Molecular Insights into the Reproductive Patterns and Genetic Structure of Wheat Stripe Rust in Ili, Xinjiang
Abstract
1. Introduction
2. Results
2.1. SSR Cumulative Genotypes
2.2. Genetic Structure Analysis
2.3. Genetic Diversity Analysis
2.4. Genetic Recombination Analysis
2.5. Gene Flow Between Pst Populations
2.6. Clustering Analysis of Pst Isolates in Ili
3. Discussion
4. Materials and Methods
4.1. Sample Collection
4.2. Sample Isolation and Propagation
4.3. DNA Extraction and Genotyping of Pst
4.4. Data Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Beddow, J.M.; Pardey, P.G.; Chai, Y.; Hurley, T.M.; Kriticos, D.J.; Braun, H.J.; Park, R.F.; Cuddy, W.S.; Yonow, T. Research investment implications of shifts in the global geography of wheat stripe rust. Nat. Plants 2015, 1, 15132. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.M. Pathogens which threaten food security: Puccinia striiformis, the wheat stripe rust pathogen. Food Secur. 2020, 12, 239–251. [Google Scholar] [CrossRef]
- Liu, W.C.; Wang, B.T.; Zhao, Z.H.; Li, Y.; Kang, Z.S. Historical review and countermeasures of wheat stripe rust epidemics in China. China Plant Prot. 2022, 42, 21–27+41. [Google Scholar]
- Liu, W.C.; Zhao, Z.H.; Wang, B.T.; Li, Y.; Wang, X.J.; Kang, Z.S. Analysis on the contribution rate of plant protection to the control of wheat stripe rust in China. China Plant Prot. 2022, 42, 5–9+53. [Google Scholar]
- Wan, A.M.; Chen, X.M.; He, Z.H. Wheat stripe rust in China. Aust. J. Agric. Res. 2007, 58, 605–619. [Google Scholar] [CrossRef]
- Chen, W.Q.; Kang, Z.S.; Ma, Z.H.; Xu, S.C.; Jin, S.L.; Jiang, Y.L. Integrated Management of Wheat Stripe Rust Caused by Puccinia striiformis f. sp. tritici in China. Sci. Agric. Sin. 2013, 46, 4254–4262. [Google Scholar]
- Kang, Z.S.; Wang, X.J.; Zhao, J.; Tang, C.L.; Huang, L.L. Advances in Research of Pathogenicity and Virulence Variation of the Wheat Stripe Rust Fungus Puccinia striiformis f. sp. tritici. Sci. Agric. Sin. 2015, 48, 3439–3453. [Google Scholar]
- Wang, J.R.; Zhan, G.M.; Tian, Y.; Zhang, Y.; Xu, Y.W.; Kang, Z.S.; Zhao, J. Role of Sexual Reproduction in the Evolution of the Wheat Stripe Rust Fungus Races in China. Phytopathology 2022, 112, 1063–1071. [Google Scholar] [CrossRef]
- Jin, Y.; Szabo, L.J.; Carson, M. Century-old mystery of Puccinia striiformis life history solved with the identification of Berberis as an alternate host. Phytopathology 2010, 100, 432–435. [Google Scholar] [CrossRef]
- Zhao, J.; Wang, L.; Wang, Z.Y.; Chen, X.M.; Zhang, H.C.; Yao, J.N.; Zhan, G.M.; Chen, W.; Huang, L.L.; Kang, Z.S. Identification of eighteen Berberis species as alternate hosts of Puccinia striiformis f. sp. tritici and virulence variation in the pathogen isolates from natural infection of barberry plants in China. Phytopathology 2013, 103, 927–934. [Google Scholar]
- Heitman, J.; Sun, S.; James, T.Y. Evolution of fungal sexual reproduction. Mycologia 2013, 105, 1–27. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Y.; Huang, X.; Li, Q.; Huang, L.L.; Kang, Z.S.; Zhao, J. Virulence Phenotyping and Molecular Genotyping Reveal High Diversity Within and Strong Gene Flow Between the Puccinia striiformis f. sp. tritici Populations Collected from Barberry and Wheat in Shaanxi Province of China. Plant Dis. 2023, 107, 701–712. [Google Scholar] [PubMed]
- Enjalbert, J.; Duan, X.; Leconte, M.; Hovmøller, M.S.; Vallavieille-Pope, C.D.E. Genetic evidence of local adaptation of wheat yellow rust (Puccinia striiformis f. sp. tritici) within France. Mol. Ecol. 2005, 14, 2065–2073. [Google Scholar] [CrossRef] [PubMed]
- Cheng, P.; Chen, X.M. Virulence and molecular analyses support asexual reproduction of Puccinia striiformis f. sp. tritici in the U.S. pacific northwest. Phytopathology 2014, 104, 1208–1220. [Google Scholar] [PubMed]
- Ali, S.; Gladieux, P.; Leconte, M.; Gautier, A.; Justesen, A.F.; Hovmøller, M.S.; Enjalbert, J.; Vallavieille-Pope, C.D. Origin, migration routes and worldwide population genetic structure of the wheat yellow rust pathogen Puccinia striiformis f. sp. tritici. PLoS Pathog. 2014, 10, e1003903. [Google Scholar] [CrossRef]
- Zhou, C.Y.; Lv, X.; Deng, J.; Zhao, B.Q.; Gao, T.Q.; Yao, Q.; Ma, Z.H. Population genetic structure of wheat stripe rust pathogen Puccinia striiformis f. sp. tritici in eastern Qinghai Province. Acta Phytopathol. Sin. 2023, 53, 922–933. [Google Scholar]
- Zhao, J.; Zhao, S.L.; Peng, Y.L.; Qin, J.F.; Huang, L.L.; Kang, Z.S. Investigation on geographic distribution and identification of six Berberis spp. ser-ving as alternate host for Puccinia striiformis f. sp. tritici in Linzhi, Tibet. Acta Phytopathol. Sin. 2016, 46, 103–111. [Google Scholar]
- Ma, J.B.; Awais, M.; Chen, L.; Yang, H.; Lai, H.L.; Shen, Y.Y.; Wang, H.Q.; Li, G.K.; Gao, H.F. Identification of Puccinia striiformis races from the spring wheat crop in Xinjiang, China. Front. Plant Sci. 2023, 14, 1273306. [Google Scholar] [CrossRef]
- Chen L, Awais M, Yang H, Shen, Y. Y.; Li, G.K.; Gao, H.F.; Ma, J.B. Races CYR34 and Suwon11-1 of Puccinia striiformis f. sp. tritici played an important role in causing the stripe rust epidemic in winter wheat in Yili, Xinjiang, China. J. Fungi 2023, 9, 436. [Google Scholar]
- Chen, W.Q.; Liu, T.G. Occurrence of wheat stripe rust in autumn-sown seedings and inter-regional inoculum dispersal of Puccinia striiformis f. sp. tritici in China. Plant Prot. 2023, 49, 50–70. [Google Scholar]
- Jiang, B.B.; Wang, C.C.; Guo, C.W.; Lv, X.; Gong, W.F.; Chang, J.; He, H.P.; Feng, J.; Chen, X.M.; Ma, Z.H. Genetic Relationships of Puccinia striiformis f. sp. tritici in Southwestern and Northwestern China. Microbiol. Spectr. 2022, 10, e0153022. [Google Scholar]
- Wang, C.H.; Li, Y.X.; Wang, B.T.; Hu, X.P. Genetic analysis reveals relationships among populations of Puccinia striiformis f. sp. tritici from the Longnan, Longdong and central Shaanxi regions of China. Phytopathology 2022, 112, 278–289. [Google Scholar] [PubMed]
- Wan, Q.; Liang, J.M.; Luo, Y.; Ma, Z.H. Population genetic structure of Puccinia striiformis in northwestern China. Plant Dis. 2015, 99, 1764–1774. [Google Scholar] [CrossRef] [PubMed]
- Chen, C.Q.; Zheng, W.M.; Buchenauer, H.; Huang, L.L.; Lu, N.H.; Kang, Z.S. Isolation of microsatellite loci from expressed sequence tag library of Puccinia striiformis f. sp. tritici. Mol. Ecol. Resour. 2009, 9, 236–238. [Google Scholar] [CrossRef] [PubMed]
- Enjalbert, J.; Duan, X.; Giraud, T.; Vautrin, D.; De Vallavieille-Pope, C.; Solignac, M. Isolation of twelve microsatellite loci, using an enrichment protocol, in the phytopathogenic fungus Puccinia striiformis f. sp. tritici. Mol. Ecol. Notes 2002, 2, 563–565. [Google Scholar] [CrossRef]
- Bahri, B.; Leconte, M.; De Vallavieille-Pope, C.; Enjalbert, J. Isolation of ten microsatellite loci in an EST library of the phytopathogenic fungus Puccinia striiformis f. sp. tritici. Conserv. Genet. 2009, 10, 1425–1428. [Google Scholar] [CrossRef]
- Zhan, G.M.; Wang, F.P.; Luo, H.Y.; Jiang, S.C.; Zheng, W.M.; Huang, L.L.; Kang, Z.S. Screening for simple sequence repeat markers in Puccinia striiformis tritici based on genomic sequence. J. Zhejiang Univ. Sci. B 2015, 16, 727–773. [Google Scholar] [CrossRef]
- Pritchard, J.K.; Stephens, M.; Donnelly, P. Inference of population structure using multilocus genotype data. Genetics. 2000, 155, 945–959. [Google Scholar] [CrossRef]
- Peakall, R.; Smouse, P.E. GENALEX 6: Genetic analysis in Excel. population genetic software for teaching and research--an update. Bioinformatics 2012, 28, 2537–2539. [Google Scholar] [CrossRef]
- Nei, M. Genetic distance between populations. Am. Nat. 1972, 106, 283–292. [Google Scholar] [CrossRef]
- Liu, K.; Muse, S.V. PowerMarker: An integrated analysis environment for genetic marker analysis. Bioinformatics 2005, 21, 2128–2129. [Google Scholar] [CrossRef] [PubMed]
- Kamvar, Z.N.; Tabima, J.F.; Grünwald, N.J. Poppr: An R package for genetic analysis of populations with clonal, partially clonal, and/or sexual reproduction. PeerJ 2014, 2, e281. [Google Scholar] [CrossRef] [PubMed]
- Jombart, T.; Devillard, S.; Balloux, F. Discriminant analysis of principal components: A new method for the analysis of genetically structured populations. BMC Genet. 2010, 11, 94. [Google Scholar] [CrossRef] [PubMed]
Type of Host | Population | N | MLG | eMLG | H | rbarD | I |
---|---|---|---|---|---|---|---|
Spring wheat | Gongliu | 30 | 21 | 8.56 | 2.87 | 0.13 | 0.729 |
Spring wheat | Nilka | 11 | 11 | 10.00 | 2.40 | 0.09 | 0.729 |
Winter wheat | Qapqal | 7 | 7 | 7.00 | 1.95 | −0.01 | 0.719 |
Spring wheat | Xinyuan C | 8 | 7 | 7.00 | 1.91 | 0.24 | 0.668 |
Winter wheat | Xinyuan D | 10 | 9 | 9.00 | 2.16 | 0.00 | 0.694 |
Spring wheat | Zhaosu | 9 | 9 | 9.00 | 2.20 | 0.20 | 0.795 |
Spring wheat | Tekes | 4 | 4 | 4.00 | 1.39 | −0.19 | 0.569 |
Total | 79 | 62 | 9.47 | 3.96 | 0.17 | 0.700 |
Gongliu | Nilka | Qapqal | Xinyuan C | Xinyuan D | Zhaosu | Tekes | |
---|---|---|---|---|---|---|---|
Gongliu | 0.000 | ||||||
Nilka | 7.774 | 0.000 | |||||
Qapqal | - | 6.501 | 0.000 | ||||
Xinyuan C | 2.052 | 1.561 | 2.245 | 0.000 | |||
Xinyuan D | 27.076 | 3.158 | - | 1.612 | 0.000 | ||
Zhaosu | 9.548 | 5.526 | 35.080 | 1097.502 | 6.810 | 0.000 | |
Tekes | - | 2.644 | 48.987 | 1.848 | - | 7.163 | 0.000 |
Locus | Repeat Motif | Primer Sequence (5′-3′) | Size | No. of Alleles | Reference |
---|---|---|---|---|---|
CPS08 | (CAG)14 | FAM-GATAAGAAACAAGGGACAGC | 205–208 | 2 | [24] |
CAGTGAACCCAATTACTCAG | |||||
CPS13 | (GAC)6 | FAM-TCCAGGCAGTAAATCAGACGC | 125–128 | 2 | [24] |
ATCAGCAGGTGTAGCCCCATC | |||||
CPS27 | (TTC)4 | TAMRA-GATGGGGAAAAGTAAGAAGT | 222–225 | 2 | [24] |
GGTGGGGGATGTAAGTATGTA | |||||
CPS34 | (TC)9 | HEX-GTTGGCTACGAGTGGTCATC | 105–113 | 6 | [24] |
TAACACTACACAAAAGGGGTC | |||||
CPS36 | (CTCTAG)3 | TAMRA-TCCAGGCAGTAAATCAGACGC | 125–128 | 2 | [24] |
ATCAGCAGGTGTAGCCCCATC | |||||
RJ3 | (TGG)8 | ROX-GCAGCACTGGCAGGTGG | 204–207 | 4 | [25] |
GATGAATCAGGATGGCTCC | |||||
RJ27 | (TC)10 | TAMRA-CGTCCCGACTAATCTGGTCC | 230–242 | 2 | [25] |
ATGAGTTAGTTTAGATCAGGTCGAC | |||||
RJ3N | (CT)9 | HEX-TGGTGGTGCTCCTCTAGTC | 338–346 | 5 | [26] |
AGGGGTCTTGTAAGATGCTC | |||||
RJ5N | (CT)8 | HEX-AACGGTCAACAGCACTCAC | 225–227 | 2 | [26] |
AGTTGGTCGCGTTTTGCTC | |||||
RJ8N | (GAT)8 | FAM-ACTGGGCAGACTGGTCAAC | 304–308 | 3 | [26] |
TCGTTTCCCTCCAGATGGC | |||||
RJ13N | (ACG)6 | ROX-TTAGCTCAGCCGGTTCCTC | 149–152 | 2 | [26] |
CAGGTGTAGCCCCATCTCC | |||||
WSR44 | (GT)6 | HEX-AGGCCCCAGGAACACAAAAA | 189–192 | 4 | [27] |
TCACACACGCTCCACAGTAC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lai, H.; Li, Y.; Deng, F.; Yang, H.; Li, J.; Chen, J.; Sun, J.; Li, G.; Fernando, W.G.D.; Gao, H. Molecular Insights into the Reproductive Patterns and Genetic Structure of Wheat Stripe Rust in Ili, Xinjiang. Int. J. Mol. Sci. 2024, 25, 12357. https://doi.org/10.3390/ijms252212357
Lai H, Li Y, Deng F, Yang H, Li J, Chen J, Sun J, Li G, Fernando WGD, Gao H. Molecular Insights into the Reproductive Patterns and Genetic Structure of Wheat Stripe Rust in Ili, Xinjiang. International Journal of Molecular Sciences. 2024; 25(22):12357. https://doi.org/10.3390/ijms252212357
Chicago/Turabian StyleLai, Hanlin, Yue Li, Feifei Deng, Hong Yang, Jin Li, Jianghua Chen, Jingjing Sun, Guangkuo Li, W. G. Dilantha Fernando, and Haifeng Gao. 2024. "Molecular Insights into the Reproductive Patterns and Genetic Structure of Wheat Stripe Rust in Ili, Xinjiang" International Journal of Molecular Sciences 25, no. 22: 12357. https://doi.org/10.3390/ijms252212357
APA StyleLai, H., Li, Y., Deng, F., Yang, H., Li, J., Chen, J., Sun, J., Li, G., Fernando, W. G. D., & Gao, H. (2024). Molecular Insights into the Reproductive Patterns and Genetic Structure of Wheat Stripe Rust in Ili, Xinjiang. International Journal of Molecular Sciences, 25(22), 12357. https://doi.org/10.3390/ijms252212357