Only Infant MLL-Rearranged Leukemia Is Susceptible to an Inhibition of Polo-like Kinase 1 (PLK-1) by Volasertib
Abstract
1. Introduction
2. Results
2.1. Revealing PLK-1 as a Potential Promising Target in Infant MLL-AF9 Leukemia
2.2. MLLr Leukemia Cells Derived from huCB Are More Susceptible to PLK-1 Inhibition Than Those from huBM
2.3. Inhibition of PLK-1 Leads to Reduced Viability and Mitotic Arrest
2.4. Transcriptomic Analysis Revealed Compensatory PLK-1 Feedback Mechanism Only in Adult MLLr Cells upon Volasertib Treatment
2.5. Combinational Treatment with Volasertib and the Aurora Kinase a Inhibitor Alisertib Shows Synergistic Effects in the huBM MLLr Model
3. Discussion
4. Materials and Methods
4.1. Human CRISPR/Cas9-MLLr Model
4.2. Cell Lines
4.3. Quantitative Reverse Transcriptase-PCR (RT-qPCR)
4.4. Inhibitor Treatment Assay
4.5. Microscopy-Based Determination of Cell Counts
4.6. Cell Viability Assay
4.7. Cell Cycle and Apoptosis Analysis
4.8. May-Gruenwald-Giemsa Staining
4.9. Statistical Analysis
4.10. RNA Sequencing
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Bowie, M.B.; Kent, D.G.; Dykstra, B.; McKnight, K.D.; McCaffrey, L.; Hoodless, P.A.; Eaves, C.J. Identification of a new intrinsically timed developmental checkpoint that reprograms key hematopoietic stem cell properties. Proc. Natl. Acad. Sci. USA 2007, 104, 5878–5882. [Google Scholar] [CrossRef] [PubMed]
 - Duguid, A.; Mattiucci, D.; Ottersbach, K. Infant leukaemia—Faithful models, cell of origin and the niche. Dis. Models Mech. 2021, 14, dmm049189. [Google Scholar] [CrossRef]
 - Krivtsov, A.V.; Figueroa, M.E.; Sinha, A.U.; Stubbs, M.C.; Feng, Z.; Valk, P.J.M.; Delwel, R.; Döhner, K.; Bullinger, L.; Kung, A.L.; et al. Cell of origin determines clinically relevant subtypes of MLL-rearranged AML. Leukemia 2012, 27, 852–860. [Google Scholar] [CrossRef] [PubMed]
 - Butler, L.H.; Slany, R.; Cui, X.; Cleary, M.L.; Mason, D.Y. The HRX Proto-oncogene Product Is Widely Expressed in Human Tissues and Localizes to Nuclear Structures. Blood 1997, 89, 3361–3370. [Google Scholar] [CrossRef] [PubMed]
 - Ernst, P.; Fisher, J.K.; Avery, W.; Wade, S.; Foy, D.; Korsmeyer, S.J. Definitive Hematopoiesis Requires the Mixed-Lineage Leukemia Gene. Dev. Cell 2004, 6, 437–443. [Google Scholar] [CrossRef] [PubMed]
 - Yu, B.D.; Hess, J.L.; Horning, S.E.; Brown, G.A.J.; Korsmeyer, S.J. Altered Hox expression and segmental identity in Mll-mutant mice. Nature 1995, 378, 505–508. [Google Scholar] [CrossRef]
 - Meyer, C.; Larghero, P.; Lopes, B.A.; Burmeister, T.; Gröger, D.; Sutton, R.; Venn, N.C.; Cazzaniga, G.; Abascal, L.C.; Tsaur, G.; et al. The KMT2A recombinome of acute leukemias in 2023. Leukemia 2023, 37, 988–1005. [Google Scholar] [CrossRef]
 - Chang, P.-Y.; Hom, R.A.; Musselman, C.A.; Zhu, L.; Kuo, A.; Gozani, O.; Kutateladze, T.G.; Cleary, M.L. Binding of the MLL PHD3 Finger to Histone H3K4me3 Is Required for MLL-Dependent Gene Transcription. J. Mol. Biol. 2010, 400, 137–144. [Google Scholar] [CrossRef]
 - Tkachuk, D.C.; Kohler, S.; Cleary, M.L. Involvement of a homolog of Drosophila trithorax by 11q23 chromosomal translocations in acute leukemias. Cell 1992, 71, 691–700. [Google Scholar] [CrossRef]
 - Marschalek, R. Systematic Classification of Mixed-Lineage Leukemia Fusion Partners Predicts Additional Cancer Pathways. Ann. Lab. Med. 2016, 36, 85–100. [Google Scholar] [CrossRef]
 - Krivtsov, A.V.; Twomey, D.; Feng, Z.; Stubbs, M.C.; Wang, Y.; Faber, J.; Levine, J.E.; Wang, J.; Hahn, W.C.; Gilliland, D.G.; et al. Transformation from committed progenitor to leukaemia stem cell initiated by MLL–AF9. Nature 2006, 442, 818–822. [Google Scholar] [CrossRef] [PubMed]
 - Okuda, H.; Stanojevic, B.; Kanai, A.; Kawamura, T.; Takahashi, S.; Matsui, H.; Takaori-Kondo, A.; Yokoyama, A. Cooperative gene activation by AF4 and DOT1L drives MLL-rearranged leukemia. J. Clin. Investig. 2017, 127, 1918–1931. [Google Scholar] [CrossRef] [PubMed]
 - Fitzel, R.; Secker-Grob, K.-A.; Keppeler, H.; Korkmaz, F.; Schairer, R.; Erkner, E.; Schneidawind, D.; Lengerke, C.; Hentrich, T.; Schulze-Hentrich, J.M.; et al. Targeting MYC in combination with epigenetic regulators induces synergistic anti-leukemic effects in MLLr leukemia and simultaneously improves immunity. Neoplasia 2023, 41, 100902. [Google Scholar] [CrossRef] [PubMed]
 - Creutzig, U.; Dworzak, M.; Reinhardt, D. L11 Akute Myeloische Leukämie—AML im Kindes—und Jugendalter. Available online: https://www.awmf.org (accessed on 12 September 2024).
 - Döhner, H.; Wei, A.H.; Appelbaum, F.R.; Craddock, C.; DiNardo, C.D.; Dombret, H.; Ebert, B.L.; Fenaux, P.; Godley, L.A.; Hasserjian, R.P.; et al. Diagnosis and management of AML in adults: 2022 recommendations from an international expert panel on behalf of the ELN. Blood 2022, 140, 1345–1377. [Google Scholar] [CrossRef]
 - Escherich, G.; Schrappe, M. Akute Lymphoblastische Leukämie -ALL- im Kindesalter. Available online: https://register.awmf.org/de/leitlinien/detail/025-014 (accessed on 14 September 2024).
 - Leitlinie Akute Lymphatische Leukämie (ALL) der Fachgesellschaften DGHO, OeGHO, SGMO, SGH+SSH. Available online: https://www.dgho.de/aktuelles/news/newsarchiv/2022/onkopedia-all-aktualisiert (accessed on 14 September 2024).
 - Röllig, C. Leilinie Akute Myeloische Leukämie (AML) der Fachgesellschaften DGHO, OeGHO, SGMO, SGH+SSH. Available online: https://www.dgho.de/aktuelles/news/newsarchiv/2023/onkopedia_aml_aktualisiert (accessed on 14 September 2024).
 - Balducci, E.; Nivaggioni, V.; Boudjarane, J.; Bouriche, L.; Rahal, I.; Bernot, D.; Alazard, E.; Duployez, N.; Grardel, N.; Arnoux, I.; et al. Lineage switch from B acute lymphoblastic leukemia to acute monocytic leukemia with persistent t(4;11)(q21;q23) and cytogenetic evolution under CD19-targeted therapy. Ann. Hematol. 2017, 96, 1579–1581. [Google Scholar] [CrossRef]
 - Tomizawa, D.; Miyamura, T.; Imamura, T.; Watanabe, T.; Saito, A.M.; Ogawa, A.; Takahashi, Y.; Hirayama, M.; Taki, T.; Deguchi, T.; et al. A risk-stratified therapy for infants with acute lymphoblastic leukemia: A report from the JPLSG MLL-10 trial. Blood 2020, 136, 1813–1823. [Google Scholar] [CrossRef] [PubMed]
 - Erkner, E.; Hentrich, T.; Schairer, R.; Fitzel, R.; Secker-Grob, K.-A.; Jeong, J.; Keppeler, H.; Korkmaz, F.; Schulze-Hentrich, J.M.; Lengerke, C.; et al. The RORɣ/SREBP2 pathway is a master regulator of cholesterol metabolism and serves as potential therapeutic target in t(4;11) leukemia. Oncogene 2023, 43, 281–293. [Google Scholar] [CrossRef]
 - Rice, S.; Roy, A. MLL-rearranged infant leukaemia: A ‘thorn in the side’ of a remarkable success story. Biochim. et Biophys. Acta (BBA) Gene Regul. Mech. 2020, 1863, 194564. [Google Scholar] [CrossRef]
 - Winters, A.C.; Bernt, K.M. MLL-Rearranged Leukemias—An Update on Science and Clinical Approaches. Front. Pediatr. 2017, 5, 4. [Google Scholar] [CrossRef]
 - Jeong, J.; Jager, A.; Domizi, P.; Pavel-Dinu, M.; Gojenola, L.; Iwasaki, M.; Wei, M.C.; Pan, F.; Zehnder, J.L.; Porteus, M.H.; et al. High-efficiency CRISPR induction of t(9;11) chromosomal translocations and acute leukemias in human blood stem cells. Blood Adv. 2019, 3, 2825–2835. [Google Scholar] [CrossRef]
 - Nilson, I.; Löchner, K.; Siegler, G.; Greil, J.; Beck, J.D.; Fey, G.H.; Marschalek, R. Exon/intron structure of the human ALL-1 (MLL) gene involved in translocations to chromosomal region 11q23 and acute leukaemias. Br. J. Haematol. 1996, 93, 966–972. [Google Scholar] [CrossRef] [PubMed]
 - Nilson, I.; Reichel, M.; Ennas, M.G.; Greim, R.; Knörr, C.; Siegler, G.; Greil, J.; Fey, G.H.; Marschalek, R. Exon/intron structure of the human AF-4 gene, a member of the AF-4/LAF-4/FMR-2 gene family coding for a nuclear protein with structural alterations in acute leukaemia. Br. J. Haematol. 1997, 98, 157–169. [Google Scholar] [CrossRef] [PubMed]
 - Strissel, P.L.; Strick, R.; Tomek, R.J.; Roe, B.A.; Rowley, J.D.; Zeleznik-Le, N.J. DNA structural properties of AF9 are similar to MLL and could act as recombination hot spots resulting in MLL/AF9 translocations and leukemogenesis. Hum. Mol. Genet. 2000, 9, 1671–1679. [Google Scholar] [CrossRef] [PubMed]
 - Secker, K.-A.; Keppeler, H.; Duerr-Stoerzer, S.; Schmid, H.; Schneidawind, D.; Hentrich, T.; Schulze-Hentrich, J.M.; Mankel, B.; Fend, F.; Schneidawind, C. Inhibition of DOT1L and PRMT5 promote synergistic anti-tumor activity in a human MLL leukemia model induced by CRISPR/Cas9. Oncogene 2019, 38, 7181–7195. [Google Scholar] [CrossRef]
 - Fischer, J.; Erkner, E.; Fitzel, R.; Radszuweit, P.; Keppeler, H.; Korkmaz, F.; Roti, G.; Lengerke, C.; Schneidawind, D.; Schneidawind, C. Uncovering NOTCH1 as a Promising Target in the Treatment of MLL-Rearranged Leukemia. Int. J. Mol. Sci. 2023, 24, 14466. [Google Scholar] [CrossRef]
 - Secker, K.-A.; Bloechl, B.; Keppeler, H.; Duerr-Stoerzer, S.; Schmid, H.; Schneidawind, D.; Jeong, J.; Hentrich, T.; Schulze-Hentrich, J.M.; Schneidawind, C. MAT2A as Key Regulator and Therapeutic Target in MLLr Leukemogenesis. Cancers 2020, 12, 1342. [Google Scholar] [CrossRef]
 - Secker, K.-A.; Bruns, L.; Keppeler, H.; Jeong, J.; Hentrich, T.; Schulze-Hentrich, J.M.; Mankel, B.; Fend, F.; Schneidawind, D.; Schneidawind, C. Only Hematopoietic Stem and Progenitor Cells from Cord Blood Are Susceptible to Malignant Transformation by MLL-AF4 Translocations. Cancers 2020, 12, 1487. [Google Scholar] [CrossRef]
 - Barr, F.A.; Silljé, H.H.W.; Nigg, E.A. Polo-like kinases and the orchestration of cell division. Nat. Rev. Mol. Cell Biol. 2004, 5, 429–441. [Google Scholar] [CrossRef]
 - Chow, Y.-P.; Alias, H.; Jamal, R. Meta-analysis of gene expression in relapsed childhood B-acute lymphoblastic leukemia. BMC Cancer 2017, 17, 1–10. [Google Scholar] [CrossRef]
 - Renner, A.G.; Dos Santos, C.; Recher, C.; Bailly, C.; Créancier, L.; Kruczynski, A.; Payrastre, B.; Manenti, S. Polo-like kinase 1 is overexpressed in acute myeloid leukemia and its inhibition preferentially targets the proliferation of leukemic cells. Blood 2009, 114, 659–662. [Google Scholar] [CrossRef]
 - Brandwein, J.M. Targeting polo-like kinase 1 in acute myeloid leukemia. Ther. Adv. Hematol. 2015, 6, 80–87. [Google Scholar] [CrossRef] [PubMed]
 - Döhner, H.; Symeonidis, A.; Deeren, D.; Demeter, J.; Sanz, M.A.; Anagnostopoulos, A.; Esteve, J.; Fiedler, W.; Porkka, K.; Kim, H.-J.; et al. Adjunctive Volasertib in Patients with Acute Myeloid Leukemia not Eligible for Standard Induction Therapy: A Randomized, Phase 3 Trial. HemaSphere 2021, 5, e617. [Google Scholar] [CrossRef]
 - Gjertsen, B.T.; Schöffski, P. Discovery and development of the Polo-like kinase inhibitor volasertib in cancer therapy. Leukemia 2014, 29, 11–19. [Google Scholar] [CrossRef]
 - Goroshchuk, O.; Kolosenko, I.; Vidarsdottir, L.; Azimi, A.; Palm-Apergi, C. Polo-like kinases and acute leukemia. Oncogene 2018, 38, 1–16. [Google Scholar] [CrossRef] [PubMed]
 - Liu, Z.; Sun, Q.; Wang, X. PLK1, A Potential Target for Cancer Therapy. Transl. Oncol. 2017, 10, 22–32. [Google Scholar] [CrossRef] [PubMed]
 - Murugan, R.N.; Park, J.-E.; Kim, E.-H.; Shin, S.Y.; Cheong, C.; Lee, K.S.; Bang, J.K. Plk1-Targeted Small Molecule Inhibitors: Molecular Basis for Their Potency and Specificity. Mol. Cells 2011, 32, 209–220. [Google Scholar] [CrossRef]
 - Bossche, J.V.D.; Lardon, F.; Deschoolmeester, V.; De Pauw, I.; Vermorken, J.; Specenier, P.; Pauwels, P.; Peeters, M.; Wouters, A. Spotlight on Volasertib: Preclinical and Clinical Evaluation of a Promising Plk1 Inhibitor. Med. Res. Rev. 2016, 36, 749–786. [Google Scholar] [CrossRef]
 - Gutteridge, R.E.A.; Ndiaye, M.A.; Liu, X.; Ahmad, N. Plk1 Inhibitors in Cancer Therapy: From Laboratory to Clinics. Mol. Cancer Ther. 2016, 15, 1427–1435. [Google Scholar] [CrossRef]
 - Symeonidou, V.; Jakobczyk, H.; Bashanfer, S.; Malouf, C.; Fotopoulou, F.; Kotecha, R.S.; Anderson, R.A.; Finch, A.J.; Ottersbach, K. Defining the fetal origin of MLL-AF4 infant leukemia highlights specific fatty acid requirements. Cell Rep. 2021, 37, 109900. [Google Scholar] [CrossRef]
 - Zeisig, B.B.; Fung, T.K.; Zarowiecki, M.; Tsai, C.T.; Luo, H.; Stanojevic, B.; Lynn, C.; Leung, A.Y.H.; Zuna, J.; Zaliova, M.; et al. Functional reconstruction of human AML reveals stem cell origin and vulnerability of treatment-resistant MLL-rearranged leukemia. Sci. Transl. Med. 2021, 13, eabc4822. [Google Scholar] [CrossRef]
 - Martin, B.T.; Strebhardt, K. Polo-Like Kinase 1: Target and Regulator of Transcriptional Control. Cell Cycle 2006, 5, 2881–2885. [Google Scholar] [CrossRef]
 - Liu, C.-C.; Wang, H.; Wang, W.-D.; Wang, L.; Liu, W.-J.; Wang, J.-H.; Geng, Q.-R.; Lu, Y. ENO2 Promotes Cell Proliferation, Glycolysis, and Glucocorticoid-Resistance in Acute Lymphoblastic Leukemia. Cell. Physiol. Biochem. 2018, 46, 1525–1535. [Google Scholar] [CrossRef]
 - Archambault, V.; Lépine, G.; Kachaner, D. Understanding the Polo Kinase machine. Oncogene 2015, 34, 4799–4807. [Google Scholar] [CrossRef]
 - Baran, V.; Brzakova, A.; Rehak, P.; Kovarikova, V.; Solc, P. PLK1 regulates spindle formation kinetics and APC/C activation in mouse zygote. Zygote 2015, 24, 338–345. [Google Scholar] [CrossRef]
 - Bruinsma, W.; Macůrek, L.; Freire, R.; Lindqvist, A.; Medema, R.H. Bora and Aurora-A continue to activate Plk1 in mitosis. J. Cell Sci. 2013, 127, 801–811. [Google Scholar] [CrossRef]
 - Bruno, S.; di Rorà, A.G.L.; Napolitano, R.; Soverini, S.; Martinelli, G.; Simonetti, G. CDC20 in and out of mitosis: A prognostic factor and therapeutic target in hematological malignancies. J. Exp. Clin. Cancer Res. 2022, 41, 159. [Google Scholar] [CrossRef]
 - Dias, S.S.; Hogan, C.; Ochocka, A.M.; Meek, D.W. Polo-like kinase-1 phosphorylates MDM2 at Ser260 and stimulates MDM2-mediated p53 turnover. FEBS Lett. 2009, 583, 3543–3548. [Google Scholar] [CrossRef]
 - Enserink, J.M.; Kolodner, R.D. An overview of Cdk1-controlled targets and processes. Cell Div. 2010, 5, 11. [Google Scholar] [CrossRef]
 - Fang, L.; Liu, Q.; Cui, H.; Zheng, Y.; Wu, C. Bioinformatics Analysis Highlight Differentially Expressed CCNB1 and PLK1 Genes as Potential Anti-Breast Cancer Drug Targets and Prognostic Markers. Genes 2022, 13, 654. [Google Scholar] [CrossRef]
 - Ikeda, M.; Tanaka, K. Plk1 bound to Bub1 contributes to spindle assembly checkpoint activity during mitosis. Sci. Rep. 2017, 7, 8794. [Google Scholar] [CrossRef]
 - Joukov, V.; De Nicolo, A. Aurora-PLK1 cascades as key signaling modules in the regulation of mitosis. Sci. Signal 2018, 11, eaar4195. [Google Scholar] [CrossRef]
 - Liu, X.S.; Li, H.; Song, B. Polo-like kinase 1 phosphorylation of G2 and S-phase-expressed 1 protein is essential for p53 inactivation during G2 checkpoint recovery. Embo Rep. 2010, 11, 626–632. [Google Scholar] [CrossRef]
 - Parrilla, A.; Cirillo, L.; Thomas, Y.; Gotta, M.; Pintard, L.; Santamaria, A. Mitotic entry: The interplay between Cdk1, Plk1 and Bora. Cell Cycle 2016, 15, 3177–3182. [Google Scholar] [CrossRef]
 - Singh, P.; Pesenti, M.E.; Maffini, S.; Carmignani, S.; Hedtfeld, M.; Petrovic, A.; Srinivasamani, A.; Bange, T.; Musacchio, A. BUB1 and CENP-U, Primed by CDK1, Are the Main PLK1 Kinetochore Receptors in Mitosis. Mol. Cell 2020, 81, 67–87.e9. [Google Scholar] [CrossRef]
 - Yamano, H. APC/C: Current understanding and future perspectives. F1000Research 2019, 8, 725. [Google Scholar] [CrossRef]
 - Jia, L.; Li, B.; Yu, H. The Bub1–Plk1 kinase complex promotes spindle checkpoint signalling through Cdc20 phosphorylation. Nat. Commun. 2016, 7, 10818. [Google Scholar] [CrossRef]
 - Zhang, H.; Zhang, X.; Li, X.; Meng, W.; Bai, Z.; Rui, S.; Wang, Z.; Zhou, W.; Jin, X. Effect of CCNB1 silencing on cell cycle, senescence, and apoptosis through the p53 signaling pathway in pancreatic cancer. J. Cell. Physiol. 2018, 234, 619–631. [Google Scholar] [CrossRef]
 - Combes, G.; Alharbi, I.; Braga, L.G.; Elowe, S. Playing polo during mitosis: PLK1 takes the lead. Oncogene 2017, 36, 4819–4827. [Google Scholar] [CrossRef]
 - Fischer, M.; Quaas, M.; Nickel, A.; Engeland, K. Indirect p53-dependent transcriptional repression of Survivin, CDC25C, and PLK1 genes requires the cyclin-dependent kinase inhibitor p21/CDKN1A and CDE/CHR promoter sites binding the DREAM complex. Oncotarget 2015, 6, 41402–41417. [Google Scholar] [CrossRef]
 - Gavet, O.; Pines, J. Progressive Activation of CyclinB1-Cdk1 Coordinates Entry to Mitosis. Dev. Cell 2010, 18, 533–543. [Google Scholar] [CrossRef]
 - Ghelli Luserna Di Rorà, A.; Bocconcelli, M.; Ferrari, A.; Terragna, C.; Bruno, S.; Imbrogno, E.; Beeharry, N.; Robustelli, V.; Ghetti, M.; Napolitano, R.; et al. Synergism Through WEE1 and CHK1 Inhibition in Acute Lymphoblastic Leukemia. Cancers 2019, 11, 1654. [Google Scholar] [CrossRef]
 - E Harley, M.; A Allan, L.; Sanderson, H.S.; Clarke, P.R. Phosphorylation of Mcl-1 by CDK1–cyclin B1 initiates its Cdc20-dependent destruction during mitotic arrest. EMBO J. 2010, 29, 2407–2420. [Google Scholar] [CrossRef]
 - Liu, K.; Zheng, M.; Lu, R.; Du, J.; Zhao, Q.; Li, Z.; Li, Y.; Zhang, S. The role of CDC25C in cell cycle regulation and clinical cancer therapy: A systematic review. Cancer Cell Int. 2020, 20, 213. [Google Scholar] [CrossRef]
 - Zhang, Z.; Zhang, G.; Kong, C. FOXM1 participates in PLK1-regulated cell cycle progression in renal cell cancer cells. Oncol. Lett. 2016, 11, 2685–2691. [Google Scholar] [CrossRef]
 - Chou, T.-C. Theoretical Basis, Experimental Design, and Computerized Simulation of Synergism and Antagonism in Drug Combination Studies. Pharmacol. Rev. 2006, 58, 621–681. [Google Scholar] [CrossRef]
 - Chou, T.-C. Drug combination studies and their synergy quantification using the Chou-Talalay method. Cancer Res. 2010, 70, 440–446. [Google Scholar] [CrossRef]
 - Andersson, A.K.; Ma, J.; Wang, J.; Chen, X.; Gedman, A.L.; Dang, J.; Nakitandwe, J.; Holmfeldt, L.; Parker, M.; Easton, J.; et al. The landscape of somatic mutations in infant MLL-rearranged acute lymphoblastic leukemias. Nat. Genet. 2015, 47, 330–337. [Google Scholar] [CrossRef]
 - Ottersbach, K.; Sanjuan-Pla, A.; Torres-Ruíz, R.; Bueno, C.; Velasco-Hernández, T.; Menendez, P. The “Never-Ending” Mouse Models for MLL-Rearranged Acute Leukemia Are Still Teaching Us. Hemasphere 2018, 2, e57. [Google Scholar] [CrossRef]
 - Agraz-Doblas, A.; Bueno, C.; Bashford-Rogers, R.; Roy, A.; Schneider, P.; Bardini, M.; Ballerini, P.; Cazzaniga, G.; Moreno, T.; Revilla, C.; et al. Unraveling the cellular origin and clinical prognostic markers of infant B-cell acute lymphoblastic leukemia using genome-wide analysis. Haematologica 2019, 104, 1176–1188. [Google Scholar] [CrossRef]
 - van de Weerdt, B.C.; Medema, R.H. Polo-like kinases: A team in control of the division. Cell Cycle 2006, 5, 853–864. [Google Scholar] [CrossRef]
 - Zeidan, A.M.; Ridinger, M.; Lin, T.L.; Becker, P.S.; Schiller, G.J.; Patel, P.A.; Spira, A.I.; Tsai, M.L.; Samuëlsz, E.; Silberman, S.L.; et al. A Phase Ib Study of Onvansertib, a Novel Oral PLK1 Inhibitor, in Combination Therapy for Patients with Relapsed or Refractory Acute Myeloid Leukemia. Clin. Cancer Res. 2020, 26, 6132–6140. [Google Scholar] [CrossRef]
 - Yan, M.; Wang, C.; He, B.; Yang, M.; Tong, M.; Long, Z.; Liu, B.; Peng, F.; Xu, L.; Zhang, Y.; et al. Aurora-A Kinase: A Potent Oncogene and Target for Cancer Therapy. Med. Res. Rev. 2016, 36, 1036–1079. [Google Scholar] [CrossRef]
 - Metselaar, D.S.; du Chatinier, A.; Meel, M.H.; ter Huizen, G.; Waranecki, P.; Goulding, J.R.; Bugiani, M.; Koster, J.; Kaspers, G.J.; Hulleman, E. AURKA and PLK1 inhibition selectively and synergistically block cell cycle progression in diffuse midline glioma. iScience 2022, 25, 104398. [Google Scholar] [CrossRef]
 - Buechele, C.; Breese, E.H.; Schneidawind, D.; Lin, C.-H.; Jeong, J.; Duque-Afonso, J.; Wong, S.H.K.; Smith, K.S.; Negrin, R.S.; Porteus, M.; et al. MLL leukemia induction by genome editing of human CD34+ hematopoietic cells. Blood 2015, 126, 1683–1694. [Google Scholar] [CrossRef]
 - Ewels, P.A.; Peltzer, A.; Fillinger, S.; Patel, H.; Alneberg, J.; Wilm, A.; Garcia, M.U.; Di Tommaso, P.; Nahnsen, S. The nf-core framework for community-curated bioinformatics pipelines. Nat. Biotechnol. 2020, 38, 276–278. [Google Scholar] [CrossRef]
 - Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef]
 - Srinivasan, K.; Friedman, B.A.; Larson, J.L.; Lauffer, B.E.; Goldstein, L.D.; Appling, L.L.; Borneo, J.; Poon, C.; Ho, T.; Cai, F.; et al. Untangling the brain’s neuroinflammatory and neurodegenerative transcriptional responses. Nat. Commun. 2016, 7, 11295. [Google Scholar] [CrossRef]
 - Szklarczyk, D.; Kirsch, R.; Koutrouli, M.; Nastou, K.; Mehryary, F.; Hachilif, R.; Gable, A.L.; Fang, T.; Doncheva, N.T.; Pyysalo, S.; et al. The STRING database in 2023: Protein-protein association networks and functional enrichment analyses for any sequenced genome of interest. Nucleic Acids Res. 2023, 51, D638–D646. [Google Scholar] [CrossRef]
 - Orchard, S.; Ammari, M.; Aranda, B.; Breuza, L.; Briganti, L.; Broackes-Carter, F.; Campbell, N.H.; Chavali, G.; Chen, C.; Del-Toro, N.; et al. The MIntAct project–IntAct as a common curation platform for 11 molecular interaction databases. Nucleic Acids Res. 2014, 42, D358–D363. [Google Scholar] [CrossRef]
 - Shannon, P.; Markiel, A.; Ozier, O.; Baliga, N.S.; Wang, J.T.; Ramage, D.; Amin, N.; Schwikowski, B.; Ideker, T. Cytoscape: A software environment for integrated models of Biomolecular Interaction Networks. Genome Res. 2003, 13, 2498–2504. [Google Scholar] [CrossRef]
 








| Gene | Forward Primer Sequence 5′-3′ | Reverse Primer Sequence 5′-3′ | 
|---|---|---|
| PLK1 | GCCCCTCACAGTCCTCAATAAAG | TCTCTCGAACCACTGGTTCTTCTT | 
| AURKA | TGGTCGCCCTCTGGGTAAAGGA | TCCAAGTGGTGCATATTCCAGA | 
| BORA | AACAAACTCTCGCCAGTCCT | GACGATGAATATCTTCTGGGTCTA | 
| FOXM1 | TCCAACATCCAGTGGCTTCG | TCATGCGCTTCCTCTCAGTG | 
| CDC20 | CGCTATATCCCCCATCGCAG | AGCCGAAGGATCTTGGCTTC | 
| GTSE1 | CGGGATGTTCTCCCTGACAA | AGGAGGACTTCCTTGCGAGA | 
| 18S | CGGCTACCACATCCAAGGAA | GCTGGAATTACCGCGGCT | 
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.  | 
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Fischer, J.; Erkner, E.; Radszuweit, P.; Hentrich, T.; Keppeler, H.; Korkmaz, F.; Schulze-Hentrich, J.; Fitzel, R.; Lengerke, C.; Schneidawind, D.; et al. Only Infant MLL-Rearranged Leukemia Is Susceptible to an Inhibition of Polo-like Kinase 1 (PLK-1) by Volasertib. Int. J. Mol. Sci. 2024, 25, 12760. https://doi.org/10.3390/ijms252312760
Fischer J, Erkner E, Radszuweit P, Hentrich T, Keppeler H, Korkmaz F, Schulze-Hentrich J, Fitzel R, Lengerke C, Schneidawind D, et al. Only Infant MLL-Rearranged Leukemia Is Susceptible to an Inhibition of Polo-like Kinase 1 (PLK-1) by Volasertib. International Journal of Molecular Sciences. 2024; 25(23):12760. https://doi.org/10.3390/ijms252312760
Chicago/Turabian StyleFischer, Jacqueline, Estelle Erkner, Pia Radszuweit, Thomas Hentrich, Hildegard Keppeler, Fulya Korkmaz, Julia Schulze-Hentrich, Rahel Fitzel, Claudia Lengerke, Dominik Schneidawind, and et al. 2024. "Only Infant MLL-Rearranged Leukemia Is Susceptible to an Inhibition of Polo-like Kinase 1 (PLK-1) by Volasertib" International Journal of Molecular Sciences 25, no. 23: 12760. https://doi.org/10.3390/ijms252312760
APA StyleFischer, J., Erkner, E., Radszuweit, P., Hentrich, T., Keppeler, H., Korkmaz, F., Schulze-Hentrich, J., Fitzel, R., Lengerke, C., Schneidawind, D., & Schneidawind, C. (2024). Only Infant MLL-Rearranged Leukemia Is Susceptible to an Inhibition of Polo-like Kinase 1 (PLK-1) by Volasertib. International Journal of Molecular Sciences, 25(23), 12760. https://doi.org/10.3390/ijms252312760
        
