Microneedle-Array-Mediated Transdermal Delivery of GCV-Functionalized Zeolitic Imidazolate Framework-8 Nanoparticles for KSHV Treatment
Abstract
:1. Introduction
2. Results and Discussion
2.1. Preparation and Characterization of GCV@ZIF-8
2.2. pH Responsiveness and Cytotoxicity of GCV@ZIF-8
2.3. Preparation and Characterization of MN/GCV@ZIF-8
2.4. Mechanical Properties of MN/GCV@ZIF-8
2.5. Drug Release Study
2.6. Skin Penetration Studies
2.7. Anti-Tumor Effects In Vivo
2.8. Inhibitory Effects of MNs on the Expression Levels of KSHV Genes
3. Materials and Methods
3.1. Materials
3.2. The Preparation and Characterization of GCV@ZIF-8
3.3. The pH Response Ability of GCV@ZIF-8
3.4. Cell Culture and Toxicity Detection
3.5. Preparation of Soluble Microneedles Loaded with Ganciclovir (MN/GCV@ZIF-8)
3.6. Determining the Force Curve of MN/GCV@ZIF-8
3.7. Morphological Characterization of MN/GCV@ZIF-8
3.8. The Permeation of MN/GCV@ZIF-8 Determined In Vitro
3.9. MN/GCV@ZIF-8 Release Test
3.10. Animal Assay
3.11. RT-PCR
3.12. Statistical Analysis
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Dittmer, D.P.; Damania, B. Kaposi sarcoma-associated herpesvirus: Immunobiology, oncogenesis, and therapy. J. Clin. Investig. 2016, 126, 3165–3175. [Google Scholar] [CrossRef] [PubMed]
- Cesarman, E.; Chadburn, A.; Rubinstein, P.G. KSHV/HHV8-mediated hematologic diseases. Blood 2022, 139, 1013–1025. [Google Scholar] [CrossRef] [PubMed]
- Lebbe, C.; Garbe, C.; Stratigos, A.J.; Harwood, C.; Peris, K.; Marmol, V.D.; Malvehy, J.; Zalaudek, I.; Hoeller, C.; Dummer, R.; et al. Diagnosis and treatment of Kaposi’s sarcoma: European consensus-based interdisciplinary guideline (EDF/EADO/EORTC). Eur. J. Cancer 2019, 114, 117–127. [Google Scholar] [CrossRef] [PubMed]
- Fico, V.; Altieri, G.; Di Grezia, M.; Bianchi, V.; Chiarello, M.M.; Pepe, G.; Tropeano, G.; Brisinda, G. Surgical complications of oncological treatments: A narrative review. World J. Gastrointest. Surg. 2023, 15, 1056–1067. [Google Scholar] [CrossRef] [PubMed]
- Sabin, J.; Alatorre-Meda, M.; Miñones, J.; Domínguez-Arca, V., Jr.; Prieto, G. New insights on the mechanism of polyethylenimine transfection and their implications on gene therapy and DNA vaccines. Colloids Surf. B Biointerfaces 2022, 210, 112219. [Google Scholar] [CrossRef] [PubMed]
- Halling Folkmar Andersen, A.; Tolstrup, M. The Potential of Long-Acting, Tissue-Targeted Synthetic Nanotherapy for Delivery of Antiviral Therapy Against HIV Infection. Viruses 2020, 12, 412. [Google Scholar] [CrossRef]
- Chen, J.; Dai, L.; Goldstein, A.; Zhang, H.; Tang, W.; Forrest, J.C.; Post, S.R.; Chen, X.; Qin, Z. Identification of new antiviral agents against Kaposi’s sarcoma-associated herpesvirus (KSHV) by high-throughput drug screening reveals the role of histamine-related signaling in promoting viral lytic reactivation. PLoS Pathog. 2019, 15, e1008156. [Google Scholar] [CrossRef]
- Khan, M.I.; Hossain, M.I.; Hossain, M.K.; Rubel, M.H.K.; Hossain, K.M.; Mahfuz, A.M.U.B.; Anik, M.I. Recent Progress in Nanostructured Smart Drug Delivery Systems for Cancer Therapy: A Review. ACS Appl. Bio Mater. 2022, 5, 971–1012. [Google Scholar] [CrossRef]
- van der Eb, M.M.; Geutskens, S.B.; van Kuilenburg, A.B.P.; van Lenthe, H.; van Dierendonck, J.-H.; Kuppen, P.J.K.; van Ormondt, H.; van de Velde, C.J.H.; Wanders, R.J.A.; van Gennip, A.H.; et al. Ganciclovir nucleotides accumulate in mitochondria of rat liver cells expressing the herpes simplex virus thymidine kinase gene. J. Gene Med. 2003, 5, 1018–1027. [Google Scholar] [CrossRef]
- Meesing, A.; Razonable, R.R. New Developments in the Management of Cytomegalovirus Infection After Transplantation. Drugs 2018, 78, 1085–1103. [Google Scholar] [CrossRef] [PubMed]
- Chou, S. Cytomegalovirus UL97 mutations in the era of ganciclovir and maribavir. Rev. Med. Virol. 2008, 18, 233–246. [Google Scholar] [CrossRef] [PubMed]
- Li, F.; Cao, D.; Gu, W.; Li, D.; Liu, Z.; Cui, L. Folate-Targeted Nanocarriers Co-Deliver Ganciclovir and miR-34a-5p for Combined Anti-KSHV Therapy. Int. J. Mol. Sci. 2024, 25, 2932. [Google Scholar] [CrossRef] [PubMed]
- Hu, L.; Bui, V.T.; Pal, S.; Guo, W.; Subramanian, A.; Kisslinger, K.; Fan, S.; Nam, C.-Y.; Ding, Y.; Lin, H. In Situ Growth of Crystalline and Polymer-Incorporated Amorphous ZIFs in Polybenzimidazole Achieving Hierarchical Nanostructures for Carbon Capture. Small 2022, 18, 2201982. [Google Scholar] [CrossRef] [PubMed]
- Gao, H.; Sun, R.; He, L.; Qian, Z.-J.; Zhou, C.; Hong, P.; Sun, S.; Mo, R.; Li, C. In Situ Growth Visualization Nanochannel Membrane for Ultrasensitive Copper Ion Detection under the Electric Field Enrichment. ACS Appl. Mater. Interfaces 2020, 12, 4849–4858. [Google Scholar] [CrossRef]
- Zheng, J.; Sharma, A.; Kumeria, T.; Chi, Y.; Ghasemian, M.B.; Mao, G.; Tang, J.; Kumar, P.; Rahim, M.A.; Kalantar-Zadeh, K. Dynamic Zinc in Liquid Metal Media as a Metal Ion Source for Highly Porous ZIF-8 Synthesis. Adv. Funct. Mater. 2023, 34, 2300969. [Google Scholar] [CrossRef]
- Yu, X.; Zhao, J.; Fan, D. The Progress in the Application of Dissolving Microneedles in Biomedicine. Polymers 2023, 15, 4059. [Google Scholar] [CrossRef]
- Zhou, Y.; Jia, L.; Zhou, D.; Chen, G.; Fu, Q.; Li, N. Advances in microneedles research based on promoting hair regrowth. J. Control. Release 2022, 353, 965–974. [Google Scholar] [CrossRef]
- Wang, H.; Pastorin, G.; Lee, C. Toward Self-Powered Wearable Adhesive Skin Patch with Bendable Microneedle Array for Transdermal Drug Delivery. Adv. Sci. 2016, 3, 1500441. [Google Scholar] [CrossRef]
- Zhu, M.; Liu, Y.; Jiang, F.; Cao, J.; Kundu, S.C.; Lu, S. Combined Silk Fibroin Microneedles for Insulin Delivery. ACS Biomater. Sci. Eng. 2020, 6, 3422–3429. [Google Scholar] [CrossRef]
- Qin, K.; Gui, Y.; Li, Y.; Li, X.; Meng, F.; Han, D.; Du, L.; Li, S.; Wang, Y.; Zhou, H.; et al. Biodegradable Microneedle Array-Mediated Transdermal Delivery of Dimethyloxalylglycine-Functionalized Zeolitic Imidazolate Framework-8 Nanoparticles for Bacteria-Infected Wound Treatment. ACS Appl. Mater. Interfaces 2023, 15, 6338–6353. [Google Scholar] [CrossRef]
- Jung, S.; Chang, S.; Kim, N.-E.; Choi, S.-O.; Song, Y.-J.; Yuan, Y.; Kim, J. Curcumin/Zeolitic Imidazolate Framework-8 Nanoparticle-Integrated Microneedles for pH-Responsive Treatment of Skin Disorders. ACS Appl. Nano Mater. 2022, 5, 13671–13679. [Google Scholar] [CrossRef]
- Tanum, J.; Jeong, H.; Choi, M.; Choi, D.; Park, K.; Lee, J.B.; Hong, J. Zinc Imidazolate Framework-8 as a Promising Nitric Oxide Carrier. J. Ind. Eng. Chem. 2020, 91, 355–361. [Google Scholar] [CrossRef]
- Liu, J.; Zheng, A.; Peng, B.; Xu, Y.; Zhang, N. Size-Dependent Absorption through Stratum Corneum by Drug-Loaded Liposomes. Pharm. Res. 2021, 38, 1429–1437. [Google Scholar] [CrossRef]
- Ronnander, P.; Simon, L.; Koch, A. Experimental and mathematical study of the transdermal delivery of sumatriptan succinate from polyvinylpyrrolidone-based microneedles. Eur. J. Pharm. Biopharm. 2019, 146, 32–40. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, H.X.; Bozorg, B.D.; Kim, Y.; Wieber, A.; Birk, G.; Lubda, D.; Banga, A.K. Poly (vinyl alcohol) microneedles: Fabrication, characterization, and application for transdermal drug delivery of doxorubicin. Eur. J. Pharm. Biopharm. 2018, 129, 88–103. [Google Scholar] [CrossRef]
- Gam Ze Letova, C.; Kalt, I.; Shamay, M.; Sarid, R. Latently KSHV-Infected Cells Promote Further Establishment of Latency upon Superinfection with KSHV. Int. J. Mol. Sci. 2021, 22, 11994. [Google Scholar] [CrossRef]
- Cao, D.; Wu, S.; Wang, X.; Li, Y.; Xu, H.; Pan, Z.; Wu, Z.; Yang, L.; Tan, X.; Li, D. Kaposi’s sarcoma-associated herpesvirus infection promotes proliferation of SH-SY5Y cells by the Notch signaling pathway. Cancer Cell Int. 2021, 21, 577. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.-C.; Toth, Z. PRC1-independent binding and activity of RYBP on the KSHV genome during de novo infection. PLoS Pathog. 2022, 18, e1010801. [Google Scholar] [CrossRef]
- Li, F.; Cao, D.; Gu, W.; Cui, L.; Qiu, Z.; Liu, Z.; Li, D.; Guo, X. Delivery of miR-34a-5p by Folic Acid-Modified β-Cyclodextrin-Grafted Polyethylenimine Copolymer Nanocarriers to Resist KSHV. ACS Appl. Nano Mater. 2023, 6, 10826–10836. [Google Scholar] [CrossRef]
Primer Name | Sequence (5′-3′) | |
---|---|---|
Actin | Sense | CGGAACCGCTCATTGCC |
Antisense | ACCCACATCGTGCCCATCTA | |
ORF26 | Sense | CGAATCCAACGGATTTGACCTC |
Antisense | CCCATAAATGACACATTGGTGGTA | |
ORF50 | Sense | GAGTCCGGCACACTGTACC |
Antisense | AAACTGCCTGGGAAGTTAACG | |
LANA | Sense | AGCCACCGGTAAAGTAGGAC |
Antisense | GATGTGACCTTGGCGATGAC | |
v-GPCR | Sense | GTGCCTTACACGTGGAACGTT |
Antisense | GGTGACCAATCCATTTCAAGA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, C.; Yin, X.; Xu, H.; Xu, J.; Gong, M.; Li, Z.; Xu, Q.; Cao, D.; Li, D. Microneedle-Array-Mediated Transdermal Delivery of GCV-Functionalized Zeolitic Imidazolate Framework-8 Nanoparticles for KSHV Treatment. Int. J. Mol. Sci. 2024, 25, 12946. https://doi.org/10.3390/ijms252312946
Liu C, Yin X, Xu H, Xu J, Gong M, Li Z, Xu Q, Cao D, Li D. Microneedle-Array-Mediated Transdermal Delivery of GCV-Functionalized Zeolitic Imidazolate Framework-8 Nanoparticles for KSHV Treatment. International Journal of Molecular Sciences. 2024; 25(23):12946. https://doi.org/10.3390/ijms252312946
Chicago/Turabian StyleLiu, Chengjing, Xiuyuan Yin, Huiling Xu, Jianyu Xu, Mengru Gong, Zhenzhong Li, Qianhe Xu, Dongdong Cao, and Dongmei Li. 2024. "Microneedle-Array-Mediated Transdermal Delivery of GCV-Functionalized Zeolitic Imidazolate Framework-8 Nanoparticles for KSHV Treatment" International Journal of Molecular Sciences 25, no. 23: 12946. https://doi.org/10.3390/ijms252312946
APA StyleLiu, C., Yin, X., Xu, H., Xu, J., Gong, M., Li, Z., Xu, Q., Cao, D., & Li, D. (2024). Microneedle-Array-Mediated Transdermal Delivery of GCV-Functionalized Zeolitic Imidazolate Framework-8 Nanoparticles for KSHV Treatment. International Journal of Molecular Sciences, 25(23), 12946. https://doi.org/10.3390/ijms252312946