Inhibition of IRAP Enhances the Expression of Pro-Cognitive Markers Drebrin and MAP2 in Rat Primary Neuronal Cells
Abstract
1. Introduction
2. Results
2.1. The IRAP Receptor Is Expressed in Hippocampal and Cortical Cell Cultures
2.2. IRAP Inhibitor C9 Increases Drebrin Intensity
2.3. Treatment with C9 Alters the Ratio of Neurons and Astrocytes
2.4. GLUT4 Expression Is Increased in Cortical Astrocytes
2.5. Synaptic Markers vGluT1 and Synapsin I Are Not Significantly Altered by C9 Treatment
2.6. IRAP Inhibitor C9 Decreases the mRNA Levels in Hippocampal Cells
2.7. Treatment with C9 Does Not Impact Viability of Primary Cell Cultures
3. Discussion
4. Materials and Methods
4.1. Animals
4.2. Rat Primary Cell Cultures
4.3. IRAP Inhibitor Compound C9
4.4. Immunocytochemistry
4.5. Image Analysis
4.6. mRNA Expression
4.7. Mitochondrial Metabolism
4.8. Membrane Integrity
4.9. Calcein Metabolism
4.10. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
Ang IV | Angiotensin IV |
ANOVA | Analysis of variance |
DAPI | 4′,6-diamidino-2-phenylindole |
DMSO | Dimethyl sulfoxide |
GFAP | Glial fibrillary acidic protein |
GLUT | Glucose transporter |
ICC | Immunocytochemistry |
IRAP | Insulin-regulated aminopeptidase |
LDH | Lactate dehydrogenase |
MAP2 | Microtubule-associated protein 2 |
MTT | Tetrazolium bromide salt |
ROI | Region of interest |
SD | Standard deviation |
vGluT1 | Vesicular glutamate transporter 1 |
References
- Chai, S.Y.; Bastias, M.A.; Clune, E.F.; Matsacos, D.J.; Mustafa, T.; Lee, J.H.; McDowall, S.G.; Mendelsohn, F.A.; Albiston, A.L.; Paxinos, G. Distribution of angiotensin IV binding sites (AT4 receptor) in the human forebrain, midbrain and pons as visualised by in vitro receptor autoradiography. J. Chem. Neuroanat. 2000, 20, 339–348. [Google Scholar] [CrossRef] [PubMed]
- Fernando, R.N.; Larm, J.; Albiston, A.L.; Chai, S.Y. Distribution and cellular localization of insulin-regulated aminopeptidase in the rat central nervous system. J. Comp. Neurol. 2005, 487, 372–390. [Google Scholar] [CrossRef] [PubMed]
- Matsumoto, H.; Nagasaka, T.; Hattori, A.; Rogi, T.; Tsuruoka, N.; Mizutani, S.; Tsujimoto, M. Expression of placental leucine aminopeptidase/oxytocinase in neuronal cells and its action on neuronal peptides. Eur. J. Biochem. 2001, 268, 3259–3266. [Google Scholar] [CrossRef] [PubMed]
- Tsujimoto, M.; Hattori, A. The oxytocinase subfamily of M1 aminopeptidases. Biochim. Biophys. Acta BBA—Proteins Proteom. 2005, 1751, 9–18. [Google Scholar] [CrossRef]
- Keller, S.R.; Scott, H.M.; Mastick, C.C.; Aebersold, R.; Lienhard, G.E. Cloning and Characterization of a Novel Insulin-regulated Membrane Aminopeptidase from Glut4 Vesicles. J. Biol. Chem. 1995, 270, 23612–23618. [Google Scholar] [CrossRef]
- Albiston, A.L.; Mustafa, T.; McDowall, S.G.; Mendelsohn, F.A.O.; Lee, J.; Chai, S.Y. AT4 receptor is insulin-regulated membrane aminopeptidase: Potential mechanisms of memory enhancement. Trends Endocrinol. Metab. 2003, 14, 72–77. [Google Scholar] [CrossRef] [PubMed]
- Chai, S.Y.; Fernando, R.; Peck, G.; Ye, S.-Y.; Mendelsohn, F.A.O.; Jenkins, T.A.; Albiston, A.L. The angiotensin IV/AT4 receptor. Cell. Mol. Life Sci. 2004, 61, 2728–2737. [Google Scholar] [CrossRef]
- Rogi, T.; Tsujimoto, M.; Nakazato, H.; Mizutani, S.; Tomoda, Y. Human Placental Leucine Aminopeptidase/Oxytocinase: A New Member of Type II Membrane-Spanning Zinc Metallopeptidase Family. J. Biol. Chem. 1996, 271, 56–61. [Google Scholar] [CrossRef]
- Herbst, J.J.; Ross, S.A.; Scott, H.M.; Bobin, S.A.; Morris, N.J.; Lienhard, G.E.; Keller, S.R. Insulin stimulates cell surface aminopeptidase activity toward vasopressin in adipocytes. Am. J. Physiol. 1997, 272 (Pt 1), E600–E606. [Google Scholar] [CrossRef]
- Saveanu, L.; Carroll, O.; Weimershaus, M.; Guermonprez, P.; Firat, E.; Lindo, V.; Greer, F.; Davoust, J.; Kratzer, R.; Keller, S.R.; et al. IRAP identifies an endosomal compartment required for MHC class I cross-presentation. Science 2009, 325, 213–217. [Google Scholar] [CrossRef]
- Evnouchidou, I.; Chappert, P.; Benadda, S.; Zucchetti, A.; Weimershaus, M.; Bens, M.; Caillens, V.; Koumantou, D.; Lotersztajn, S.; van Endert, P.; et al. IRAP-dependent endosomal T cell receptor signalling is essential for T cell responses. Nat. Commun. 2020, 11, 2779. [Google Scholar] [CrossRef] [PubMed]
- Bryant, N.J.; Govers, R.; James, D.E. Regulated transport of the glucose transporter GLUT4. Nat. Rev. Mol. Cell Biol. 2002, 3, 267–277. [Google Scholar] [CrossRef]
- Keller, S.R. The insulin-regulated aminopeptidase: A companion and regulator of GLUT4. Front. Biosci. 2003, 8, s410–s420. [Google Scholar] [CrossRef]
- Seyer, B.; Diwakarla, S.; Burns, P.; Hallberg, A.; Grönbladh, A.; Hallberg, M.; Chai, S.Y. Insulin-regulated aminopeptidase inhibitor-mediated increases in dendritic spine density are facilitated by glucose uptake. J. Neurochem. 2020, 153, 485–494. [Google Scholar] [CrossRef] [PubMed]
- Waters, S.B.; D’Auria, M.; Martin, S.S.; Nguyen, C.; Kozma, L.M.; Luskey, K.L. The amino terminus of insulin-responsive aminopeptidase causes Glut4 translocation in 3T3-L1 adipocytes. J. Biol. Chem. 1997, 272, 23323–23327. [Google Scholar] [CrossRef] [PubMed]
- Andersson, H.; Hallberg, M. Discovery of Inhibitors of Insulin-Regulated Aminopeptidase as Cognitive Enhancers. Int. J. Hypertens. 2012, 2012, 789671. [Google Scholar] [CrossRef]
- Georgiadis, D.; Ziotopoulou, A.; Kaloumenou, E.; Lelis, A.; Papasava, A. The Discovery of Insulin-Regulated Aminopeptidase (IRAP) Inhibitors: A Literature Review. Front. Pharmacol. 2020, 11, 585838. [Google Scholar] [CrossRef]
- Albiston, A.L.; McDowall, S.G.; Matsacos, D.; Sim, P.; Clune, E.; Mustafa, T.; Lee, J.; Mendelsohn, F.A.O.; Simpson, R.J.; Connolly, L.M.; et al. Evidence That the Angiotensin IV (AT4) Receptor Is the Enzyme Insulin-regulated Aminopeptidase. J. Biol. Chem. 2001, 276, 48623–48626. [Google Scholar] [CrossRef]
- Braszko, J.J.; Kupryszewski, G.; Witczuk, B.; Wiśniewski, K. Angiotensin II-(3-8)-hexapeptide affects motor activity, performance of passive avoidance and a conditioned avoidance response in rats. Neuroscience 1988, 27, 777–783. [Google Scholar] [CrossRef]
- Pederson, E.S.; Harding, J.W.; Wright, J.W. Attenuation of scopolamine-induced spatial learning impairments by an angiotensin IV analog. Regul. Pept. 1998, 74, 97–103. [Google Scholar] [CrossRef]
- Wright, J.W.; Stubley, L.; Pederson, E.S.; Kramár, E.A.; Hanesworth, J.M.; Harding, J.W. Contributions of the brain angiotensin IV-AT4 receptor subtype system to spatial learning. J. Neurosci. Off. J. Soc. Neurosci. 1999, 19, 3952–3961. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.; Albiston, A.; Allen, A.; Mendelsohn, F.; Ping, S.; Barrett, G.; Murphy, M.; Morris, M.; McDowall, S.; Chai, S. Effect of I.C.V. injection of AT4 receptor ligands, NLE1-angiotensin IV and LVV-hemorphin 7, on spatial learning in rats. Neuroscience 2004, 124, 341–349. [Google Scholar] [CrossRef] [PubMed]
- Albiston, A.L.; Pederson, E.S.; Burns, P.; Purcell, B.; Wright, J.W.; Harding, J.W.; Mendelsohn, F.A.; Weisinger, R.S.; Chai, S.Y. Attenuation of scopolamine-induced learning deficits by LVV-hemorphin-7 in rats in the passive avoidance and water maze paradigms. Behav. Brain Res. 2004, 154, 239–243. [Google Scholar] [CrossRef]
- Royea, J.; Martinot, P.; Hamel, E. Memory and cerebrovascular deficits recovered following angiotensin IV intervention in a mouse model of Alzheimer’s disease. Neurobiol. Dis. 2020, 134, 104644. [Google Scholar] [CrossRef]
- Kilic, A.; Ustunova, S.; Elibol, B.; Bulut, H.; Meral, I.; Sahin, G. Angiotensin IV improves spatial memory in streptozotocin-induced diabetic rats by reducing oxidative stress and altering BDNF levels. Acta Neurobiol. Exp. 2021, 81, 161–170. [Google Scholar] [CrossRef]
- De Bundel, D.; Smolders, I.; Yang, R.; Albiston, A.L.; Michotte, Y.; Chai, S.Y. Angiotensin IV and LVV-haemorphin 7 enhance spatial working memory in rats: Effects on hippocampal glucose levels and blood flow. Neurobiol. Learn. Mem. 2009, 92, 19–26. [Google Scholar] [CrossRef]
- Gard, P.R. Cognitive-enhancing effects of angiotensin IV. BMC Neurosci. 2008, 9 (Suppl. S2), S15. [Google Scholar] [CrossRef]
- Lew, R.A.; Mustafa, T.; Ye, S.; McDowall, S.G.; Chai, S.Y.; Albiston, A.L. Angiotensin AT4 ligands are potent, competitive inhibitors of insulin regulated aminopeptidase (IRAP). J. Neurochem. 2003, 86, 344–350. [Google Scholar] [CrossRef] [PubMed]
- Albiston, A.L.; Morton, C.J.; Ng, H.L.; Pham, V.; Yeatman, H.R.; Ye, S.; Fernando, R.N.; De Bundel, D.; Ascher, D.B.; Mendelsohn, F.A.O.; et al. Identification and characterization of a new cognitive enhancer based on inhibition of insulin-regulated aminopeptidase. FASEB J. 2008, 22, 4209–4217. [Google Scholar] [CrossRef]
- Axén, A.; Lindeberg, G.; Demaegdt, H.; Vauquelin, G.; Karlén, A.; Hallberg, M. Cyclic insulin-regulated aminopeptidase (IRAP)/AT4 receptor ligands. J. Pept. Sci. 2006, 12, 705–713. [Google Scholar] [CrossRef]
- Hallberg, M. Targeting the insulin-regulated aminopeptidase/AT4 receptor for cognitive disorders. Drug News Perspect. 2009, 22, 133–139. [Google Scholar] [CrossRef] [PubMed]
- Barlow, N.; Vanga, S.R.; Sävmarker, J.; Sandström, A.; Burns, P.; Hallberg, A.; Åqvist, J.; Gutiérrez-De-Terán, H.; Hallberg, M.; Larhed, M.; et al. Macrocyclic peptidomimetics as inhibitors of insulin-regulated aminopeptidase (IRAP). RSC Med. Chem. 2020, 11, 234–244. [Google Scholar] [CrossRef] [PubMed]
- Andersson, H.; Demaegdt, H.; Vauquelin, G.; Lindeberg, G.; Karlén, A.; Hallberg, M.; Erdélyi, M.; Hallberg, A. Disulfide Cyclized Tripeptide Analogues of Angiotensin IV as Potent and Selective Inhibitors of Insulin-Regulated Aminopeptidase (IRAP). J. Med. Chem. 2010, 53, 8059–8071. [Google Scholar] [CrossRef]
- Mpakali, A.; Saridakis, E.; Giastas, P.; Maben, Z.; Stern, L.J.; Larhed, M.; Hallberg, M.; Stratikos, E. Structural Basis of Inhibition of Insulin-Regulated Aminopeptidase by a Macrocyclic Peptidic Inhibitor. ACS Med. Chem. Lett. 2020, 11, 1429–1434. [Google Scholar] [CrossRef]
- Diwakarla, S.; Nylander, E.; Grönbladh, A.; Vanga, S.R.; Khan, Y.S.; Gutiérrez-De-Terán, H.; Ng, L.; Pham, V.; Sävmarker, J.; Lundbäck, T.; et al. Binding to and Inhibition of Insulin-Regulated Aminopeptidase by Macrocyclic Disulfides Enhances Spine Density. Mol. Pharmacol. 2016, 89, 413–424. [Google Scholar] [CrossRef]
- Stam, F.; Lind, S.F.; Schroff, A.; Zelleroth, S.; Nylander, E.; Gising, J.; Grönbladh, A.; Larhed, M.; Hallberg, M. Hydrogen Peroxide Induced Toxicity Is Reversed by the Macrocyclic IRAP-Inhibitor HA08 in Primary Hippocampal Cell Cultures. Curr. Issues Mol. Biol. 2022, 44, 5000–5012. [Google Scholar] [CrossRef]
- Cajal, S.R. Estructura de los centros nerviosos de las aves. Rev. Trim. Histol. Norm. Patol. 1888, 1, 1–10. [Google Scholar]
- Fiala, J.C.; Spacek, J.; Harris, K.M. Dendritic spine pathology: Cause or consequence of neurological disorders? Brain Res. Rev. 2002, 39, 29–54. [Google Scholar] [CrossRef]
- Hering, H.; Sheng, M. Dentritic spines: Structure, dynamics and regulation. Nat. Rev. Neurosci. 2001, 2, 880–888. [Google Scholar] [CrossRef]
- Kasai, H.; Matsuzaki, M.; Noguchi, J.; Yasumatsu, N.; Nakahara, H. Structure-stability-function relationships of dendritic spines. Trends Neurosci. 2003, 26, 360–368. [Google Scholar] [CrossRef]
- Kennedy, M.B.; Beale, H.C.; Carlisle, H.J.; Washburn, L.R. Integration of biochemical signalling in spines. Nat. Rev. Neurosci. 2005, 6, 423–434. [Google Scholar] [CrossRef] [PubMed]
- Leuner, B.; Falduto, J.; Shors, T.J. Associative memory formation increases the observation of dendritic spines in the hippocampus. J. Neurosci. 2003, 23, 659–665. [Google Scholar] [CrossRef] [PubMed]
- Van Spronsen, M.; Hoogenraad, C.C. Synapse pathology in psychiatric and neurologic disease. Curr. Neurol. Neurosci. Rep. 2010, 10, 207–214. [Google Scholar] [CrossRef]
- Yuste, R. The discovery of dendritic spines by Cajal. Front. Neuroanat. 2015, 9, 18. [Google Scholar] [CrossRef] [PubMed]
- Kasai, H.; Fukuda, M.; Watanabe, S.; Hayashi-Takagi, A.; Noguchi, J. Structural dynamics of dendritic spines in memory and cognition. Trends Neurosci. 2010, 33, 121–129. [Google Scholar] [CrossRef]
- DeGiosio, R.A.; Grubisha, M.J.; MacDonald, M.L.; McKinney, B.C.; Camacho, C.J.; Sweet, R.A. More than a marker: Potential pathogenic functions of MAP2. Front. Mol. Neurosci. 2022, 15, 974890. [Google Scholar] [CrossRef]
- Kim, Y.; Jang, Y.; Kim, J.; Kim, N.; Noh, S.; Kim, H.; Queenan, B.N.; Bellmore, R.; Mun, J.Y.; Park, H.; et al. Microtubule-associated protein 2 mediates induction of long-term potentiation in hippocampal neurons. FASEB J. 2020, 34, 6965–6983. [Google Scholar] [CrossRef]
- Abdelhak, A.; Foschi, M.; Abu-Rumeileh, S.; Yue, J.K.; D’anna, L.; Huss, A.; Oeckl, P.; Ludolph, A.C.; Kuhle, J.; Petzold, A.; et al. Blood GFAP as an emerging biomarker in brain and spinal cord disorders. Nat. Rev. Neurol. 2022, 18, 158–172. [Google Scholar] [CrossRef]
- Liu, T.; Zuo, H.; Ma, D.; Song, D.; Zhao, Y.; Cheng, O. Cerebrospinal fluid GFAP is a predictive biomarker for conversion to dementia and Alzheimer’s disease-associated biomarkers alterations among de novo Parkinson’s disease patients: A prospective cohort study. J. Neuroinflamm. 2023, 20, 167. [Google Scholar] [CrossRef]
- Buddle, M.; Eberhardt, E.; Ciminello, L.H.; Levin, T.; Wing, R.; DiPasquale, K.; Raley-Susman, K.M. Microtubule-associated protein 2 (MAP2) associates with the NMDA receptor and is spatially redistributed within rat hippocampal neurons after oxygen-glucose deprivation. Brain Res. 2003, 978, 38–50. [Google Scholar] [CrossRef]
- Anhê, G.F.; Torrão, A.S.; Nogueira, T.C.; Caperuto, L.C.; Amaral, M.E.; Medina, M.C.; Azevedo-Martins, A.K.; Carpinelli, A.R.; Carvalho, C.R.; Curi, R.; et al. ERK3 associates with MAP2 and is involved in glucose-induced insulin secretion. Mol. Cell. Endocrinol. 2006, 251, 33–41. [Google Scholar] [CrossRef] [PubMed]
- Easom, R.A. CaM kinase II: A protein kinase with extraordinary talents germane to insulin exocytosis. Diabetes 1999, 48, 675–684. [Google Scholar] [CrossRef] [PubMed]
- Diwakarla, S.; Nylander, E.; Grönbladh, A.; Vanga, S.R.; Shamsudin, Y.; Gutiérrez-De-Terán, H.; Sävmarker, J.; Ng, L.; Pham, V.; Lundbäck, T.; et al. Aryl Sulfonamide Inhibitors of Insulin-Regulated Aminopeptidase Enhance Spine Density in Primary Hippocampal Neuron Cultures. ACS Chem. Neurosci. 2016, 7, 1383–1392. [Google Scholar] [CrossRef] [PubMed]
- Koepsell, H. Glucose transporters in brain in health and disease. Pflüg Arch.—Eur. J. Physiol. 2020, 472, 1299–1343. [Google Scholar] [CrossRef] [PubMed]
- Keller, S.R.; Davis, A.C.; Clairmont, K.B. Mice Deficient in the Insulin-regulated Membrane Aminopeptidase Show Substantial Decreases in Glucose Transporter GLUT4 Levels but Maintain Normal Glucose Homeostasis. J. Biol. Chem. 2002, 277, 17677–17686. [Google Scholar] [CrossRef]
- Fernando, R.N.; Albiston, A.L.; Chai, S.Y. The insulin-regulated aminopeptidase IRAP is colocalised with GLUT4 in the mouse hippocampus—Potential role in modulation of glucose uptake in neurones? Eur. J. Neurosci. 2008, 28, 588–598. [Google Scholar] [CrossRef]
Standardised mRNA Levels of Dbn1, Gfap, Glut1, Glut3, Glut4, Lnpep and Map2 1 | |||||||
---|---|---|---|---|---|---|---|
Gene: | Dbn1 | Gfap | Glut1 | Glut3 | Glut4 | Lnpep | Map2 |
C9 0.01 µM | 61.1 * ±31.9 | 70.2 ** ±12.2 | 55.7 **** ±11.3 | 67.2 ±15.5 | 58.1 * ±14.4 | 86.3 ±27.9 | 71.0 ±13.0 |
C9 0.1 µM | 70.5 ±24.6 | 74.3 * ±17.7 | 76.8 *** ±8.7 | 72.1 ±30.4 | 56.3 * ±22.3 | 104.7 ±30.2 | 92.5 ±32.6 |
C9 1 µM | 46.2 ** ±13.8 | 60.8 *** ±8.7 | 62.4 **** ±5.4 | 57.6 * ±19.6 | 60.0 * ±30.8 | 69.3 ±13.4 | 63.4 * ±11.3 |
C9 0.01 µM | 87.8 ±11.6 | 85.4 ±33.6 | 101.5 ±37.6 | 75.9 ±17.9 | 77.6 ±30.5 | 95.5 ±29.4 | 99.7 ±40.2 |
C9 0.1 µM | 103.3 ±32.9 | 102.2 ±21.9 | 99.1 ±23.7 | 84.6 ±5.4 | 88.0 ±20.8 | 84.1 ±12.5 | 82.7 ±12.7 |
C9 1 µM | 72.4 ±23.6 | 126.8 2 ±6.0 | 101.5 ±22.4 | 88.2 ±15.3 | 73.8 ±18.9 | 87.7 ±11.7 | 94.4 ±17.5 |
Protein | Gene | Primer Sequence |
---|---|---|
Beta-actin | Actb | FW: CGTCCACCCGCGAGTACAACCT R: ATCCATGGCGAACTGGTGGCG |
Ribosomal protein lateral stalk subunit P0 | Rplp0 | FW: GGGCAATCCCTGACGCACCG R: AGCTGCACATCGCTCAGGATTTCA |
Drebrin | Dbn1 | FW: TCAGACAGCAGGAACGAGTG R: TATGAAAGGGCAGTACGGACG |
Glial fibrillary acidic protein | Gfap | FW: GTGGTATCGGTCCAAGTTTGC R: GACTCAAGGTCGCAGGTCAA |
Glucose transporter type 1 | Glut1 | FW: GAGCTAGGAGGCTTTACCGC R: CCTAAATGGAGCCTGGACCC |
Glucose transporter type 3 | Glut3 | FW: ATGGGGACAGCGAAGGTGAC R: CCCCTCGCTTGGTAGGTCTT |
Glucose transporter type 4 | Glut4 | FW: AGGCCGGGACACTATACCC R: TAGCCAAACTGAAGGGAGCC |
Insulin-regulated aminopeptidase | Lnpep | FW: GAGTGACAAAGACCGAGCCA R: TCTGAAGAGGCACTTTGCCA |
Microtubule-associated protein 2 | Map2 | FW: GACCACCAGGTCAGAACCAAT R: TGGGCACCAAGATGCCAAAT |
Large ribosomal subunit protein eL19 | Rpl19 | FW: GCGTCTGCAGCCATGAGTATGCTT R: ATCGAGCCCGGGAATGGACAGT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Stam, F.; Bjurling, S.; Nylander, E.; Håkansson, E.O.; Barlow, N.; Gising, J.; Larhed, M.; Odell, L.R.; Grönbladh, A.; Hallberg, M. Inhibition of IRAP Enhances the Expression of Pro-Cognitive Markers Drebrin and MAP2 in Rat Primary Neuronal Cells. Int. J. Mol. Sci. 2024, 25, 12016. https://doi.org/10.3390/ijms252212016
Stam F, Bjurling S, Nylander E, Håkansson EO, Barlow N, Gising J, Larhed M, Odell LR, Grönbladh A, Hallberg M. Inhibition of IRAP Enhances the Expression of Pro-Cognitive Markers Drebrin and MAP2 in Rat Primary Neuronal Cells. International Journal of Molecular Sciences. 2024; 25(22):12016. https://doi.org/10.3390/ijms252212016
Chicago/Turabian StyleStam, Frida, Sara Bjurling, Erik Nylander, Esther Olaniran Håkansson, Nicholas Barlow, Johan Gising, Mats Larhed, Luke R. Odell, Alfhild Grönbladh, and Mathias Hallberg. 2024. "Inhibition of IRAP Enhances the Expression of Pro-Cognitive Markers Drebrin and MAP2 in Rat Primary Neuronal Cells" International Journal of Molecular Sciences 25, no. 22: 12016. https://doi.org/10.3390/ijms252212016
APA StyleStam, F., Bjurling, S., Nylander, E., Håkansson, E. O., Barlow, N., Gising, J., Larhed, M., Odell, L. R., Grönbladh, A., & Hallberg, M. (2024). Inhibition of IRAP Enhances the Expression of Pro-Cognitive Markers Drebrin and MAP2 in Rat Primary Neuronal Cells. International Journal of Molecular Sciences, 25(22), 12016. https://doi.org/10.3390/ijms252212016