Next Article in Journal
Unravelling the Signature Follicular Fluid Metabolites in Dairy Cattle Follicles Growing Under Negative Energy Balance: An In Vitro Approach
Previous Article in Journal
Albumin Is an Integrative Protein of Blood Plasma and Beyond
Previous Article in Special Issue
Molecular Mechanisms Linking Genes and Vitamins of the Complex B Related to One-Carbon Metabolism in Breast Cancer: An In Silico Functional Database Study
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Synergic Immunomodulatory Effect of Vitamin D and Chickpea Protein Hydrolysate in THP-1 Cells: An In Vitro Approach

by
Ángela Alcalá-Santiago
1,2,
Rocío Toscano-Sánchez
3,
José Carlos Márquez-López
4,
José Antonio González-Jurado
5,
María-Soledad Fernández-Pachón
6,
Belén García-Villanova
1,
Justo Pedroche
4,* and
Noelia María Rodríguez-Martín
4
1
Department of Nutrition and Food Science, Faculty of Pharmacy, University of Granada, 18071 Granada, Spain
2
Instituto de Investigación Biosanitaria ibs. GRANADA, 18012 Granada, Spain
3
Department of Medical Biochemistry, Molecular Biology, and Immunology, Faculty of Medicine, University of Seville, Av. Dr. Fedriani 3, 41071 Seville, Spain
4
Group of Plant Proteins, Instituto de la Grasa-CSIC, 41013 Seville, Spain
5
Physical and Sport Education, Physical Performance and Sports Research Center, University Pablo de Olavide, 41013 Sevilla, Spain
6
Area of Nutrition and Food Sciences, Department of Molecular Biology, and Biochemistry Engineering, University Pablo de Olavide, 41013 Seville, Spain
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2024, 25(23), 12628; https://doi.org/10.3390/ijms252312628
Submission received: 4 November 2024 / Revised: 15 November 2024 / Accepted: 22 November 2024 / Published: 25 November 2024
(This article belongs to the Special Issue The Role of Micronutrients in Metabolic and Infectious Diseases)

Abstract

Vitamin D (VD), a crucial micronutrient, regulates bone health and immune responses. Recent studies suggest that VD may confer protective effects against chronic inflammatory diseases. Additionally, plant-based peptides can show biological activities. Furthermore, the supplementation of protein hydrolysates with VD could potentially enhance the bioactivity of peptides, leading to synergistic effects. In this study, THP-1 cells were exposed to low concentrations of Lipopolysaccharide (LPS) to induce inflammation, followed by treatment with vitamin D at different concentrations (10, 25, or 50 nM) or a chickpea protein hydrolysate (“H30BIO”) supplemented with VD. The cytotoxicity of VD was evaluated using viability assay to confirm its safety. The cytokine secretion of TNF-α, IL-1β, and IL6 was assessed in the cell supernatant, and the gene expression of TNF-α, IL-1β, IL6, IL8, CASP-1, COX2, NRF2, NF-ĸB, NLRP3, CCL2, CCR2, IP10, IL10, and RANTES was quantified by qRT-PCR. Treatment with VD alone significantly decreased the expression of the pro-inflammatory genes TNF-α and IL6, as well as their corresponding cytokine levels in the supernatants. While IL-1β gene expression remained unchanged, a reduction in its cytokine release was observed upon VD treatment. No dose-dependent effects were observed. Interestingly, the combination of VD with H30BIO led to an increase in TNF-α expression and secretion in contrast with the LPS control, coupled with a decrease in IL-1β levels. Additionally, genes such as IP10, NF-κB, CCL2, COX2, NRF2, and CASP-1 exhibited notable modulation, suggesting that the combination treatment primarily downregulates NF-κB-related gene activity. This study demonstrates a synergistic interaction between VD and H30BIO, suggesting that this combination may enhance pathways involving TNF-α, potentially aiding in the resolution and modulation of inflammation through adaptive processes. These findings open new avenues for research into the therapeutic applications of enriched protein hydrolysates with VD to manage low-grade inflammatory-related conditions.

1. Introduction

VD is a fat-soluble vitamin with critical functions in human physiology. This vitamin exists in two forms: D3 (cholecalciferol) and D2 (ergocalciferol). The most well-known function of VD is bone mineralization, achieved by regulating the levels of calcium and phosphorus in the bone matrix [1,2]. A significant aspect supporting the role of VD in immune regulation is the expression of the VD receptor (VDR) on most immune cells, including B and T lymphocytes, monocytes, macrophages, and dendritic cells. Furthermore, VD can be locally metabolized by immune cells, converting from 25-hydroxyvitamin D3 (25(OH)D3) to its active form 1,25-dihydroxyvitamin D3 (1,25(OH)2D3) [2,3].The combined action of VD and the nuclear receptor VDR exert a modulating effect on the immune response by promoting the differentiation of dendritic cells and regulatory T cells, while reducing Th17 helper T cell responses and the secretion of inflammatory cytokines [2]. Additionally, VD has the ability to suppress adaptive immunity and modulate inflammation, making it a potential target for therapeutic interventions [4,5,6]. Experimental models have demonstrated that VD downregulates T helper 1 (Th1)-mediated immune responses, inhibiting the production of pro-inflammatory cytokines such as interferon gamma (IFN-γ), Interleukin 6 (IL6), Interleukin 2 (IL2), and tumor necrosis factor alpha (TNF-α) [2,7]. The immunomodulatory activity of VD also enhances Th2 cell activity and regulatory T cells (Treg) [8]. In vitro assays show that VD3 promotes dendritic cell differentiation and high levels of anti-inflammatory cytokines (e.g., Interleukin 10 (IL10)), as well as the inhibition of pro-inflammatory cytokines (TNF-α and IL6) [9,10,11,12,13].
VD can be obtained through two main pathways: endogenous synthesis and dietary intake. Approximately 80% of the VD pool is derived from endogenous synthesis, where 7-dehydrocholecalciferol is converted to cholecalciferol (VD3) upon exposure to ultraviolet B (UVB) radiation in the skin. The remaining VD is obtained from dietary sources, mainly in the form of VD3. Rich dietary sources of VD3 include liver oil and fatty fish, followed by beef liver, dairy products, and egg yolks. The VD2 isoform is found in plant-based foods, with mushrooms being one of the few natural sources. This is particularly important for at risk populations such as the elderly, individuals with limited sun exposure, those with malabsorption disorders, athletes requiring enhanced recovery and immune support, and certain chronic conditions [5,14,15,16,17,18,19,20]. Some studies suggest that VD deficiency might contribute to chronic diseases associated with increased inflammation and immune system deregulation.
The fortification of foods with VD has become a widely adopted strategy to address deficiencies, considering that VD deficiency is a global public health concern [21]. Fortified products, including dairy items like milk and yogurt, plant-based beverages, orange juice, and cereals, have demonstrated efficacy in improving VD status and associated health outcomes, such as enhanced bone mineral density, cardiovascular risk markers, and immune function [14,22]. Additionally, there is growing interest in developing functional foods using protein hydrolysates combined with other vitamins, such as vitamin C and vitamin E, to enhance their bioactive properties. These products are particularly interesting for their potential to improve the bioavailability of these nutrients and to provide synergistic health benefits, especially in reducing oxidative stress and inflammation, providing new advancements and directions for functional foods [23].
On the other hand, enzymatic protein hydrolysates, consisting of a mixture of peptides and free amino acids, enhance their bioactive properties, in contrast with the non-hydrolyzed protein [24]. Chickpea protein hydrolysates, in particular, have shown an effective modulation of oxidative stress and inflammation in several studies [25,26,27,28,29]. These studies show their biological relevance not only in cellular models but also using molecular docking studies [30,31]. In a previous study, our group showed the physicochemical and antioxidant properties of a chickpea protein hydrolysate, H30BIO, through ex vivo assays [26]. Moreover, H30BIO exerts notable effects at the cellular level, suggesting mitochondrial protection and anti-inflammatory activity [32]. A few studies have also investigated the activity of chickpea protein hydrolysates in cellular lines, demonstrating an antioxidant capacity and immunomodulatory and antidiabetic activities [25,28,33,34].
Given the crucial role of VD in modulating immune responses, combining it with the chickpea protein hydrolysate “H30BIO”, which possesses antioxidant and anti-inflammatory properties, could enhance its therapeutic potential [32]. Unlike other VD-fortified foods, the combination of H30BIO and VD could result in a synergistic effect, boosting the anti-inflammatory response of the body. In light of these considerations, this study aims to investigate the anti-inflammatory effects of a VD-enriched protein supplement in a model of LPS-induced low-grade inflammation using THP-1 cells. We hypothesize that the combination of VD with hydrolyzed chickpea protein will more effectively modulate the inflammatory response compared to VD alone, providing valuable insights into potential therapeutic strategies for managing inflammatory-related conditions.

2. Results

2.1. Effect of VD on Cell Viability

An MTT assay was employed to evaluate the viability or cytotoxicity of VD (Figure 1). This assay relies on the oxidative metabolism of cells, particularly the mitochondrial production of ATP [35]. The data revealed that after 24 h (Figure 1A) and 48 h (Figure 1B) of exposure to VD, there were no significant differences in cell viability compared to the live control. The viability study of H30BIO demonstrated that it is a non-toxic ingredient, as described in detail by Rodríguez-Martin et al., 2022 [32].

2.2. The Effect of VD on Pro-Inflammatory Cytokines and Genes

The release of pro-inflammatory cytokines TNF-α, IL-1β, and IL6 into the cellular medium was quantified to evaluate the impact of VD treatment. As illustrated in Figure 2B,D,F, a significant reduction in the levels of TNF-α, IL-1β, and IL6, respectively, was observed when cells were treated with VD at any concentration (T1, T2, T3) compared to the pro-inflammatory control (C+, low LPS concentration). Gene expression analysis (Figure 2A: TNF-α, Figure 2C: IL-1β, Figure 2E: IL6) revealed a substantial downregulation of TNF-α and IL6 expression following VD treatment relative to the LPS control (C+). However, IL-1β gene expression remained largely unchanged under the same conditions. Notably, no dose-dependent effect was detected across the VD-treated groups.

2.3. Effect of VD-Supplemented H30BIO on Pro-Inflammatory Cytokines and Genes

Treatment with H30BIO (T4) and VD-supplemented H30BIO (T5) resulted in a significant reduction in the release of IL-1β (Figure 3D) and IL6 (Figure 3F) in the cellular supernatants compared to the control, which was further confirmed by the downregulation of their gene expression, as shown in Figure 3C and Figure 3E, respectively. There were no differences between the effects of H30BIO alone and VD-supplemented H30BIO. Interestingly, the release of TNF-α (Figure 3B) remained comparable to that of the LPS control (C++) with both treatments. However, the gene expression of TNF-α (Figure 3A) was similar to C++ in cells treated with H30BIO alone but significantly elevated in those treated with VD-supplemented H30BIO.

2.4. Effect of VD and VD-Supplemented H30BIO on NF-κB Pathway Genes

Gene expression analyses were performed to investigate how VD influences the reduction in LPS-induced inflammation within the primary inflammatory pathway NF-κB. As shown in Figure 4, significant changes in most gene expressions were observed in VD treatments compared to the LPS control (C+, low LPS concentration). Notably, treatments with all concentrations of VD led to a significant decrease in the expression of the NF-κB and CASP-1 genes. Additionally, a downregulation trend in NRF2 expression was observed, which became significant at higher VD doses.
Parallel experiments with H30BIO (T4) and VD-supplemented H30BIO (T5) (Figure 5) demonstrated that H30BIO alone and supplemented with VD downregulated NRF2 and CASP-1 compared to the control. Notably, the combination of VD and H30BIO exhibited a significant effect on the downregulation of NF-kB compared to H30BIO alone.

2.5. Effect of VD and VD-Supplemented H30BIO on M1/M2-Related Markers

In this study, the stimulation of undifferentiated THP-1 cells with LPS altered the expression of markers associated with monocytic activation. Although these cells were not differentiated into macrophages, the observed changes are similar to the subset macrophage profile, indicating a pro-inflammatory activation induced by LPS. In this regard, the responses of all genes in the different treatments were analyzed using a normalized approach (Figure 6). In relation to VD treatment, the analysis of polarization markers through gene expression showed that VD did not significantly alter the expression of IL8 or IP10, as observed in Figure 4 and Figure 6A, while COX2 expression was upregulated following VD treatment. Treatment with H30BIO alone resulted in the downregulation of IL8, IP10, IL10, CCL2, and COX2, while CCR2 mRNA expression levels remained unchanged (Figure 5 and Figure 6B). In VD-supplemented H30BIO treatments, there was a downregulation of CCR2 and CCL2 compared to the LPS control. Interestingly, the downregulation of IL10 and IL8 was also observed in this case, but these expressions were higher in comparison with the H30BIO treatment alone; additionally, the IP10 downregulation was higher using both compounds (Figure 5 and Figure 6B).
When cells were treated with VD-supplemented H30BIO, the mRNA levels of IP10, CCR2, and CCL2 were lower compared to the treatment with H30BIO alone. COX2 expression levels were similar between the VD-supplemented H30BIO and H30BIO treatments. Additionally, IL10 and IL8 expression levels were slightly higher in the VD-supplemented H30BIO treatment compared to H30BIO alone.

2.6. Enrichment Analyses

The enrichment analysis results presented in Figure 7 highlight several key pathways associated with inflammation and immune response processes. Particularly, Figure 7A shows results derived from the Biocarta, 7B Hallmark, and 7C KEGG databases.
These pathways show a significant overrepresentation of the genes involved in cytokine-cytokine receptor interactions, including IL-1β, IL8, TNF-α, IL6, CCL2, RANTES (CCL5), IL10, CCR2, and IP10. These cytokines are crucial mediators of inflammation, and the analysis underscores their role in regulating immune cell activation, with the NF-κB, cytokine, and NOD-like receptor pathways further driving these processes through IL6, IL8, IL10, and TNF-α expression. The involvement of these genes points to their significance in modulating immune responses, particularly in inflammation-driven conditions.
Additionally, the analysis identifies genes linked to the activation and signaling of immune cells such as macrophages, neutrophils, and natural killer (NK) cells (IL-1β, TNF-α, IL8), which are essential in the body’s response to infections and tissue damage. The NF-κB pathway, a pivotal regulator of inflammation, also shows enrichment with regard to the majority of the genes, playing a major role in controlling immune responses and the expression of inflammatory mediators (Figure 7B). Importantly, the analysis suggests that these enriched pathways are associated with NOD-like and cytokine receptor signaling-related diseases, such as autoimmune conditions including asthma, rheumatoid arthritis, and systemic lupus erythematosus, amongst others, emphasizing how dysregulated inflammation may contribute to these diseases (Figure 7C). The results suggest that the enriched protein hydrolysate may be valuable for interacting with these pathways.

3. Discussion

Low-grade and systemic chronic inflammation can arise due to various factors, including increased body fat, sleep, and stress, among others linked to poor habits, environmental influences, or genetic predisposition. In addition, chronic or infectious diseases or microbiome dysbiosis contribute to the exacerbation of chronic inflammation, and it often escalates with age. Low-grade inflammation is associated with an increased risk of developing several non-communicable diseases, such as cancer, cardiovascular diseases, type 2 diabetes, depression, and neurodegenerative and autoimmune disorders [36]. Given that approximately 74% of global deaths are attributable to non-communicable diseases [37], it is of interest to design dietary strategies to control many of the mentioned factors. The study of functional ingredients capable of managing inflammation is an emerging means to improve inflammation status, human health, and longevity.
In this study, we used THP-1, a human monocytic leukemia cell line, which is commonly extended to study monocyte and macrophage functions, inflammatory mechanisms, signaling pathways, and nutrient and drug transport [38]. In this context, LPS is often used to induce inflammation in THP-1 cells, serving as a pro-inflammatory model [39,40,41]. Given the extensive acceptance and use of this model, investigating the synergistic actions between VD and the chickpea protein hydrolysate “H30BIO” on pro-inflammatory genes presents a valuable in vitro approach.
Inflammation is a cellular defense mechanism, which involves several immune cells, blood vessels, and pro-inflammatory molecules in an effort to remove cellular damage and to start the healing process in tissues. Signaling events, including the activation of transcriptional factor NF-κB, are triggered in this process. NF-κB maintains the control of the production and release of pro-inflammatory cytokines such as IL-1β, TNFα, and IL6 [42]. Otherwise, intracellular receptors such as the NLRP3 inflammasome and CASP-1 are part of an indispensable complex system responsible not only for the maturation and release of IL-1β but also for NF-κB positive feedback and reactive oxygen species production. VD may modulate these pathways, potentially affecting IL-1β secretion through post-transcriptional mechanisms, without altering gene expression [43]. Additionally, other chemokines act as recruiting immune cells, such as IL8 and CCL2 [44]. Together, these elements create a cytokine storm involved in the pro-inflammatory response but also maintain a special role in the inflammation’s resolution. These molecules, among others, can act in negative or positive feedback, which is critical for understanding the resolution phase that allows for the return to cellular homeostasis and the healing processes. And several signaling molecules act as activating or deactivating proteins and molecules, serving as an enhancer in this process.
Our study demonstrated that VD, both alone and in combination with the protein hydrolysate H30BIO, significantly modulates the expression of key pro-inflammatory cytokines and genes involved in the NF-κB pathway. Specifically, VD treatment led to a marked reduction in the expression of TNF-α and IL6, as well as a significant downregulation of the NF-κB and CASP-1 genes, suggesting a potent anti-inflammatory effect. In line with these results, in vitro assays show that VD3 promotes dendritic cell differentiation, characterized by the presence of low levels of inflammatory cytokines such as TNF-α and high levels of IL10, as an anti-inflammatory cytokine [9,10]. Moreover, other studies show that the active form of VD inhibits the LPS-induced production of IL6 and TNF-α by human monocytes in a dose-dependent manner, supporting the role of VD as an immunomodulatory agent and corroborating our results [11,12,13].
Interestingly, while H30BIO alone reduced pro-inflammatory markers (IL-1β, IL6) and did not maintain action through TNF-α, also contrasting with previous results ([32], article under review), its combination with VD resulted in a downregulation of pro-inflammatory genes in the same manner as H30BIO (while creating an upregulation of TNF-α and also a downregulation of IL10 in comparison with LPS) but higher than H30BIO alone, and a significative downregulation of IP10, indicating a synergistic effect not previously reported. In this context, TNF-α plays a particular role in the positive feedback of cytokine signaling pathways and also in healing processes [45]. Thus, we may hypothesize that the function of TNF-α depends on the activation of the soluble or membrane form of its receptors, tumor necrosis factor-alpha receptor 1 (TNFR-1) or 2 (TNFR-2), which can stimulate different signaling pathways. For instance, in monocyte cells, TNFR-1 is mainly related to pro-inflammatory behavior, while TNFR-2 can induce the downregulation of IL8, IL1-β, and IL6, as well as the 50% downregulation of IL10 genes [46]. As Figure 5 and Figure 6 show, VD-H30BIO was implicated in the downregulation of IL8, IL-1β, IL6 and the downregulation of IL10, but with a higher expression if compared with the H30BIO alone; thus, both compounds might interact with TNFR, driving TNF-α coupling to TNFR-2 instead of TNFR-1. In addition, some authors indicate that the major expression of TNFR-1 or 2 is related to different monocyte subsets. Non-classical monocytes expressed the highest levels of TNFR-2, and the highest expression of TNFR-1 was found on intermediates [47].
Regarding monocyte subsets, human monocytes are generally classified into three subsets, classical (CD14++ CD16), intermediate (CD14++ CD16+), and non-classical (CD14+ CD16++), based on the expression of CD14 and CD16 markers [48,49,50]. However, since monocytes are key cells in the pathophysiological response to various stimuli, an increasing number of markers are being used to subdivide them into distinct functional subsets. The specific roles of these monocyte subsets in health and disease are still under investigation. In this context, other genes are considered in the clustering of monocyte differentiation, which is the case with TNFR-1 and 2, among others. For instance, the cytokine production of IL10, CCL2, IL8, or IL6 is associated with the classical subset; TNF-α, IL-1β, and IL6 are markers for the intermediate subset; and IL-1R, TNF-α and IL-1β characterize non-classical monocytes [50]. Moreover, Schmidl et al. (2014) identified that the motif signature of intermediate monocytes was dominated by the modulation of NF-κB. Additionally, their analysis suggests underlying epigenetic regulatory mechanisms among the three subsets, which are regulated by different metabolic processes—the glycolytic pathway in classical monocytes and oxidative phosphorylation in non-classical monocytes [51].
Results obtained in our study indicated that LPS stimulation (positive control) leads to an upregulation of gene expression, driving the activation of classical monocytes. This is due to an increased expression and production of cytokines and chemokines such as TNF-α, IL-1β, IL6, IL8, IP10, CCL2, and RANTES, as well as transcription factor NF-κB [50]. These data also align with the pro-inflammatory response pathways observed in the enrichment analysis using the Biocarta, Hallmark, and KEGG databases, suggesting the involvement of NF-κB, cytokine, and NLRP pathway activation through the overlapping genes (Figure 7). On the other hand, subsequent treatment with VD downregulated the expression and release of TNF-α and IL6 and caused a 50% downregulation of IL10, while upregulating the expression of COX2, leading to the non-classical monocyte subset, and did not maintain its effect through IL8, IP10, or CCL2. This suggests an anti-inflammatory profile that would possibly enhance the release of reactive oxygen species (ROS), which could be modulated by VD itself. In this sense, the differentiation of monocyte subsets and the anti-inflammatory activity of VD observed align with previous studies. For instance, Yong Zhang et al. (2012) demonstrated that VD reduces TNF-α and IL6 levels in a similar cellular model by inhibiting LPS-induced p38 activation and cytokine production in human monocytes, closely related to NF-κB pathway activation [11]. Their study showed a significant decrease in the CD14+ cells induced by LPS through treatment with VD, suggesting the conversion to non-classical monocytes or macrophages in peripheral blood mononuclear cells (PBMCs). While other studies did not report an increase in COX2 after exposure to VD in monocytes or macrophages, there is evidence of increased PGE2 synthesis in keratinocytes via an upregulation of COX2 expression, which may promote or attenuate cutaneous inflammation (as a dual role) [52], but also oxidative phosphorylation related to non-classical monocytes [52] may be regulated by COX2 pathways. Additionally, it is possible that the increase in COX2 expression in our study reflects a context-dependent response, where VD might enhance COX2 activity to support the inflammatory process [53]. This could represent a compensatory mechanism or a more regulated response to inflammation, which may explain the observed uptrend in COX2 expression in the VD + LPS group compared to LPS alone.
Finally, the expression and release of cytokines and chemokines after combined treatment with VD and H30BIO indicated a synergistic effect on possible cell differentiation. This is evidenced by the upregulation of TNF-α, the 50% downregulation of IL10, and the downregulation of COX2, IL8, RANTES, and CCL2, along with the most significant downregulation of NF-κB and IP10 observed. This pattern suggests differentiation towards a monocyte subset between the intermediate and non-classical monocytes [49]. In this context, an enrichment analysis using Biocarta indicated that the IL10 and TNF-α genes are highly correlated with NF-κB and related pathways such as RELA (Transcription Factor P65) and the HIVNEF (HIV-1 Nef-Interacting Protein), which plays a role in autoimmunity through the regulation of NF-κB [54]. Furthermore, these cytokines are associated with the modulation of ATP production in the mitochondria through the TID (DnaJ Homolog Subfamily A Member 3, Mitochondrial) pathway [54]. On the other hand, other studies suggest that H30BIO shows a protective action on the mitochondria, restoring SOD2 (Superoxide Dismutase 2) at activity and gene expression levels [32].
Given the results obtained, the synergic anti-inflammatory activity of VD with H30BIO could have significant therapeutic potential in managing chronic and low-grade inflammatory conditions. The ability of VD-supplemented H30BIO to downregulate key inflammatory markers more effectively than VD alone suggests that this combination could enhance the efficacy of existing treatments in certain cases or serve as a novel therapy. Despite the promising results, further investigation is needed to fully understand the overall effect and to test the potential beneficial effect in in vivo studies.

4. Materials and Methods

4.1. Chemicals and Sampling

1α,25-Dihydroxyvitamin D3 was provided by Sigma Chemical Co. (St Louis, MO, USA, Cat. No. 32222-06-3). Lipopolysaccharide (LPS, E. coli 055: B5) was purchased from Sigma-Aldrich (St Louis, MO, USA; Ref: L2637). The chickpea protein hydrolysate H30BIO was obtained by the Group of Plant Protein at the Instituto de la Grasa-CSIC (Seville, Spain) [26]. Cell culture media and other cellular-grade reagents were purchased from Biowest (Nuaille, France) and Gibco, Thermo Fisher Scientific (Madrid, Spain).
3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) was purchased from Sigma-Aldrich (St. Louis, MO, USA; Cat. No. 298-93-1). Trisure (Bioline, Meridian Life Science, Inc., Memphis, TN, USA) was used to isolate total RNA, and a synthesis kit from Bio-Rad (Hercules, CA, USA; Ref: 1708890) was used to reverse transcribe it to cDNA. Primers were designed using Primer3 software (open-source, developed by Helen J. Skaletsky and Steve Rozen at the Whitehead Institute, Cambridge, MA, USA; maintained by the Primer3 community, GitHub repository) and synthesized by Eurofins Genomics (Ebersberg, Germany). Real-Time Quantitative PCR was performed using the iTaq™ Universal SYBR® Green Supermix of Bio-Rad (Hercules, CA, USA; Ref: 1725120).
All chemicals (reagents and solvents) were of biomolecular grade and were provided by Sigma-Aldrich (St. Louis, MO, USA), Bachem AG (Bubendorf, Switzerland), and Gibco, Thermo Fisher Scientific (Madrid, Spain). The disposable plastics used in the experiments were DNase and RNase-free, sterile, and were mainly supplied by Thermo Fisher Scientific (Madrid, Spain).

4.2. Cell Culture Maintenance

The THP-1 cells were obtained from the Cell Biology Unit at the Instituto de la Grasa (Seville, Spain). The cells were maintained in Roswell Park Memorial Institute (RPMI)-1640 medium, supplemented with 10% heat-inactivated fetal bovine serum (Biowest, Nuaillé, France) and 1% penicillin/streptomycin (Gibco, Thermo Fisher Scientific, Madrid, Spain). They were incubated in 5% CO2 at 37 °C in a CO2 incubator (Binder CB170L, Binder GmbH, Tuttlingen, Germany).

4.3. Cell Toxicity Assay

Cytotoxicity was measured using the MTT method. THP-1 cells were incubated in 96-well plates at a density of 1 × 106 cells/mL for 24 h and 48 h with VD (1, 5, 10, 25, and 50 nM). In these plates, cell life (only live cells) and cell death (live cells with triton) controls were included. After this period, the MTT solution was added and incubated over 3 h until a purple precipitate was visible. MTT-formazan crystals were solubilized with DMSO (Sigma-Aldrich, St. Louis, MO, USA) and then measured with a microplate reader at 570 nm, corrected to 650 nm. Cell survival was expressed as the percentage of absorbance compared with that obtained in the control (non-treated cells).

4.4. Cellular Treatments

In this study, 50 ng/mL LPS was used to induce a moderate inflammatory response for VD treatment (at 10, 25, or 50 nM) to determine the optimal concentration of VD, while 100 ng/mL LPS was employed to generate a stronger inflammatory challenge for the combined treatment with VD (at 10 nM) and H30BIO (250 µg/mL).
In the first experiment, cells were treated with LPS and/or VD. This experiment maintained different conditions consisting of a negative control (non-LPS and non-VD added), positive control (cells stimulated with LPS at 50 ng/mL), and treatments in LPS-stimulated cells with VD at 10, 25, or 50 nM (T1, T2, T3). The LPS was added, and it was left to incubate for 1 h. Finally, VD was added in the selected concentrations and allowed to incubate for 24 h.
The second experiment included LPS at 100 ng/mL. Subsequently, after 1 h incubation, the chickpea protein hydrolysate (H30BIO) at a concentration of 250 µg/mL (T4) or the H30BIO with VD (10 nM) (T5) was added and incubated for 24 h. The concentrations used and experimental procedure for both experiments are indicated in Table 1.
Two different batches of experiments, in triplicate at least, were conducted.

4.5. Evaluation of Cytokine Secretion by ELISA

The cytokine release in the culture media collected after the treatments was determined by an ELISA kit (Diaclone, Besancon, France). The tumor necrosis factor alpha (TNF-α), Interleukin 1 Beta (IL-1β), and Interleukin 6 (IL6) concentrations were measured. All tests were carried out in strict accordance with the manufacturer’s instructions. ELISA data were calculated using a standard curve supplied in the commercial kit and expressed as pg/mL.

4.6. RNA Isolation and Real-Time Quantitative PCR Analysis

Treated THP-1 cells were harvested and total mRNA was isolated to quantify gene expression by qRT-PCR, using a CFX connect 96 system (Bio-Rad, Hercules, CA, USA). Briefly, total mRNA was extracted using the TRIsure reagent and alcohol-based extraction methods. mRNA quality was assessed by calculating the A260/A280 ratio using a NanoDrop ND-1000 spectrophotometer (Denovix, Wilmington, DE, USA, Model DS-11-FX). Isolated mRNA was subjected to reverse transcription using the iScript cDNA Synthesis Kit (Bio-Rad, Hercules, CA, USA). An amount of 10 ug of the resulting cDNA was used as a template for qRT-PCR amplifications with Brilliant SYBR green Supermix. The magnitude of change in mRNA expression for the candidate genes (Table 2) was calculated using the standard 2−(ΔΔCt) method. All data were normalized to the endogenous reference (HPRT and GAPDH) gene content and expressed as a relative fold change of the control. Table 2 shows the primer pairs of genes used in this work.

4.7. Statistical Analysis

All values are expressed as arithmetic means ± SD. Statistics were evaluated with Graph Pad Prism Version 8.0.1 software (GraphPad Software, San Diego, CA, USA). Differences between the sample groups were evaluated by a one-way analysis of variance (ANOVA), followed by Tukey’s multiple comparison test as a post hoc test. p values less than 0.05 were considered statistically significant.
A heat map was generated to visualize the relative expression of the genes analyzed by quantitative real-time PCR, using GraphPad Prism version 8.0.1 (GraphPad Software, San Diego, CA, USA). The expression data for each gene were normalized relative to the overstimulated control (C+ or C++), which was assigned a value of 100%. The heat map scale ranges from 0% to 150% relative to this control, allowing a visualization of expression levels both below and above the control.

4.8. Enrichment Analysis

We conducted enrichment analyses on the gene set selected in the previous steps using the FUMA platform’s GENE2FUNC module (FUMA, Vrije Universiteit Amsterdam, Amsterdam, The Netherlands; accessed via https://fuma.ctglab.nl/gene2func on 22 September 2024). This tool allowed us to gather information on gene expression patterns and shared molecular functions between the selected genes. Specifically, we obtained functional analysis results for molecular, cellular, and metabolic pathways. The platform also provides enrichment analysis results based on genes, pathways, and tissue-specific expression. It is integrated with several widely used resources, such as Gene Ontology (GO), WikiPathways, and the Molecular Signatures Database (MsigDB).
We focused primarily on the enrichment analysis conducted using this platform. For the enrichment analysis, hypergeometric tests were performed to assess whether our genes of interest were overrepresented in predefined gene sets. The background gene set, representing the “universe,” consisted of the remaining genes from our study. These predefined gene sets were compared against the background genes for pathway enrichment using multiple data repositories, including MsigDB (Broad Institute, Cambridge, MA, USA), WikiPathways (WikiPathways Project, Maastricht University, Maastricht, The Netherlands), GO (Gene Ontology Consortium, Sacramento, CA, USA), and KEGG (Kyoto Encyclopedia of Genes and Genomes, Kyoto University, Kyoto, Japan). GO classifies gene functions into three categories: cellular component, molecular function, and biological process. KEGG provides insights into metabolic pathways and annotations for the enzymes involved at each step. MsigDB includes canonical pathways from KEGG, Reactome (European Bioinformatics Institute, Hinxton, UK), WikiPathways, and other databases. All these resources were accessed on 22 September 2024.

5. Conclusions

Our study demonstrates the synergistic and complex interactions between VD and H30BIO in modulating pro-inflammatory gene expression in THP-1 cells within a low-grade inflammatory microenvironment. While VD downregulates TNF-α, H30BIO selectively causes a downregulation of IL-1β without affecting TNF-α. The combined treatment exerts a synergistic effect, significantly reducing the expression of IL-1β, CCR2, and IP10, while also increasing TNF-α expression and maintaining a 50% downregulation of IL10 cytokine. These findings provide compelling evidence that VD, particularly when combined with H30BIO, exerts significant anti-inflammatory effects by modulating key cytokines and genes within the NF-κB pathway. This suggests the modulation of adaptive processes related to intermediate and non-classical monocyte subsets, as well as potential interactions with TNF receptors. Our results open new avenues for the development of combined nutraceuticals or functional ingredients aimed at more effectively controlling the low-grade inflammation involved in the origin of many chronic diseases.

Author Contributions

Conceptualization, N.M.R.-M., Á.A.-S. and J.P.; methodology, Á.A.-S., N.M.R.-M., R.T.-S. and J.C.M.-L.; formal analysis, Á.A.-S. and N.M.R.-M.; investigation, Á.A-S. and N.M.R.-M.; data curation, Á.A.-S. and N.M.R.-M.; writing—original draft preparation, Á.A.-S. and N.M.R.-M.; writing—review and editing N.M.R.-M., B.G.-V., J.P. and M.-S.F.-P.; supervision, N.M.R.-M., J.P., M.-S.F.-P. and B.G.-V.; project administration, J.P., J.A.G.-J. and M.-S.F.-P.; funding acquisition, J.P., J.A.G.-J. and M.-S.F.-P. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by Project PECOVID-0200-2020, funded by Consejería de Salud de la Junta de Andalucía and co-funded by the European Regional Development Fund (ERDF-FEDER). This work was also financially supported by the Center for the Development of Industrial Technology (CDTI) and the Technological Corporation of Andalusia (CTA), together with the company Moreno Ruiz Hermanos S.L.-Aurora Intelligent Nutrition, and co-funded by the Multi-Regional Operational Program from the European Regional Development Fund (ERDF) (IDI-20200562), as well as by the State Plan for Scientific and Technical Research and Innovation 2017–2020—“R + D + i Projects” from the Spanish Ministry of Science and Innovation (PID2019-111368RB.-I00).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding author.

Acknowledgments

The authors would like to express their gratitude to the Cell Biology Unit of the Instituto de la Grasa-CSIC for their assistance during the completion of this work, especially to Rocío Abia González for her dedication and support. Rocío Toscano-Sanchez has the benefit of a “Margarita Salas” postdoctoral grant from The Recovery Transformation and Resilience plan (Next Generation, EU).

Conflicts of Interest

The authors declare no conflicts of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of the data; in the writing of the manuscript; nor in the decision to publish the results.

References

  1. Alcalá-Santiago, A.; Rodríguez-Barranco, M.; Rava, M.; Jiménez-Sousa, M.A.; Gil, A.; Sánchez, M.J.; Molina-Montes, E. Vitamin D Deficiency and COVID-19: A Biological Database Study on Pathways and Gene-Disease Associations. Int. J. Mol. Sci. 2022, 23, 14256. [Google Scholar] [CrossRef] [PubMed]
  2. Sassi, F.; Tamone, C.; D’Amelio, P. Vitamin D: Nutrient, Hormone, and Immunomodulator. Nutrients 2018, 10, 1656. [Google Scholar] [CrossRef] [PubMed]
  3. Hosoda, H.; Tamura, H.; Nagaoka, I. Evaluation of the lipopolysaccharide-induced transcription of the human TREM-1 gene in vitamin D3-matured THP-1 macrophage-like cells. Int. J. Mol. Med. 2015, 36, 1300–1310. [Google Scholar] [CrossRef] [PubMed]
  4. Zhang, Y.-G.; Wu, S.; Sun, J. Vitamin D, vitamin D receptor and tissue barriers. Tissue Barriers 2013, 1, e23118. [Google Scholar] [CrossRef]
  5. Voltan, G.; Cannito, M.; Ferrarese, M.; Ceccato, F.; Camozzi, V. Vitamin D: An Overview of Gene Regulation, Ranging from Metabolism to Genomic Effects. Genes 2023, 14, 1691. [Google Scholar] [CrossRef]
  6. Wei, R.; Christakos, S. Mechanisms Underlying the Regulation of Innate and Adaptive Immunity by Vitamin D. Nutrients 2015, 7, 8251–8260. [Google Scholar] [CrossRef]
  7. Carvalho, J.T.G.; Schneider, M.; Cuppari, L.; Grabulosa, C.C.; Aoike, D.T.; Redublo, B.M.Q.; Batista, M.C.; Cendoroglo, M.; Moyses, R.M.; Dalboni, M.A. Cholecalciferol decreases inflammation and improves vitamin D regulatory enzymes in lymphocytes in the uremic environment: A randomized controlled pilot trial. PLoS ONE 2017, 12, e0179540. [Google Scholar] [CrossRef]
  8. Pichler, J.; Gerstmayr, M.; Szépfalusi, Z.; Urbanek, R.; Peterlik, M.; Willheim, M. 1α,25(OH)2D3 Inhibits Not Only Th1 But Also Th2 Differentiation in Human Cord Blood T Cells. Pediatr. Res. 2002, 52, 12–18. [Google Scholar] [CrossRef][Green Version]
  9. Penna, G.; Adorini, L. 1α,25-Dihydroxyvitamin D3 Inhibits Differentiation, Maturation, Activation, and Survival of Dendritic Cells Leading to Impaired Alloreactive T Cell Activation. J. Immunol. 2000, 164, 2405–2411. [Google Scholar] [CrossRef]
  10. Piemonti, L.; Monti, P.; Sironi, M.; Fraticelli, P.; Leone, B.E.; Dal Cin, E.; Allavena, P.; Di Carlo, V. Vitamin D3 Affects Differentiation, Maturation, and Function of Human Monocyte-Derived Dendritic Cells. J. Immunol. 2000, 164, 4443–4451. [Google Scholar] [CrossRef]
  11. Zhang, Y.; Leung, D.Y.M.; Richers, B.N.; Liu, Y.; Remigio, L.K.; Riches, D.W.; Goleva, E. Vitamin D Inhibits Monocyte/Macrophage Proinflammatory Cytokine Production by Targeting MAPK Phosphatase-1. J. Immunol. 2012, 188, 2127–2135. [Google Scholar] [CrossRef] [PubMed]
  12. Siddiqui, M.; Manansala, J.S.; Abdulrahman, H.A.; Nasrallah, G.K.; Smatti, M.K.; Younes, N.; Althani, A.A.; Yassine, H.M. Immune Modulatory Effects of Vitamin D on Viral Infections. Nutrients 2020, 12, 2879. [Google Scholar] [CrossRef] [PubMed]
  13. Ghaseminejad-Raeini, A.; Ghaderi, A.; Sharafi, A.; Nematollahi-Sani, B.; Moossavi, M.; Derakhshani, A.; Sarab, G.A. Immunomodulatory actions of vitamin D in various immune-related disorders: A comprehensive review. Front. Immunol. 2023, 14, 950465. [Google Scholar] [CrossRef] [PubMed]
  14. Sinha, S.K.; Sun, L.; Didero, M.; Martins, D.; Norris, K.C.; Lee, J.E.; Meng, Y.-X.; Sung, J.H.; Sayre, M.; Carpio, M.B.; et al. Vitamin D3 Repletion Improves Vascular Function, as Measured by Cardiorenal Biomarkers in a High-Risk African American Cohort. Nutrients 2022, 14, 3331. [Google Scholar] [CrossRef]
  15. Tang, Q.; Liu, L.; Chen, M. Effects of vitamin D supplementation on patients with chronic heart failure: A meta-analysis. Nutr. Clin. Metab. 2024, 38, 168–178. [Google Scholar] [CrossRef]
  16. Abulafia, O.; Ashkenazi, E.; Epstein, Y.; Eliakim, A.; Nemet, D. Characteristics of Vitamin D Concentration in Elite Israeli Olympic Athletes. Nutrients 2024, 16, 2627. [Google Scholar] [CrossRef]
  17. Balasooriya, N.N.; Elliott, T.M.; Neale, R.E.; Vasquez, P.; Comans, T.; Gordon, L.G. The association between vitamin D deficiency and multiple sclerosis: An updated systematic review and meta-analysis. Mult. Scler. Relat. Disord. 2024, 90, 105804. [Google Scholar] [CrossRef]
  18. Martineau, A.R.; James, W.Y.; Hooper, R.L.; Barnes, N.C.; Jolliffe, D.A.; Greiller, C.L.; Islam, K.; McLaughlin, D.; Bhowmik, A.; Timms, P.M.; et al. Vitamin D 3 supplementation in patients with chronic obstructive pulmonary disease (ViDiCO): A multicentre, double-blind, randomised controlled trial. Lancet Respir. Med. 2015, 3, 120–130. [Google Scholar] [CrossRef]
  19. Jolliffe, D.A.; Camargo, C.A.; Sluyter, J.D.; Aglipay, M.; Aloia, J.F.; Ganmaa, D.; Bergman, P.; Bischoff-Ferrari, H.A.; Borzutzky, A.; Damsgaard, C.T.; et al. Vitamin D supplementation to prevent acute respiratory infections: A systematic review and meta-analysis of aggregate data from randomised controlled trials. Lancet Diabetes Endocrinol. 2021, 9, 276–292. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  20. Rejnmark, L.; Bislev, L.S.; Cashman, K.D.; Eiríksdottir, G.; Gaksch, M.; Grüebler, M.; Grimnes, G.; Gudnason, V.; Lips, P.; Pilz, S.; et al. Non-skeletal health effects of vitamin D supplementation: A systematic review on findings from meta-analyses summarizing trial data. PLoS ONE 2017, 12, e0180512. [Google Scholar] [CrossRef]
  21. Shin, J.; Choi, M.; Longtine, M.; Nelson, D. Vitamin D effects on pregnancy and the placenta. Placenta 2010, 31, 1027–1034. [Google Scholar] [CrossRef] [PubMed]
  22. Calvo, M.S.; Whiting, S.J. Public Health Strategies to Overcome Barriers to Optimal Vitamin D Status in Populations with Special Needs. J. Nutr. 2006, 136, 1135–1139. [Google Scholar] [CrossRef] [PubMed]
  23. Lagouri, V. (Ed.) Introductory Chapter: Functional Foods. In Functional Foods; IntechOpen: London, UK, 2019. [Google Scholar] [CrossRef]
  24. Tawalbeh, D.; Al-U’datt, M.H.; Ahmad, W.A.N.W.; Ahmad, F.; Sarbon, N.M. Recent Advances in In Vitro and In Vivo Studies of Antioxidant, ACE-Inhibitory and Anti-Inflammatory Peptides from Legume Protein Hydrolysates. Molecules 2023, 28, 2423. [Google Scholar] [CrossRef]
  25. Jamdar, S.N.; Deshpande, R.; Marathe, S.A. Effect of processing conditions and in vitro protein digestion on bioactive potentials of commonly consumed legumes. Food Biosci. 2017, 20, 1–11. [Google Scholar] [CrossRef]
  26. Rodríguez-Martín, N.M.; Márquez-López, J.C.; Cerrillo, I.; Millán, F.; González-Jurado, J.A.; Fernández-Pachón, M.-S.; Pedroche, J. Production of chickpea protein hydrolysate at laboratory and pilot plant scales: Optimization using principal component analysis based on antioxidant activities. Food Chem. 2023, 437, 137707. [Google Scholar] [CrossRef]
  27. Sánchez-Chino, X.M.; Martínez, C.J.; León-Espinosa, E.B.; Garduño-Siciliano, L.; Álvarez-González, I.; Madrigal-Bujaidar, E.; Vásquez-Garzón, V.R.; Baltiérrez-Hoyos, R.; Dávila-Ortiz, G. Protective Effect of Chickpea Protein Hydrolysates on Colon Carcinogenesis Associated With a Hypercaloric Diet. J. Am. Coll. Nutr. 2018, 38, 162–170. [Google Scholar] [CrossRef]
  28. Torres-Fuentes, C.; del Mar Contreras, M.; Recio, I.; Alaiz, M.; Vioque, J. Identification and characterization of antioxidant peptides from chickpea protein hydrolysates. Food Chem. 2015, 180, 194–202. [Google Scholar] [CrossRef]
  29. Yust, M.d.M.; Pedroche, J.; Millán-Linares, M.d.C.; Alcaide-Hidalgo, J.M.; Millán, F. Improvement of functional properties of chickpea proteins by hydrolysis with immobilised Alcalase. Food Chem. 2010, 122, 1212–1217. [Google Scholar] [CrossRef]
  30. Chandrasekaran, S.; de Mejia, E.G. Germinated chickpea protein ficin hydrolysate and its peptides inhibited glucose uptake and affected the bitter receptor signaling pathway in vitro. Food Funct. 2023, 14, 8467–8486. [Google Scholar] [CrossRef]
  31. Zhang, T.; Li, Y.; Miao, M.; Jiang, B. Purification and characterisation of a new antioxidant peptide from chickpea (Cicer arietium L.) protein hydrolysates. Food Chem. 2011, 128, 28–33. [Google Scholar] [CrossRef]
  32. Rodríguez-Martin, N.M.; Marquez, J.C.; Villanueva, Á.; Millán, F.; Millán-Linares, M.d.C.; Pedroche, J. Antioxidant Properties of Chickpea (Cicer arietinum L.) Protein Hydrolysates: The In Vitro Evaluation of SOD Activity in THP-1 Cell Line. In Proceedings of the IV Conference Ia ValSe-Food CYTED and VII Symposium Chia-Link, La Plata, Argentina, 14–18 November 2022; p. 12. [Google Scholar]
  33. Torres-Fuentes, C.; Alaiz, M.; Vioque, J. Chickpea chelating peptides inhibit copper-mediated lipid peroxidation. J. Sci. Food Agric. 2014, 94, 3181–3188. [Google Scholar] [CrossRef] [PubMed]
  34. Xue, Z.; Gao, J.; Zhang, Z.; Yu, W.; Wang, H.; Kou, X. Antihyperlipidemic and Antitumor Effects of Chickpea Albumin Hydrolysate. Plant Foods Hum. Nutr. 2012, 67, 393–400. [Google Scholar] [CrossRef] [PubMed]
  35. Dougall, I.G.; Unitt, J. Evaluation of the Biological Activity of Compounds. Pract. Med. Chem. 2015, 15–43. [Google Scholar] [CrossRef]
  36. Furman, D.; Campisi, J.; Verdin, E.; Carrera-Bastos, P.; Targ, S.; Franceschi, C.; Ferrucci, L.; Gilroy, D.W.; Fasano, A.; Miller, G.W.; et al. Chronic inflammation in the etiology of disease across the life span. Nat. Med. 2019, 25, 1822–1832. [Google Scholar] [CrossRef]
  37. Nearly 75% of Global Deaths Are Caused By Non-Communicable Diseases—How the G20 Can Help; AN EVENT REPORT FROM AN OFFICIAL T20 SIDE EVENT; NCD Alliance: London, UK, 2023.
  38. Chanput, W.; Mes, J.J.; Wichers, H.J. THP-1 cell line: An in vitro cell model for immune modulation approach. Int. Immunopharmacol. 2014, 23, 37–45. [Google Scholar] [CrossRef]
  39. Li, S.; Gao, X.; Wu, X.; Wu, Z.; Cheng, L.; Zhu, L.; Shen, D.; Tong, X. Parthenolide inhibits LPS-induced inflammatory cytokines through the toll-like receptor 4 signal pathway in THP-1 cells. Acta Biochim. Biophys. Sin. 2015, 47, 368–375. [Google Scholar] [CrossRef]
  40. Kobyakova, M.I.; Senotov, A.S.; Krasnov, K.S.; Lomovskaya, Y.V.; Odinokova, I.V.; Kolotova, A.A.; Ermakov, A.M.; Zvyagina, A.I.; Fadeeva, I.S.; Fetisova, E.I.; et al. Pro-Inflammatory Activation Suppresses TRAIL-induced Apoptosis of Acute Myeloid Leukemia Cells. Biochemistry 2024, 89, 431–440. [Google Scholar] [CrossRef]
  41. Su, Y.-C.; Phan, T.T.T.; Wang, T.-W.; Chang, S.-H.; Lin, F.-H.; Hsu, T.-S.; Lin, L.-Y. Nanoscaled biphasic calcium phosphate modulates osteogenesis and attenuates LPS-induced inflammation. Front. Bioeng. Biotechnol. 2023, 11, 1236429. [Google Scholar] [CrossRef]
  42. Liu, T.; Zhang, L.; Joo, D.; Sun, S.-C. NF-κB signaling in inflammation. Signal Transduct. Target. Ther. 2017, 2, 17023. [Google Scholar] [CrossRef]
  43. Swanson, K.V.; Deng, M.; Ting, J.P.-Y. The NLRP3 inflammasome: Molecular activation and regulation to therapeutics. Nat. Rev. Immunol. 2019, 19, 477–489. [Google Scholar] [CrossRef]
  44. West, A.P.; Shadel, G.S.; Ghosh, S. Mitochondria in innate immune responses. Nat. Rev. Immunol. 2011, 11, 389–402. [Google Scholar] [CrossRef] [PubMed]
  45. Bryan, N.; Ahswin, H.; Smart, N.; Bayon, Y.; Wohlert, S.; Hunt, J. Reactive oxygen species (ROS)—A family of fate deciding molecules pivotal in constructive inflammation and wound healing. Eur. Cells Mater. 2012, 24, 249–265. [Google Scholar] [CrossRef] [PubMed]
  46. Gane, J.M.; Stockley, R.A.; Sapey, E. TNF-αAutocrine Feedback Loops in Human Monocytes: The Pro- and Anti-Inflammatory Roles of the TNF-αReceptors Support the Concept of Selective TNFR1 BlockadeIn Vivo. J. Immunol. Res. 2016, 2016, 1079851. [Google Scholar] [CrossRef] [PubMed]
  47. Hijdra, D.; Vorselaars, A.D.M.; Grutters, J.C.; Claessen, A.M.E.; Rijkers, G.T. Phenotypic Characterization of Human Intermediate Monocytes. Front. Immunol. 2013, 4, 339. [Google Scholar] [CrossRef] [PubMed]
  48. Kapellos, T.S.; Bonaguro, L.; Gemünd, I.; Reusch, N.; Saglam, A.; Hinkley, E.R.; Schultze, J.L. Human Monocyte Subsets and Phenotypes in Major Chronic Inflammatory Diseases. Front. Immunol. 2019, 10, 2035. [Google Scholar] [CrossRef]
  49. Wacleche, V.S.; Tremblay, C.L.; Routy, J.-P.; Ancuta, P. The Biology of Monocytes and Dendritic Cells: Contribution to HIV Pathogenesis. Viruses 2018, 10, 65. [Google Scholar] [CrossRef]
  50. Cormican, S.; Griffin, M.D. Human Monocyte Subset Distinctions and Function: Insights from Gene Expression Analysis. Front. Immunol. 2020, 11, 1070. [Google Scholar] [CrossRef]
  51. Schmidl, C.; Renner, K.; Peter, K.; Eder, R.; Lassmann, T.; Balwierz, P.J.; Itoh, M.; Nagao-Sato, S.; Kawaji, H.; Carninci, P.; et al. Transcription and enhancer profiling in human monocyte subsets. Blood 2014, 123, e90–e99. [Google Scholar] [CrossRef]
  52. Ravid, A.; Shenker, O.; Buchner-Maman, E.; Rotem, C.; Koren, R. Vitamin D Induces Cyclooxygenase 2 Dependent Prostaglandin E2 Synthesis in HaCaT Keratinocytes. J. Cell. Physiol. 2015, 231, 837–843. [Google Scholar] [CrossRef]
  53. Giannini, S.; Giusti, A.; Minisola, S.; Napoli, N.; Passeri, G.; Rossini, M.; Sinigaglia, L. The Immunologic Profile of Vitamin D and Its Role in Different Immune-Mediated Diseases: An Expert Opinion. Nutrients 2022, 14, 473. [Google Scholar] [CrossRef]
  54. GeneCards Human Gene Database. GeneCards—Human Genes. Genecards.Org. Available online: https://www.genecards.org/ (accessed on 2 February 2023).
Figure 1. Cell viability analysis of THP-1 cells treated with different compounds at 24 and 48 h. The graph shows the 24 h viability of THP-1 cells treated with various concentrations of VD (1–50 nM) (A) and 48 h viability at the same concentrations for VD (B). Data are expressed as the mean (percentage of absorbance compared with that obtained in the control (non-treated cells)) ± SD, and different letters (a,b) were assigned in the multiple comparison test across all groups, indicating significant differences in a p value < 0.05, n ≥ 4. DC corresponds to the dead cells control and LC to the live cells control.
Figure 1. Cell viability analysis of THP-1 cells treated with different compounds at 24 and 48 h. The graph shows the 24 h viability of THP-1 cells treated with various concentrations of VD (1–50 nM) (A) and 48 h viability at the same concentrations for VD (B). Data are expressed as the mean (percentage of absorbance compared with that obtained in the control (non-treated cells)) ± SD, and different letters (a,b) were assigned in the multiple comparison test across all groups, indicating significant differences in a p value < 0.05, n ≥ 4. DC corresponds to the dead cells control and LC to the live cells control.
Ijms 25 12628 g001
Figure 2. Pro-inflammatory cytokines and genes in LPS-induced inflammation THP-1 cells treated with VD. The figure shows the mRNA of Tumor Necrotic Factor-α (TNF-α) levels (A), as well as the content of TNF-α in the supernatant of the treated cells described below (B). In (C), the figure shows the expression levels of Interleukin-1β (IL-1β) and the release of the IL-1β in cellular supernatants after the treatments (D). (E,F) show mRNA levels and content in the supernatant of Interleukin 6 (IL6), respectively. Data are expressed as the mean ± SD, and different letters (a–c) indicate statistical differences in the multiple comparison test across all groups using a p value < 0.05, n = 6. Treatments conducted were C: without reactive; C+: Lipopolysaccharide (LPS) (50 ng/mL); T1: LPS (50 ng/mL) + vitamin D (VD) (10 nM); T2: LPS (50 ng/mL) + VD (25 nM); T3: LPS (50 ng/mL) + VD (50 nM).
Figure 2. Pro-inflammatory cytokines and genes in LPS-induced inflammation THP-1 cells treated with VD. The figure shows the mRNA of Tumor Necrotic Factor-α (TNF-α) levels (A), as well as the content of TNF-α in the supernatant of the treated cells described below (B). In (C), the figure shows the expression levels of Interleukin-1β (IL-1β) and the release of the IL-1β in cellular supernatants after the treatments (D). (E,F) show mRNA levels and content in the supernatant of Interleukin 6 (IL6), respectively. Data are expressed as the mean ± SD, and different letters (a–c) indicate statistical differences in the multiple comparison test across all groups using a p value < 0.05, n = 6. Treatments conducted were C: without reactive; C+: Lipopolysaccharide (LPS) (50 ng/mL); T1: LPS (50 ng/mL) + vitamin D (VD) (10 nM); T2: LPS (50 ng/mL) + VD (25 nM); T3: LPS (50 ng/mL) + VD (50 nM).
Ijms 25 12628 g002
Figure 3. Pro-inflammatory cytokines and genes in LPS-induced inflammation THP-1 cells treated with H30BIO, alone and supplemented with vitamin D. The figure shows the mRNA of Tumor Necrotic Factor-α (TNF-α) levels (A), as well as the content of TNF-α in the supernatant of the treated cells described below (B). In (C), the figure shows the expression levels of Interleukin-1β (IL-1β) and the release of the IL-1β in cellular supernatants after the treatments (D). (E,F) show mRNA levels and content in the supernatant of Interleukin-6 (IL-6), respectively. Data are expressed as the mean ± SD, and different letters (a–c) indicates statistical differences in the multiple comparison test across all groups using a p value < 0.05, n = 6. Treatments conducted were C: without reactive; C++: Lipopolysaccharide (LPS) (100 ng/mL); T4: LPS (100 ng/mL) + H30BIO (250 µg/mL); T5: LPS (100 ng/mL) + vitamin D (10 nM) + H30BIO (250 µg/mL).
Figure 3. Pro-inflammatory cytokines and genes in LPS-induced inflammation THP-1 cells treated with H30BIO, alone and supplemented with vitamin D. The figure shows the mRNA of Tumor Necrotic Factor-α (TNF-α) levels (A), as well as the content of TNF-α in the supernatant of the treated cells described below (B). In (C), the figure shows the expression levels of Interleukin-1β (IL-1β) and the release of the IL-1β in cellular supernatants after the treatments (D). (E,F) show mRNA levels and content in the supernatant of Interleukin-6 (IL-6), respectively. Data are expressed as the mean ± SD, and different letters (a–c) indicates statistical differences in the multiple comparison test across all groups using a p value < 0.05, n = 6. Treatments conducted were C: without reactive; C++: Lipopolysaccharide (LPS) (100 ng/mL); T4: LPS (100 ng/mL) + H30BIO (250 µg/mL); T5: LPS (100 ng/mL) + vitamin D (10 nM) + H30BIO (250 µg/mL).
Ijms 25 12628 g003
Figure 4. Gene transcription levels of NF-κB pathway in LPS-induced inflammation THP-1 cells treated with vitamin D. The figure shows the relative levels of gene expression of Nuclear Factor Kappa B Subunit 1 (NF-κB) (A), Nuclear Factor Erythroid 2-related Factor 2 (NRF2) (B), Caspase-1 (CASP-1) (C), C-C Motif Chemokine Receptor 2 (CCR2) (D), C-C Motif Chemokine Ligand 2 (CCL2) (E), Interleukin 8 (IL8) (F), Cyclooxygenase-2 (COX2) (G), Interleukin 10 (IL10) (H), and C-X-C motif chemokine ligand 10 (CXCL10, IP10) (I). Data are expressed as the mean ± SD, and different letters (a–c) were assigned in the multiple comparison test across all groups, indicating significant differences at a p value < 0.05; and ‘ns’ indicates non-statistical differences in the multiple comparison test, n = 6. Treatments conducted were C: without reactive; C+: Lipopolysaccharide (LPS) (50 ng/mL); T1: LPS (50 ng/mL) + vitamin D (VD) (10 nM); T2: LPS (50 ng/mL) + VD (25 nM); T3: LPS (50 ng/mL) + VD (50 nM).
Figure 4. Gene transcription levels of NF-κB pathway in LPS-induced inflammation THP-1 cells treated with vitamin D. The figure shows the relative levels of gene expression of Nuclear Factor Kappa B Subunit 1 (NF-κB) (A), Nuclear Factor Erythroid 2-related Factor 2 (NRF2) (B), Caspase-1 (CASP-1) (C), C-C Motif Chemokine Receptor 2 (CCR2) (D), C-C Motif Chemokine Ligand 2 (CCL2) (E), Interleukin 8 (IL8) (F), Cyclooxygenase-2 (COX2) (G), Interleukin 10 (IL10) (H), and C-X-C motif chemokine ligand 10 (CXCL10, IP10) (I). Data are expressed as the mean ± SD, and different letters (a–c) were assigned in the multiple comparison test across all groups, indicating significant differences at a p value < 0.05; and ‘ns’ indicates non-statistical differences in the multiple comparison test, n = 6. Treatments conducted were C: without reactive; C+: Lipopolysaccharide (LPS) (50 ng/mL); T1: LPS (50 ng/mL) + vitamin D (VD) (10 nM); T2: LPS (50 ng/mL) + VD (25 nM); T3: LPS (50 ng/mL) + VD (50 nM).
Ijms 25 12628 g004
Figure 5. Gene transcription levels of NF-κB pathway in LPS-induced inflammation in THP-1 cells treated with H30BIO alone and supplemented with vitamin D. The figure shows the relative levels of gene expression of Nuclear Factor Kappa B Subunit 1 (NF-κB) (A), Nuclear Factor Erythroid 2-related Factor 2 (NRF2) (B), Caspase-1 (CASP-1) (C), C-C Motif Chemokine Receptor 2 (CCR2) (D), C-C Motif Chemokine Ligand 2 (CCL2) (E), Interleukin 8 (IL8) (F), Cyclooxygenase-2 (COX2) (G), Interleukin 10 (IL10) (H), and C-X-C motif chemokine ligand 10 (CXCL10, IP10) (I). Data are expressed as the mean ± SD, and different letters (a–c) were assigned in the multiple comparison test across all groups, indicating significant differences at a p value < 0.05, n = 6. Treatments conducted were C: without reactive; C++: Lipopolysaccharide (LPS) (100 ng/mL); T4: LPS (100 ng/mL) + H30BIO (250 µg/mL); T5: LPS (100 ng/mL) + VD (10 nM) + H30BIO (250 µg/mL).
Figure 5. Gene transcription levels of NF-κB pathway in LPS-induced inflammation in THP-1 cells treated with H30BIO alone and supplemented with vitamin D. The figure shows the relative levels of gene expression of Nuclear Factor Kappa B Subunit 1 (NF-κB) (A), Nuclear Factor Erythroid 2-related Factor 2 (NRF2) (B), Caspase-1 (CASP-1) (C), C-C Motif Chemokine Receptor 2 (CCR2) (D), C-C Motif Chemokine Ligand 2 (CCL2) (E), Interleukin 8 (IL8) (F), Cyclooxygenase-2 (COX2) (G), Interleukin 10 (IL10) (H), and C-X-C motif chemokine ligand 10 (CXCL10, IP10) (I). Data are expressed as the mean ± SD, and different letters (a–c) were assigned in the multiple comparison test across all groups, indicating significant differences at a p value < 0.05, n = 6. Treatments conducted were C: without reactive; C++: Lipopolysaccharide (LPS) (100 ng/mL); T4: LPS (100 ng/mL) + H30BIO (250 µg/mL); T5: LPS (100 ng/mL) + VD (10 nM) + H30BIO (250 µg/mL).
Ijms 25 12628 g005
Figure 6. Heat map of gene expression in LPS-induced inflammation THP-1 cells treated with vitamin D and/or H30BIO. The heat map represents gene expression normalized to the overstimulated control (C+ (A) or C++ (B)), with a color scale ranging from 0% (minimal expression, blue) to 150% (expression 50% higher than the C+ or C++ controls, red), n = 6. More intense red indicates higher levels of relative expression, while more light blue indicates lower levels. Treatments conducted were C: without reactive; C+: Lipopolysaccharide (LPS) (50 ng/mL); T1: LPS (50 ng/mL) + VD (10 nM); T2: LPS (50 ng/mL) + VD (25 nM); T3: LPS (50 ng/mL) + vitamin D (VD) (50 nM); C++: Lipopolysaccharide (LPS) (100 ng/mL); T4: LPS (100 ng/mL) + H30BIO (250 µg/mL); T5: LPS (100 ng/mL) + VD (10 nM) + H30BIO (250 µg/mL).
Figure 6. Heat map of gene expression in LPS-induced inflammation THP-1 cells treated with vitamin D and/or H30BIO. The heat map represents gene expression normalized to the overstimulated control (C+ (A) or C++ (B)), with a color scale ranging from 0% (minimal expression, blue) to 150% (expression 50% higher than the C+ or C++ controls, red), n = 6. More intense red indicates higher levels of relative expression, while more light blue indicates lower levels. Treatments conducted were C: without reactive; C+: Lipopolysaccharide (LPS) (50 ng/mL); T1: LPS (50 ng/mL) + VD (10 nM); T2: LPS (50 ng/mL) + VD (25 nM); T3: LPS (50 ng/mL) + vitamin D (VD) (50 nM); C++: Lipopolysaccharide (LPS) (100 ng/mL); T4: LPS (100 ng/mL) + H30BIO (250 µg/mL); T5: LPS (100 ng/mL) + VD (10 nM) + H30BIO (250 µg/mL).
Ijms 25 12628 g006
Figure 7. Enrichment analysis using Biocarta (A), Hallmark (B), and KEGG (C) databases. Enrichment adjusted log-transformed p-values and proportions of overlapping genes are displayed alongside corresponding pathway names. Key pathways include cytokine signaling, NF-κB activation, inflammatory response, and apoptosis. The results provide insights into the molecular and cellular processes associated with the analyzed gene set.
Figure 7. Enrichment analysis using Biocarta (A), Hallmark (B), and KEGG (C) databases. Enrichment adjusted log-transformed p-values and proportions of overlapping genes are displayed alongside corresponding pathway names. Key pathways include cytokine signaling, NF-κB activation, inflammatory response, and apoptosis. The results provide insights into the molecular and cellular processes associated with the analyzed gene set.
Ijms 25 12628 g007
Table 1. Summary of cellular treatments during experimentation.
Table 1. Summary of cellular treatments during experimentation.
CC+C++T1T2T3T4T5
LPS (50 ng/mL)-+-+++--
LPS (100 ng/mL)--+---++
Vit. D (10 nM)---+---+
Vit. D (25 nM)----+---
Vit. D (50 nM)-----+--
H30BIO (250 µg/mL)------++
C: control without reactive; C+ and C++: Lipopolysaccharide (LPS) (50 and 100 ng/mL, respectively); T1: LPS (50 ng/mL) + VD (10 nM); T2: LPS (50 ng(mL) + VD (25 nM); T3: LPS (50 ng/mL) + VD (50 nM); T4: LPS (100 ng/mL) + H30BIO (250 µg/mL); T5: LPS (100 ng/mL) + H30BIO (250 µg/mL) + VD (10 nM).
Table 2. Primer pairs of genes used in qRT-PCR experiments.
Table 2. Primer pairs of genes used in qRT-PCR experiments.
ForwardReverseMN
TNF-αTCCTTCAGACACCCTCAACCAGGCCCCAGTTTGAATTCTTNM_000594.3
IL-1βCTGTCCTGCGTGTTGAAAGATTCTGCTTGAGAGGTGCTGANM_000576.2
IL6TGCAATAACCACCCCTGACCGCTACATTTGCCGAAGAGCCNM_000600.5
IL8AGGAAAACTGGGTGCAGAGGCCCTACAACAGACCCACACANM_000584.4
CASP-1CAAGACCTCTGACAGCACGTGCAGGCCTGGATGATGATCANM_001257119.3
COX2GGTGACATCGATGCTGTGGA AGTGCTTGGCTTCCAGTAGG NM_000963.4
NRF2GCGACGGAAAGAGTATGAGCGTTGGCAGATCCACTGGTTTNM_006164.5
NF-κB1CTACGATGGAACCACACCCCGGTTCCAGGCACAACTCCTTNM_003998.4
NLRP3GGAGAGAGCTGCGATCCATCACAACACCCGATGCTGTCATNM_001127462.3
CCL2CCCCAGTCACCTGCTGTTATTGGAATCCTGAACCCACTTCNM_002982.3
CCR2GTGTGTGGAGGTCCAGGAGTAAGCCAGACGTGTGATTTCCNM_001123041.2
IP10 (CXCL10)GCAAGCCAATTTTGTCCACGTGTGGTCCATCCTTGGAAGCANC_000004.12
NRF2GCGACGGAAAGAGTATGAGCGTTGGCAGATCCACTGGTTTNM_006164.5
COX2GGTGACATCGATGCTGTGGA AGTGCTTGGCTTCCAGTAGG NM_000963.4
IL10TGCAAAACCAAACCACAAGATCTCGGAGATCTCGAAGCATNM_000572.2
RANTESAGGATCAAGACAGCACGTGGTACTCCTTGATGTGGGCACGNM_002985.3
GAPDHACAGTCAGCCGCATCTTCTTACGACCAAATCCGTTGACTCNM_001289745.2
HPRTTGGCGTCGTGATTAGTGATGAAGAGGGCTACAATGTGATGGCNM_000194.3
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Alcalá-Santiago, Á.; Toscano-Sánchez, R.; Márquez-López, J.C.; González-Jurado, J.A.; Fernández-Pachón, M.-S.; García-Villanova, B.; Pedroche, J.; Rodríguez-Martín, N.M. The Synergic Immunomodulatory Effect of Vitamin D and Chickpea Protein Hydrolysate in THP-1 Cells: An In Vitro Approach. Int. J. Mol. Sci. 2024, 25, 12628. https://doi.org/10.3390/ijms252312628

AMA Style

Alcalá-Santiago Á, Toscano-Sánchez R, Márquez-López JC, González-Jurado JA, Fernández-Pachón M-S, García-Villanova B, Pedroche J, Rodríguez-Martín NM. The Synergic Immunomodulatory Effect of Vitamin D and Chickpea Protein Hydrolysate in THP-1 Cells: An In Vitro Approach. International Journal of Molecular Sciences. 2024; 25(23):12628. https://doi.org/10.3390/ijms252312628

Chicago/Turabian Style

Alcalá-Santiago, Ángela, Rocío Toscano-Sánchez, José Carlos Márquez-López, José Antonio González-Jurado, María-Soledad Fernández-Pachón, Belén García-Villanova, Justo Pedroche, and Noelia María Rodríguez-Martín. 2024. "The Synergic Immunomodulatory Effect of Vitamin D and Chickpea Protein Hydrolysate in THP-1 Cells: An In Vitro Approach" International Journal of Molecular Sciences 25, no. 23: 12628. https://doi.org/10.3390/ijms252312628

APA Style

Alcalá-Santiago, Á., Toscano-Sánchez, R., Márquez-López, J. C., González-Jurado, J. A., Fernández-Pachón, M.-S., García-Villanova, B., Pedroche, J., & Rodríguez-Martín, N. M. (2024). The Synergic Immunomodulatory Effect of Vitamin D and Chickpea Protein Hydrolysate in THP-1 Cells: An In Vitro Approach. International Journal of Molecular Sciences, 25(23), 12628. https://doi.org/10.3390/ijms252312628

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop