lett. 2010, 584, 2837–2844. [Google Scholar] [CrossRef] [PubMed]
- Costa, V.; Moradas-Ferreira, P. Oxidative Stress and Signal Transduction in Saccharomyces Cerevisiae: Insights into Ageing, Apoptosis and Diseases. Mol. Aspects Med. 2001, 22, 217–246. [Google Scholar] [CrossRef]
- Zhang, M.; Shi, J.; Jiang, L. Modulation of Mitochondrial Membrane Integrity and ROS Formation by High Temperature in Saccharomyces cerevisiae. Electron. J. Biotechnol. 2015, 18, 202–209. [Google Scholar] [CrossRef]
- Reina, S.; Pittalà, M.G.G.; Guarino, F.; Messina, A.; De Pinto, V.; Foti, S.; Saletti, R. Cysteine Oxidations in Mitochondrial Membrane Proteins: The Case of VDAC Isoforms in Mammals. Front. Cell Dev. Biol. 2020, 8, 397. [Google Scholar] [CrossRef]
- Reina, S.; Nibali, S.C.; Tomasello, M.F.; Magrì, A.; Messina, A.; De Pinto, V. Voltage Dependent Anion Channel 3 (VDAC3) Protects Mitochondria from Oxidative Stress. Redox Biol. 2022, 51, 102264. [Google Scholar] [CrossRef]
- Pittalà, M.G.G.; Saletti, R.; Reina, S.; Cunsolo, V.; De Pinto, V.; Foti, S. A High Resolution Mass Spectrometry Study Reveals the Potential of Disulfide Formation in Human Mitochondrial Voltage-Dependent Anion Selective Channel Isoforms (hVDACs). Int. J. Mol. Sci. 2020, 21, 1468. [Google Scholar] [CrossRef]
- Reina, S.; Checchetto, V.; Saletti, R.; Gupta, A.; Chaturvedi, D.; Guardiani, C.; Guarino, F.; Scorciapino, M.A.; Magrì, A.; Foti, S.; et al. VDAC3 as a Sensor of Oxidative State of the Intermembrane Space of Mitochondria: The Putative Role of Cysteine Residue Modifications. Oncotarget 2016, 7, 2249–2268. [Google Scholar] [CrossRef]
- Gałgańska, H.; Antoniewicz, M.; Budzińska, M.; Gałgański, L.; Kmita, H. VDAC Contributes to mRNA Levels in Saccharomyces Cerevisiae Cells by the Intracellular Reduction/Oxidation State Dependent and Independent Mechanisms. J. Bioenerg. Biomembr. 2010, 42, 483–489. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Xu, S.; Shieh, M.; Paul, B.D.; Xian, M. Hydrogen Sulfide: Recent Development of Its Dual Donors and Hybrid Drugs. Br. J. Pharmacol. 2023. [Google Scholar] [CrossRef] [PubMed]
- Kabil, O.; Motl, N.; Banerjee, R. H2S and Its Role in Redox Signaling. Biochim. Biophys. Acta 2014, 1844, 1355–1366. [Google Scholar] [CrossRef] [PubMed]
- Linderholm, A.L.; Findleton, C.L.; Kumar, G.; Hong, Y.; Bisson, L.F. Identification of Genes Affecting Hydrogen Sulfide Formation in Saccharomyces Cerevisiae. Appl. Environ. Microbiol. 2008, 74, 1418–1427. [Google Scholar] [CrossRef] [PubMed]
- Van Oss, S.B.; Parikh, S.B.; Castilho Coelho, N.; Wacholder, A.; Belashov, I.; Zdancewicz, S.; Michaca, M.; Xu, J.; Kang, Y.P.; Ward, N.P.; et al. On the Illusion of Auxotrophy: met15Δ Yeast Cells Can Grow on Inorganic Sulfur, Thanks to the Previously Uncharacterized Homocysteine Synthase Yll058w. J. Biol. Chem. 2022, 298, 102697. [Google Scholar] [CrossRef]
- Gu, Z.; Sun, Y.; Wu, F.; Wu, X. Mechanism of Growth Regulation of Yeast Involving Hydrogen Sulfide From S-Propargyl-Cysteine Catalyzed by Cystathionine-γ-Lyase. Front. Microbiol. 2021, 12, 679563. [Google Scholar] [CrossRef]
- Collins, S.R.; Roguev, A.; Krogan, N.J. Quantitative Genetic Interaction Mapping Using the E-MAP Approach. Methods Enzymol. 2010, 470, 205–231. [Google Scholar] [CrossRef]
- Correia-Melo, C.; Kamrad, S.; Tengölics, R.; Messner, C.B.; Trebulle, P.; Townsend, S.; Jayasree Varma, S.; Freiwald, A.; Heineike, B.M.; Campbell, K.; et al. Cell-Cell Metabolite Exchange Creates a pro-Survival Metabolic Environment That Extends Lifespan. Cell 2023, 186, 63–79.e21. [Google Scholar] [CrossRef]
- Liemburg-Apers, D.C.; Willems, P.H.G.M.; Koopman, W.J.H.; Grefte, S. Interactions between Mitochondrial Reactive Oxygen Species and Cellular Glucose Metabolism. Arch. Toxicol. 2015, 89, 1209–1226. [Google Scholar] [CrossRef]
- Laughery, M.F.; Wyrick, J.J. Simple CRISPR-Cas9 Genome Editing in Saccharomyces Cerevisiae. Curr. Protoc. Mol. Biol. 2019, 129, e110. [Google Scholar] [CrossRef]
- Hu, G.; Luo, S.; Rao, H.; Cheng, H.; Gan, X. A Simple PCR-Based Strategy for the Introduction of Point Mutations in the Yeast Saccharomyces Cerevisiae via CRISPR/Cas9. Biochem. Mol. Biol. J. 2018, 4, 9. [Google Scholar] [CrossRef] [PubMed]
- Mülleder, M.; Campbell, K.; Matsarskaia, O.; Eckerstorfer, F.; Ralser, M. Saccharomyces Cerevisiae Single-Copy Plasmids for Auxotrophy Compensation, Multiple Marker Selection, and for Designing Metabolically Cooperating Communities. F1000Research 2016, 5, 2351. [Google Scholar] [CrossRef] [PubMed]
- Giaever, G.; Nislow, C. The Yeast Deletion Collection: A Decade of Functional Genomics. Genetics 2014, 197, 451–465. [Google Scholar] [CrossRef] [PubMed]





| Strain | Genotype | Feature | Source |
|---|---|---|---|
| M3 | MATa lys2; his4; trp1; ade2; leu2; ura3 | WT | [17] |
| M3-por1Δ | MATa lys2; his4; trp1; ade2; leu2; ura3; por1Δ::LEU2 | Lacking the POR1 gene (por1Δ) | [17] (M22-2) |
| M3-por2Δ | MATa lys2; his4; trp1; ade2; leu2; ura3; por2Δ::TRP1 | Lacking the POR2 gene (por2Δ) | [17] (M3-2) |
| M3-por1Δpor2Δ | MATa lys2; his4; trp1; ade2; leu2; ura3; por1Δ::LEU2; por2Δ::TRP1 | Double mutant lacking POR1 and POR2 genes (por1Δ por2Δ) | [17] (M22-2-1) |
| M3-por1Δpor2Δ-hVDAC1 | MATa lys2; his4; trp1; ade2; leu2; ura3; por1Δ::HVDAC1; por2Δ::TRP1 | Expresses human VDAC1 under the control of the POR1 promoter (hVDAC1) | This work |
| M3-por1Δpor2Δ-hVDAC2 | MATa lys2; his4; trp1; ade2; leu2; ura3; por1Δ::HVDAC2; por2Δ::TRP1 | Expresses human VDAC2 under the control of the POR1 promoter (hVDAC2) | This work |
| M3-por1Δpor2Δ-hVDAC3 | MATa lys2; his4; trp1; ade2; leu2; ura3; por1Δ::HVDAC3; por2Δ::TRP1 | Expresses human VDAC3 under the control of the POR1 promoter (hVDAC3) | This work |
| M3-por1Δpor2Δ-hVDAC3-ΔCys | MATa lys2; his4; trp1; ade2; leu2; ura3; por1Δ::HVDAC3ΔCys; por2Δ::TRP1 | Expresses human VDAC3 under the control of the POR1 promoter. HVDAC3 mutations: C2A, C8A, C36A, C65A, C122A, C229A (hVDAC3ΔCys) | This work |
| BY4741 | MATa his3Δ1; leu2Δ0; met15Δ0; ura3Δ0 | WT | Euroscarf |
| BY4741-por1Δ | MATa; his3Δ1; leu2Δ0; met15Δ0; ura3Δ0; por1Δ0 | Lacking the POR1 gene (por1Δ) | This work |
| BY4741-por2Δ | MATa; his3Δ1; leu2Δ0; met15Δ0; ura3Δ0; por2Δ::kanMX4 | Lacking the POR2 gene (por2Δ) | Euroscarf |
| BY4741-por1Δ por2Δ | MATa; his3Δ1; leu2Δ0; met15Δ0; ura3Δ0; por1Δ0; por2Δ::kanMX4 | Double mutant lacking POR1 and POR2 genes (por1Δ por2Δ) | This work |
| BY4741-por1Δpor2Δ-hVDAC1 | MATa; his3Δ1; leu2Δ0; met15Δ0; ura3Δ0 por1Δ::HVDAC1; por2Δ::kanMX4 | Expresses human VDAC1 under the control of the POR1 promoter (hVDAC1) | This work |
| BY4741-por1Δpor2Δ-hVDAC2 | MATa; his3Δ1; leu2Δ0; met15Δ0; ura3Δ0; por1Δ::HVDAC2; por2Δ::kanMX4 | Expresses human VDAC2 under the control of the POR1 promoter (hVDAC2) | This work |
| BY4741-por1Δpor2Δ-hVDAC3 | MATa; his3Δ1; leu2Δ0; met15Δ0; ura3Δ0; por1Δ::HVDAC3; por2Δ::kanMX4 | Expresses human VDAC3 under the control of the POR1 promoter (hVDAC3) | This work |
| BY4741-por1Δpor2Δ-hVDAC3-ΔCys | MATa; his3Δ1; leu2Δ0; met15Δ0; ura3Δ0; por1Δ::HVDAC3ΔCys; por2Δ::kanMX4 | Expresses human VDAC3 under the control of the POR1 promoter. HVDAC3 mutations: C2A, C8A, C36A, C65A, C122A, C229A (hVDAC3ΔCys) | This work |
| Plasmid | Size (bp) | Description |
|---|---|---|
| pML104-POR1 | 11,258 | CRISPR/Cas9 vector designed for targeting the POR1 |
| pBSK(+) Simple-Amp-hVDAC1 | 4383 | Contains the repair DNA sequence for human VDAC1, used in CRISPR/Cas9-mediated gene editing |
| pBSK(+) Simple-Amp-hVDAC2 | 4416 | Contains the repair DNA sequence for human VDAC2, used in CRISPR/Cas9-mediated gene editing |
| pBluescript II SK(+)-hVDAC3 | 4437 | Contains the repair DNA sequence for human VDAC3, used in CRISPR/Cas9-mediated gene editing |
| pBluescript II SK(+)-hVDAC3ΔCys | 4437 | Contains the repair DNA sequence for cysteine-depleted variant of human VDAC3, used in CRISPR/Cas9-mediated gene editing |
| pUM | 6448 | Contains URA3 and MET17 auxotrophy selection markers |
| Oligonucleotides | Sequence (5′ -> 3′) | Description |
|---|---|---|
| pML104_por1_F | GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGC | insertion of guide sgRNA sequence into pML104 vector |
| pML104_por1_R | GCAGTGAAAGATAAATGATCGATCATTTATCTTTCACTGC | |
| POR1A | TTCCAACAAGTTTAATGGTCAGAAT | amplification of repair DNA, sequencing, diagnostic |
| POR1B | CTCTAATTTGGTTTGCAAGTTGTTT | diagnostic |
| POR1C | AACTGCAAACTACCTAACTCCAATG | diagnostic |
| POR1D | AATGTTCGAAACCAATCTGAAAATA | amplification of repair DNA, sequencing, diagnostic |
| hVDAC1/2opt_B | CCGAATTCAGTACCGTCGTT | diagnostic |
| hVDAC3opt_B | GCCGGTGTTAGGAACAAAAA | diagnostic |
| POR1_KO_1 | CCAACACGAAACAGCCAAGCGTACCCAAAGCAAAAATCAAA CCAACCTCTCAACAACGTATATATCTAATATATATATGTTC ACTATATACCATATATGTGCTCGTTCTT | oligonucleotides for hybridization, DNA repair for gene deletion |
| POR1_KO_2 | AAGAACGAGCACATATATGGTATATAGTGAACATATATATA TTAGATATATACGTTGTTGAGAGGTTGGTTTGATTTTTGCT TTGGGTACGCTTGGCTGTTTCGTGTTGG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Baranek-Grabińska, M.; Grabiński, W.; Musso, D.; Karachitos, A.; Kmita, H. Developing a Novel and Optimized Yeast Model for Human VDAC Research. Int. J. Mol. Sci. 2024, 25, 13010. https://doi.org/10.3390/ijms252313010
Baranek-Grabińska M, Grabiński W, Musso D, Karachitos A, Kmita H. Developing a Novel and Optimized Yeast Model for Human VDAC Research. International Journal of Molecular Sciences. 2024; 25(23):13010. https://doi.org/10.3390/ijms252313010
Chicago/Turabian StyleBaranek-Grabińska, Martyna, Wojciech Grabiński, Deborah Musso, Andonis Karachitos, and Hanna Kmita. 2024. "Developing a Novel and Optimized Yeast Model for Human VDAC Research" International Journal of Molecular Sciences 25, no. 23: 13010. https://doi.org/10.3390/ijms252313010
APA StyleBaranek-Grabińska, M., Grabiński, W., Musso, D., Karachitos, A., & Kmita, H. (2024). Developing a Novel and Optimized Yeast Model for Human VDAC Research. International Journal of Molecular Sciences, 25(23), 13010. https://doi.org/10.3390/ijms252313010

