The Synergic Immunomodulatory Effect of Vitamin D and Chickpea Protein Hydrolysate in THP-1 Cells: An In Vitro Approach
Abstract
1. Introduction
2. Results
2.1. Effect of VD on Cell Viability
2.2. The Effect of VD on Pro-Inflammatory Cytokines and Genes
2.3. Effect of VD-Supplemented H30BIO on Pro-Inflammatory Cytokines and Genes
2.4. Effect of VD and VD-Supplemented H30BIO on NF-κB Pathway Genes
2.5. Effect of VD and VD-Supplemented H30BIO on M1/M2-Related Markers
2.6. Enrichment Analyses
3. Discussion
4. Materials and Methods
4.1. Chemicals and Sampling
4.2. Cell Culture Maintenance
4.3. Cell Toxicity Assay
4.4. Cellular Treatments
4.5. Evaluation of Cytokine Secretion by ELISA
4.6. RNA Isolation and Real-Time Quantitative PCR Analysis
4.7. Statistical Analysis
4.8. Enrichment Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Alcalá-Santiago, A.; Rodríguez-Barranco, M.; Rava, M.; Jiménez-Sousa, M.A.; Gil, A.; Sánchez, M.J.; Molina-Montes, E. Vitamin D Deficiency and COVID-19: A Biological Database Study on Pathways and Gene-Disease Associations. Int. J. Mol. Sci. 2022, 23, 14256. [Google Scholar] [CrossRef] [PubMed]
- Sassi, F.; Tamone, C.; D’Amelio, P. Vitamin D: Nutrient, Hormone, and Immunomodulator. Nutrients 2018, 10, 1656. [Google Scholar] [CrossRef] [PubMed]
- Hosoda, H.; Tamura, H.; Nagaoka, I. Evaluation of the lipopolysaccharide-induced transcription of the human TREM-1 gene in vitamin D3-matured THP-1 macrophage-like cells. Int. J. Mol. Med. 2015, 36, 1300–1310. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.-G.; Wu, S.; Sun, J. Vitamin D, vitamin D receptor and tissue barriers. Tissue Barriers 2013, 1, e23118. [Google Scholar] [CrossRef]
- Voltan, G.; Cannito, M.; Ferrarese, M.; Ceccato, F.; Camozzi, V. Vitamin D: An Overview of Gene Regulation, Ranging from Metabolism to Genomic Effects. Genes 2023, 14, 1691. [Google Scholar] [CrossRef]
- Wei, R.; Christakos, S. Mechanisms Underlying the Regulation of Innate and Adaptive Immunity by Vitamin D. Nutrients 2015, 7, 8251–8260. [Google Scholar] [CrossRef]
- Carvalho, J.T.G.; Schneider, M.; Cuppari, L.; Grabulosa, C.C.; Aoike, D.T.; Redublo, B.M.Q.; Batista, M.C.; Cendoroglo, M.; Moyses, R.M.; Dalboni, M.A. Cholecalciferol decreases inflammation and improves vitamin D regulatory enzymes in lymphocytes in the uremic environment: A randomized controlled pilot trial. PLoS ONE 2017, 12, e0179540. [Google Scholar] [CrossRef]
- Pichler, J.; Gerstmayr, M.; Szépfalusi, Z.; Urbanek, R.; Peterlik, M.; Willheim, M. 1α,25(OH)2D3 Inhibits Not Only Th1 But Also Th2 Differentiation in Human Cord Blood T Cells. Pediatr. Res. 2002, 52, 12–18. [Google Scholar] [CrossRef][Green Version]
- Penna, G.; Adorini, L. 1α,25-Dihydroxyvitamin D3 Inhibits Differentiation, Maturation, Activation, and Survival of Dendritic Cells Leading to Impaired Alloreactive T Cell Activation. J. Immunol. 2000, 164, 2405–2411. [Google Scholar] [CrossRef]
- Piemonti, L.; Monti, P.; Sironi, M.; Fraticelli, P.; Leone, B.E.; Dal Cin, E.; Allavena, P.; Di Carlo, V. Vitamin D3 Affects Differentiation, Maturation, and Function of Human Monocyte-Derived Dendritic Cells. J. Immunol. 2000, 164, 4443–4451. [Google Scholar] [CrossRef]
- Zhang, Y.; Leung, D.Y.M.; Richers, B.N.; Liu, Y.; Remigio, L.K.; Riches, D.W.; Goleva, E. Vitamin D Inhibits Monocyte/Macrophage Proinflammatory Cytokine Production by Targeting MAPK Phosphatase-1. J. Immunol. 2012, 188, 2127–2135. [Google Scholar] [CrossRef] [PubMed]
- Siddiqui, M.; Manansala, J.S.; Abdulrahman, H.A.; Nasrallah, G.K.; Smatti, M.K.; Younes, N.; Althani, A.A.; Yassine, H.M. Immune Modulatory Effects of Vitamin D on Viral Infections. Nutrients 2020, 12, 2879. [Google Scholar] [CrossRef] [PubMed]
- Ghaseminejad-Raeini, A.; Ghaderi, A.; Sharafi, A.; Nematollahi-Sani, B.; Moossavi, M.; Derakhshani, A.; Sarab, G.A. Immunomodulatory actions of vitamin D in various immune-related disorders: A comprehensive review. Front. Immunol. 2023, 14, 950465. [Google Scholar] [CrossRef] [PubMed]
- Sinha, S.K.; Sun, L.; Didero, M.; Martins, D.; Norris, K.C.; Lee, J.E.; Meng, Y.-X.; Sung, J.H.; Sayre, M.; Carpio, M.B.; et al. Vitamin D3 Repletion Improves Vascular Function, as Measured by Cardiorenal Biomarkers in a High-Risk African American Cohort. Nutrients 2022, 14, 3331. [Google Scholar] [CrossRef]
- Tang, Q.; Liu, L.; Chen, M. Effects of vitamin D supplementation on patients with chronic heart failure: A meta-analysis. Nutr. Clin. Metab. 2024, 38, 168–178. [Google Scholar] [CrossRef]
- Abulafia, O.; Ashkenazi, E.; Epstein, Y.; Eliakim, A.; Nemet, D. Characteristics of Vitamin D Concentration in Elite Israeli Olympic Athletes. Nutrients 2024, 16, 2627. [Google Scholar] [CrossRef]
- Balasooriya, N.N.; Elliott, T.M.; Neale, R.E.; Vasquez, P.; Comans, T.; Gordon, L.G. The association between vitamin D deficiency and multiple sclerosis: An updated systematic review and meta-analysis. Mult. Scler. Relat. Disord. 2024, 90, 105804. [Google Scholar] [CrossRef]
- Martineau, A.R.; James, W.Y.; Hooper, R.L.; Barnes, N.C.; Jolliffe, D.A.; Greiller, C.L.; Islam, K.; McLaughlin, D.; Bhowmik, A.; Timms, P.M.; et al. Vitamin D 3 supplementation in patients with chronic obstructive pulmonary disease (ViDiCO): A multicentre, double-blind, randomised controlled trial. Lancet Respir. Med. 2015, 3, 120–130. [Google Scholar] [CrossRef]
- Jolliffe, D.A.; Camargo, C.A.; Sluyter, J.D.; Aglipay, M.; Aloia, J.F.; Ganmaa, D.; Bergman, P.; Bischoff-Ferrari, H.A.; Borzutzky, A.; Damsgaard, C.T.; et al. Vitamin D supplementation to prevent acute respiratory infections: A systematic review and meta-analysis of aggregate data from randomised controlled trials. Lancet Diabetes Endocrinol. 2021, 9, 276–292. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Rejnmark, L.; Bislev, L.S.; Cashman, K.D.; Eiríksdottir, G.; Gaksch, M.; Grüebler, M.; Grimnes, G.; Gudnason, V.; Lips, P.; Pilz, S.; et al. Non-skeletal health effects of vitamin D supplementation: A systematic review on findings from meta-analyses summarizing trial data. PLoS ONE 2017, 12, e0180512. [Google Scholar] [CrossRef]
- Shin, J.; Choi, M.; Longtine, M.; Nelson, D. Vitamin D effects on pregnancy and the placenta. Placenta 2010, 31, 1027–1034. [Google Scholar] [CrossRef] [PubMed]
- Calvo, M.S.; Whiting, S.J. Public Health Strategies to Overcome Barriers to Optimal Vitamin D Status in Populations with Special Needs. J. Nutr. 2006, 136, 1135–1139. [Google Scholar] [CrossRef] [PubMed]
- Lagouri, V. (Ed.) Introductory Chapter: Functional Foods. In Functional Foods; IntechOpen: London, UK, 2019. [Google Scholar] [CrossRef][Green Version]
- Tawalbeh, D.; Al-U’datt, M.H.; Ahmad, W.A.N.W.; Ahmad, F.; Sarbon, N.M. Recent Advances in In Vitro and In Vivo Studies of Antioxidant, ACE-Inhibitory and Anti-Inflammatory Peptides from Legume Protein Hydrolysates. Molecules 2023, 28, 2423. [Google Scholar] [CrossRef]
- Jamdar, S.N.; Deshpande, R.; Marathe, S.A. Effect of processing conditions and in vitro protein digestion on bioactive potentials of commonly consumed legumes. Food Biosci. 2017, 20, 1–11. [Google Scholar] [CrossRef]
- Rodríguez-Martín, N.M.; Márquez-López, J.C.; Cerrillo, I.; Millán, F.; González-Jurado, J.A.; Fernández-Pachón, M.-S.; Pedroche, J. Production of chickpea protein hydrolysate at laboratory and pilot plant scales: Optimization using principal component analysis based on antioxidant activities. Food Chem. 2023, 437, 137707. [Google Scholar] [CrossRef]
- Sánchez-Chino, X.M.; Martínez, C.J.; León-Espinosa, E.B.; Garduño-Siciliano, L.; Álvarez-González, I.; Madrigal-Bujaidar, E.; Vásquez-Garzón, V.R.; Baltiérrez-Hoyos, R.; Dávila-Ortiz, G. Protective Effect of Chickpea Protein Hydrolysates on Colon Carcinogenesis Associated With a Hypercaloric Diet. J. Am. Coll. Nutr. 2018, 38, 162–170. [Google Scholar] [CrossRef]
- Torres-Fuentes, C.; del Mar Contreras, M.; Recio, I.; Alaiz, M.; Vioque, J. Identification and characterization of antioxidant peptides from chickpea protein hydrolysates. Food Chem. 2015, 180, 194–202. [Google Scholar] [CrossRef]
- Yust, M.d.M.; Pedroche, J.; Millán-Linares, M.d.C.; Alcaide-Hidalgo, J.M.; Millán, F. Improvement of functional properties of chickpea proteins by hydrolysis with immobilised Alcalase. Food Chem. 2010, 122, 1212–1217. [Google Scholar] [CrossRef]
- Chandrasekaran, S.; de Mejia, E.G. Germinated chickpea protein ficin hydrolysate and its peptides inhibited glucose uptake and affected the bitter receptor signaling pathway in vitro. Food Funct. 2023, 14, 8467–8486. [Google Scholar] [CrossRef]
- Zhang, T.; Li, Y.; Miao, M.; Jiang, B. Purification and characterisation of a new antioxidant peptide from chickpea (Cicer arietium L.) protein hydrolysates. Food Chem. 2011, 128, 28–33. [Google Scholar] [CrossRef]
- Rodríguez-Martin, N.M.; Marquez, J.C.; Villanueva, Á.; Millán, F.; Millán-Linares, M.d.C.; Pedroche, J. Antioxidant Properties of Chickpea (Cicer arietinum L.) Protein Hydrolysates: The In Vitro Evaluation of SOD Activity in THP-1 Cell Line. In Proceedings of the IV Conference Ia ValSe-Food CYTED and VII Symposium Chia-Link, La Plata, Argentina, 14–18 November 2022; p. 12. [Google Scholar]
- Torres-Fuentes, C.; Alaiz, M.; Vioque, J. Chickpea chelating peptides inhibit copper-mediated lipid peroxidation. J. Sci. Food Agric. 2014, 94, 3181–3188. [Google Scholar] [CrossRef] [PubMed]
- Xue, Z.; Gao, J.; Zhang, Z.; Yu, W.; Wang, H.; Kou, X. Antihyperlipidemic and Antitumor Effects of Chickpea Albumin Hydrolysate. Plant Foods Hum. Nutr. 2012, 67, 393–400. [Google Scholar] [CrossRef] [PubMed]
- Dougall, I.G.; Unitt, J. Evaluation of the Biological Activity of Compounds. Pract. Med. Chem. 2015, 15–43. [Google Scholar] [CrossRef]
- Furman, D.; Campisi, J.; Verdin, E.; Carrera-Bastos, P.; Targ, S.; Franceschi, C.; Ferrucci, L.; Gilroy, D.W.; Fasano, A.; Miller, G.W.; et al. Chronic inflammation in the etiology of disease across the life span. Nat. Med. 2019, 25, 1822–1832. [Google Scholar] [CrossRef]
- Nearly 75% of Global Deaths Are Caused By Non-Communicable Diseases—How the G20 Can Help; AN EVENT REPORT FROM AN OFFICIAL T20 SIDE EVENT; NCD Alliance: London, UK, 2023.
- Chanput, W.; Mes, J.J.; Wichers, H.J. THP-1 cell line: An in vitro cell model for immune modulation approach. Int. Immunopharmacol. 2014, 23, 37–45. [Google Scholar] [CrossRef]
- Li, S.; Gao, X.; Wu, X.; Wu, Z.; Cheng, L.; Zhu, L.; Shen, D.; Tong, X. Parthenolide inhibits LPS-induced inflammatory cytokines through the toll-like receptor 4 signal pathway in THP-1 cells. Acta Biochim. Biophys. Sin. 2015, 47, 368–375. [Google Scholar] [CrossRef]
- Kobyakova, M.I.; Senotov, A.S.; Krasnov, K.S.; Lomovskaya, Y.V.; Odinokova, I.V.; Kolotova, A.A.; Ermakov, A.M.; Zvyagina, A.I.; Fadeeva, I.S.; Fetisova, E.I.; et al. Pro-Inflammatory Activation Suppresses TRAIL-induced Apoptosis of Acute Myeloid Leukemia Cells. Biochemistry 2024, 89, 431–440. [Google Scholar] [CrossRef]
- Su, Y.-C.; Phan, T.T.T.; Wang, T.-W.; Chang, S.-H.; Lin, F.-H.; Hsu, T.-S.; Lin, L.-Y. Nanoscaled biphasic calcium phosphate modulates osteogenesis and attenuates LPS-induced inflammation. Front. Bioeng. Biotechnol. 2023, 11, 1236429. [Google Scholar] [CrossRef]
- Liu, T.; Zhang, L.; Joo, D.; Sun, S.-C. NF-κB signaling in inflammation. Signal Transduct. Target. Ther. 2017, 2, 17023. [Google Scholar] [CrossRef]
- Swanson, K.V.; Deng, M.; Ting, J.P.-Y. The NLRP3 inflammasome: Molecular activation and regulation to therapeutics. Nat. Rev. Immunol. 2019, 19, 477–489. [Google Scholar] [CrossRef]
- West, A.P.; Shadel, G.S.; Ghosh, S. Mitochondria in innate immune responses. Nat. Rev. Immunol. 2011, 11, 389–402. [Google Scholar] [CrossRef] [PubMed]
- Bryan, N.; Ahswin, H.; Smart, N.; Bayon, Y.; Wohlert, S.; Hunt, J. Reactive oxygen species (ROS)—A family of fate deciding molecules pivotal in constructive inflammation and wound healing. Eur. Cells Mater. 2012, 24, 249–265. [Google Scholar] [CrossRef] [PubMed]
- Gane, J.M.; Stockley, R.A.; Sapey, E. TNF-αAutocrine Feedback Loops in Human Monocytes: The Pro- and Anti-Inflammatory Roles of the TNF-αReceptors Support the Concept of Selective TNFR1 BlockadeIn Vivo. J. Immunol. Res. 2016, 2016, 1079851. [Google Scholar] [CrossRef] [PubMed]
- Hijdra, D.; Vorselaars, A.D.M.; Grutters, J.C.; Claessen, A.M.E.; Rijkers, G.T. Phenotypic Characterization of Human Intermediate Monocytes. Front. Immunol. 2013, 4, 339. [Google Scholar] [CrossRef] [PubMed]
- Kapellos, T.S.; Bonaguro, L.; Gemünd, I.; Reusch, N.; Saglam, A.; Hinkley, E.R.; Schultze, J.L. Human Monocyte Subsets and Phenotypes in Major Chronic Inflammatory Diseases. Front. Immunol. 2019, 10, 2035. [Google Scholar] [CrossRef]
- Wacleche, V.S.; Tremblay, C.L.; Routy, J.-P.; Ancuta, P. The Biology of Monocytes and Dendritic Cells: Contribution to HIV Pathogenesis. Viruses 2018, 10, 65. [Google Scholar] [CrossRef]
- Cormican, S.; Griffin, M.D. Human Monocyte Subset Distinctions and Function: Insights from Gene Expression Analysis. Front. Immunol. 2020, 11, 1070. [Google Scholar] [CrossRef]
- Schmidl, C.; Renner, K.; Peter, K.; Eder, R.; Lassmann, T.; Balwierz, P.J.; Itoh, M.; Nagao-Sato, S.; Kawaji, H.; Carninci, P.; et al. Transcription and enhancer profiling in human monocyte subsets. Blood 2014, 123, e90–e99. [Google Scholar] [CrossRef]
- Ravid, A.; Shenker, O.; Buchner-Maman, E.; Rotem, C.; Koren, R. Vitamin D Induces Cyclooxygenase 2 Dependent Prostaglandin E2 Synthesis in HaCaT Keratinocytes. J. Cell. Physiol. 2015, 231, 837–843. [Google Scholar] [CrossRef]
- Giannini, S.; Giusti, A.; Minisola, S.; Napoli, N.; Passeri, G.; Rossini, M.; Sinigaglia, L. The Immunologic Profile of Vitamin D and Its Role in Different Immune-Mediated Diseases: An Expert Opinion. Nutrients 2022, 14, 473. [Google Scholar] [CrossRef]
- GeneCards Human Gene Database. GeneCards—Human Genes. Genecards.Org. Available online: https://www.genecards.org/ (accessed on 2 February 2023).
C | C+ | C++ | T1 | T2 | T3 | T4 | T5 | |
---|---|---|---|---|---|---|---|---|
LPS (50 ng/mL) | - | + | - | + | + | + | - | - |
LPS (100 ng/mL) | - | - | + | - | - | - | + | + |
Vit. D (10 nM) | - | - | - | + | - | - | - | + |
Vit. D (25 nM) | - | - | - | - | + | - | - | - |
Vit. D (50 nM) | - | - | - | - | - | + | - | - |
H30BIO (250 µg/mL) | - | - | - | - | - | - | + | + |
Forward | Reverse | MN | |
---|---|---|---|
TNF-α | TCCTTCAGACACCCTCAACC | AGGCCCCAGTTTGAATTCTT | NM_000594.3 |
IL-1β | CTGTCCTGCGTGTTGAAAGA | TTCTGCTTGAGAGGTGCTGA | NM_000576.2 |
IL6 | TGCAATAACCACCCCTGACC | GCTACATTTGCCGAAGAGCC | NM_000600.5 |
IL8 | AGGAAAACTGGGTGCAGAGG | CCCTACAACAGACCCACACA | NM_000584.4 |
CASP-1 | CAAGACCTCTGACAGCACGT | GCAGGCCTGGATGATGATCA | NM_001257119.3 |
COX2 | GGTGACATCGATGCTGTGGA | AGTGCTTGGCTTCCAGTAGG | NM_000963.4 |
NRF2 | GCGACGGAAAGAGTATGAGC | GTTGGCAGATCCACTGGTTT | NM_006164.5 |
NF-κB1 | CTACGATGGAACCACACCCC | GGTTCCAGGCACAACTCCTT | NM_003998.4 |
NLRP3 | GGAGAGAGCTGCGATCCATC | ACAACACCCGATGCTGTCAT | NM_001127462.3 |
CCL2 | CCCCAGTCACCTGCTGTTAT | TGGAATCCTGAACCCACTTC | NM_002982.3 |
CCR2 | GTGTGTGGAGGTCCAGGAGT | AAGCCAGACGTGTGATTTCC | NM_001123041.2 |
IP10 (CXCL10) | GCAAGCCAATTTTGTCCACGT | GTGGTCCATCCTTGGAAGCA | NC_000004.12 |
NRF2 | GCGACGGAAAGAGTATGAGC | GTTGGCAGATCCACTGGTTT | NM_006164.5 |
COX2 | GGTGACATCGATGCTGTGGA | AGTGCTTGGCTTCCAGTAGG | NM_000963.4 |
IL10 | TGCAAAACCAAACCACAAGA | TCTCGGAGATCTCGAAGCAT | NM_000572.2 |
RANTES | AGGATCAAGACAGCACGTGG | TACTCCTTGATGTGGGCACG | NM_002985.3 |
GAPDH | ACAGTCAGCCGCATCTTCTT | ACGACCAAATCCGTTGACTC | NM_001289745.2 |
HPRT | TGGCGTCGTGATTAGTGATGA | AGAGGGCTACAATGTGATGGC | NM_000194.3 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Alcalá-Santiago, Á.; Toscano-Sánchez, R.; Márquez-López, J.C.; González-Jurado, J.A.; Fernández-Pachón, M.-S.; García-Villanova, B.; Pedroche, J.; Rodríguez-Martín, N.M. The Synergic Immunomodulatory Effect of Vitamin D and Chickpea Protein Hydrolysate in THP-1 Cells: An In Vitro Approach. Int. J. Mol. Sci. 2024, 25, 12628. https://doi.org/10.3390/ijms252312628
Alcalá-Santiago Á, Toscano-Sánchez R, Márquez-López JC, González-Jurado JA, Fernández-Pachón M-S, García-Villanova B, Pedroche J, Rodríguez-Martín NM. The Synergic Immunomodulatory Effect of Vitamin D and Chickpea Protein Hydrolysate in THP-1 Cells: An In Vitro Approach. International Journal of Molecular Sciences. 2024; 25(23):12628. https://doi.org/10.3390/ijms252312628
Chicago/Turabian StyleAlcalá-Santiago, Ángela, Rocío Toscano-Sánchez, José Carlos Márquez-López, José Antonio González-Jurado, María-Soledad Fernández-Pachón, Belén García-Villanova, Justo Pedroche, and Noelia María Rodríguez-Martín. 2024. "The Synergic Immunomodulatory Effect of Vitamin D and Chickpea Protein Hydrolysate in THP-1 Cells: An In Vitro Approach" International Journal of Molecular Sciences 25, no. 23: 12628. https://doi.org/10.3390/ijms252312628
APA StyleAlcalá-Santiago, Á., Toscano-Sánchez, R., Márquez-López, J. C., González-Jurado, J. A., Fernández-Pachón, M.-S., García-Villanova, B., Pedroche, J., & Rodríguez-Martín, N. M. (2024). The Synergic Immunomodulatory Effect of Vitamin D and Chickpea Protein Hydrolysate in THP-1 Cells: An In Vitro Approach. International Journal of Molecular Sciences, 25(23), 12628. https://doi.org/10.3390/ijms252312628