An Oxford Nanopore Technology-Based Hepatitis B Virus Sequencing Protocol Suitable for Genomic Surveillance Within Clinical Diagnostic Settings
Abstract
1. Introduction
2. Results
2.1. Sequencing of Samples
2.2. Recombination Detection and Breakpoint Identification
2.3. Drug Resistance and Immune-Evasion Profiling
3. Discussion
4. Materials and Methods
4.1. Study Design
4.2. HBV DNA Extraction
4.3. Primer Design
4.4. Tiling-Based Polymerase Chain Reaction
4.5. Raw-Read Assessment and Genotyping
4.6. Recombination Analysis
4.7. Genotyping and the Identification of Drug-Resistance and Immune-Escape Mutations
4.8. Statistical Analyses
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A
| Sequence | RDP | GeneConv | BootScan | MaxChi | Chimaera | Sister Scan | TOPAL |
|---|---|---|---|---|---|---|---|
| K048723 * | 1.08 × 10−15 | 5.51 × 10−10 | 4.61 × 10−2 | 7.31 × 10−9 | 1.15 × 10−7 | 1.58 × 10−4 | 6.45 × 10−13 |
| K048737 * | 1.66 × 10−11 | 3.93 × 10−11 | NS | 6.41 × 10−7 | 2.02 × 10−5 | 1.79 × 10−8 | 8.29 × 10−11 |
| K048753 * | 3.09 × 10−10 | 3.43 × 10−6 | NS | 5.64 × 10−6 | 4.17 × 10−5 | 1.26 × 10−9 | 8.07 × 10−9 |
| K048756 * | 1.59 × 10−11 | 2.21 × 10−8 | 1.95 × 10−2 | 1.00 × 10−10 | 1.00 × 10−10 | 1.45 × 10−13 | 1.50 × 10−21 |
| K056892 | 2.30 × 10−7 | 1.76 × 10−5 | 7.24 × 10−5 | 2.94 × 10−4 | 2.01 × 10−4 | 8.16 × 10−6 | 9.75 × 10−7 |
| K056897 | 1.89 × 10−21 | 1.24 × 10−19 | 1.67 × 10−7 | 2.60 × 10−12 | 6.11 × 10−13 | 1.21 × 10−15 | 3.58 × 10−25 |
| K056900 * | 1.47 × 10−16 | 8.36 × 10−13 | 2.77 × 10−13 | 4.40 × 10−11 | 4.37 × 10−10 | 1.64 × 10−13 | 3.32 × 10−15 |
| K056911 | 2.61 × 10−10 | 3.51 × 10−9 | 5.81 × 10−5 | NS | NS | 3.33 × 10−2 | 1.75 × 10−4 |
| K056916 * | 2.16 × 10−10 | 1.92 × 10−8 | NS | 1.74 × 10−3 | 1.54 × 10−3 | 1.14 × 10−4 | 3.00 × 10−7 |
| K056934 * | 7.56 × 10−16 | 1.39 × 10−5 | 1.06 × 10−4 | 3.93 × 10−3 | NS | NS | 1.74 × 10−4 |
| K056939 | 1.86 × 10−6 | 1.17 × 10−3 | 7.42 × 10−5 | 2.05 × 10−5 | 1.41 × 10−4 | 3.82 × 10−8 | 5.02 × 10−4 |
| K056944 * | 4.52 × 10−18 | 3.36 × 10−15 | NS | 1.04 × 10−10 | 5.47 × 10−11 | 1.38 × 10−4 | 1.77 × 10−23 |
| K056945 * | 3.42 × 10−20 | 1.26 × 10−17 | 1.83 × 10−2 | 1.88 × 10−18 | 1.48 × 10−5 | 2.92 × 10−26 | 2.53 × 10−27 |
| K056950 * | 5.16 × 10−8 | 1.87 × 10−6 | NS | 7.51 × 10−6 | 2.34 × 10−6 | 8.20 × 10−3 | 4.75 × 10−9 |
| K057256 * | 1.47 × 10−17 | 9.40 × 10−17 | 4.14 × 10−4 | 4.17 × 10−11 | 1.31 × 10−11 | 4.29 × 10−12 | 4.52 × 10−26 |
| K057265 | 7.53 × 10−11 | 1.72 × 10−9 | 1.03 × 10−3 | 4.03 × 10−8 | 9.05 × 10−5 | 1.10 × 10−2 | 1.10 × 10−10 |
| K057280 * | 6.92 × 10−21 | 2.63 × 10−22 | 2.12 × 10−19 | 3.78 × 10−6 | 3.29 × 10−6 | 1.28 × 10−7 | 8.01 × 10−21 |
References
- Coste, M.; De Sèze, M.; Diallo, A.; Carrieri, M.P.; Marcellin, F.; Boyer, S. Burden and impacts of chronic hepatitis B infection in rural Senegal: Study protocol of a cross-sectional survey in the area of Niakhar (AmBASS ANRS 12356). BMJ Open. 2019, 9, e030211. [Google Scholar] [CrossRef] [PubMed]
- Ghenea, A.E.; Pădureanu, V.; Cioboată, R.; Udriștoiu, A.-L.; Drocaş, A.I.; Țieranu, E.; Carsote, M.; Vasile, C.M.; Moroşanu, A.; Biciușcă, V.; et al. The Study of Clinical and Biochemical Parameters in Assessing the Response to the Antiviral Therapy in the Chronic Viral Hepatitis. B. Med. 2021, 57, 757. [Google Scholar] [CrossRef] [PubMed]
- Sheena, B.S.; Hiebert, L.; Han, H.; Ippolito, H.; Abbasi-Kangevari, M.; Abbasi-Kangevari, Z.; Abbastabar, H.; Abdoli, A.; Ali, H.A.; Adane, M.M.; et al. Global, regional, and national burden of hepatitis B, 1990–2019: A systematic analysis for the Global Burden of Disease Study 2019. Lancet Gastroenterol. Hepatol. 2022, 7, 796–829. [Google Scholar] [CrossRef] [PubMed]
- Carman, W.F. The clinical significance of surface antigen variants of hepatitis B virus. J. Viral Hepat. 1997, 4, 11–20. [Google Scholar] [CrossRef]
- Inoue, J.; Nakamura, T.; Masamune, A. Roles of Hepatitis B Virus Mutations in the Viral Reactivation after Immunosuppression Therapies. Viruses 2019, 11, 457. [Google Scholar] [CrossRef]
- Kurbanov, F.; Tanaka, Y.; Mizokami, M. Geographical and genetic diversity of the human hepatitis B virus. Hepatol. Res. 2010, 40, 14–30. [Google Scholar] [CrossRef]
- Kramvis, A. Molecular characteristics and clinical relevance of African genotypes and subgenotypes of hepatitis B virus. S. Afr. Med. J. 2018, 108, 17–21. [Google Scholar] [CrossRef]
- Maepa, M.B.; Ely, A.; Kramvis, A.; Bloom, K.; Naidoo, K.; Simani, O.E.; Maponga, T.G.; Arbuthnot, P. Hepatitis B Virus Research in South Africa. Viruses 2022, 14, 1939. [Google Scholar] [CrossRef]
- Abe, H.; Ushijima, Y.; Bikangui, R.; Ondo, G.N.; Pemba, C.M.; Zadeh, V.R.; Mpingabo, P.I.; Ueda, H.; Agnandji, S.T.; Lell, B.; et al. Genetic Diversity of Hepatitis B and C Viruses Revealed by Continuous Surveillance from 2015 to 2021 in Gabon, Central Africa. Microorg. 2023, 11, 2046. [Google Scholar] [CrossRef]
- Giandhari, J.; Pillay, S.; Wilkinson, E.; Tegally, H.; Sinayskiy, I.; Schuld, M.; Lourenço, J.; Chimukangara, B.; Lessells, R.; Moosa, Y.; et al. Early transmission of SARS-CoV-2 in South Africa: An epidemiological and phylogenetic report. Int. J. Infect. Dis. 2021, 103, 234–241. [Google Scholar] [CrossRef]
- Ingasia, L.A.O.; Kostaki, E.G.; Paraskevis, D.; Kramvis, A. Global and regional dispersal patterns of hepatitis B virus genotype E from and in Africa: A full-genome molecular analysis. PLoS ONE 2020, 15, e0240375. [Google Scholar] [CrossRef]
- Al-Matary, A.M.; Al Gashaa, F.A.S. Comparison of different rapid screening tests and ELISA for HBV, HCV, and HIV among healthy blood donors and recipients at Jibla University Hospital Yemen. J. Med. Life 2022, 15, 1403–1408. [Google Scholar] [CrossRef] [PubMed]
- Parekh, B.S.; Ou, C.-Y.; Fonjungo, P.N.; Kalou, M.B.; Rottinghaus, E.; Puren, A.; Alexander, H.; Cox, M.H.; Nkengasong, J.N. Diagnosis of Human Immunodeficiency Virus Infection. Clin. Microbiol. Rev. 2018, 32, e00064-18. [Google Scholar] [CrossRef] [PubMed]
- Solmone, M.; Vincenti, D.; Prosperi, M.C.F.; Bruselles, A.; Ippolito, G.; Capobianchi, M.R. Use of massively parallel ultradeep pyrosequencing to characterize the genetic diversity of hepatitis B virus in drug-resistant and drug-naive patients and to detect minor variants in reverse transcriptase and hepatitis B S antigen. J. Virol. 2009, 83, 1718–1726. [Google Scholar] [CrossRef] [PubMed]
- Soleimani, B.; Lehnert, H.; Keilwagen, J.; Plieske, J.; Ordon, F.; Rad, S.N.; Ganal, M.; Beier, S.; Perovic, D. Comparison Between Core Set Selection Methods Using Different Illumina Marker Platforms: A Case Study of Assessment of Diversity in Wheat. Front. PlantSci. 2020, 11, 1040. [Google Scholar] [CrossRef]
- Adewale, B.A. Will long-read sequencing technologies replace short-read sequencing technologies in the next 10 years? Afr. J. Lab. Med. 2020, 9, 1340. [Google Scholar] [CrossRef]
- Quiñones-Mateu, M.E.; Avila, S.; Reyes-Teran, G.; Martinez, M.A. Deep sequencing: Becoming a critical tool in clinical virology. J. Clin. Virol. 2014, 61, 9–19. [Google Scholar] [CrossRef]
- Liu, W.-C.; Lin, C.-P.; Cheng, C.-P.; Ho, C.-H.; Lan, K.-L.; Cheng, J.-H.; Yen, C.-J.; Cheng, P.-N.; Wu, I.-C.; Li, I.-C.; et al. Aligning to the sample-specific reference sequence to optimize the accuracy of next-generation sequencing analysis for hepatitis B virus. Hepatol. Int. 2016, 10, 147–157. [Google Scholar] [CrossRef]
- Makondo, E.; Bell, T.G.; Kramvis, A. Genotyping and molecular characterization of hepatitis B virus from human immunodeficiency virus-infected individuals in southern Africa. PLoS ONE 2012, 7, e46345. [Google Scholar] [CrossRef]
- Caballero, A.; Gregori, J.; Homs, M.; Tabernero, D.; Gonzalez, C.; Quer, J.; Blasi, M.; Casillas, R.; Nieto, L.; Riveiro-Barciela, M.; et al. Complex Genotype Mixtures Analyzed by Deep Sequencing in Two Different Regions of Hepatitis B Virus. PLoS ONE 2016, 10, e0144816. [Google Scholar] [CrossRef]
- Han, Y.; Zhang, Y.; Mei, Y.; Wang, Y.; Liu, T.; Guan, Y.; Tan, D.; Liang, Y.; Yang, L.; Yi, X. Analysis of hepatitis B virus genotyping and drug resistance gene mutations based on massively parallel sequencing. J. Virol. Methods 2013, 193, 341–347. [Google Scholar] [CrossRef] [PubMed]
- Jones, L.R.; Sede, M.; Manrique, J.M.; Quarleri, J. Hepatitis B virus resistance substitutions: Long-term analysis by next-generation sequencing. Arch. Virol. 2016, 161, 2885–2891. [Google Scholar] [CrossRef] [PubMed]
- Lowe, C.F.; Merrick, L.; Harrigan, P.R.; Mazzulli, T.; Sherlock, C.H.; Ritchie, G. Implementation of Next-Generation Sequencing for Hepatitis B Virus Resistance Testing and Genotyping in a Clinical Microbiology Laboratory. J. Clin. Microbiol. 2016, 54, 127–133. [Google Scholar] [CrossRef] [PubMed]
- McNaughton, A.L.; Roberts, H.E.; Bonsall, D.; de Cesare, M.; Mokaya, J.; Lumley, S.F.; Golubchik, T.; Piazza, P.; Martin, J.B.; de Lara, C.; et al. Illumina and Nanopore methods for whole genome sequencing of hepatitis B virus (HBV). Sci. Rep. 2019, 9, 7081. [Google Scholar] [CrossRef]
- Radukic, M.T.; Brandt, D.; Haak, M.; Müller, K.M.; Kalinowski, J. Nanopore sequencing of native adeno-associated virus (AAV) single-stranded DNA using a transposase-based rapid protocol. NAR Genom. Bioinform. 2020, 2, lqaa074. [Google Scholar] [CrossRef]
- Ranasinghe, D.; Jayadas, T.T.P.; Jayathilaka, D.; Jeewandara, C.; Dissanayake, O.; Guruge, D.; Ariyaratne, D.; Gunasinghe, D.; Gomes, L.; Wijesinghe, A.; et al. Comparison of different sequencing techniques for identification of SARS-CoV-2 variants of concern with multiplex real-time PCR. PLoS ONE 2022, 17, e0265220. [Google Scholar] [CrossRef]
- Loman, N.J.; Quick, J.; Simpson, J.T. A complete bacterial genome assembled de novo using only nanopore sequencing data. Nat. Methods 2015, 12, 733–735. [Google Scholar] [CrossRef]
- Krzywinski, M.; Schein, J.; Birol, I.; Connors, J.; Gascoyne, R.; Horsman, D.; Jones, S.J.; Marra, M.A. Circos: An information aesthetic for comparative genomics. Genome Res. 2009, 19, 1639–1645. [Google Scholar] [CrossRef]
- Hossain, M.G.; Ueda, K.A. meta-analysis on genetic variability of RT/HBsAg overlapping region of hepatitis B virus (HBV) isolates of Bangladesh. Infect. Agent Cancer 2019, 14, 33. [Google Scholar] [CrossRef]
- Astbury, S.; Soares, M.M.D.C.N.; Peprah, E.; King, B.J.; Jardim, A.C.G.; Shimizu, J.F.; Jalal, P.J.; Saeed, C.H.; Sabeer, F.T.; Irving, W.L.; et al. Extraction-free direct PCR from dried serum spots permits HBV genotyping and RAS identification by Sanger and minION sequencing. BioRxiv 2019, 552539. [Google Scholar] [CrossRef]
- Sauvage, V.; Boizeau, L.; Candotti, D.; Vandenbogaert, M.; Servant-Delmas, A.; Caro, V.; Laperche, S. Early MinION™ nanopore single-molecule sequencing technology enables the characterization of hepatitis B virus genetic complexity in clinical samples. PLoS ONE 2018, 13, e0194366. [Google Scholar] [CrossRef] [PubMed]
- Dopico, E.; Vila, M.; Tabernero, D.; Gregori, J.; Rando-Segura, A.; Pacín-Ruíz, B.; Guerrero, L.; Ubillos, I.; Martínez, M.J.; Costa, J.; et al. Genotyping Hepatitis B virus by Next-Generation Sequencing: Detection of Mixed Infections and Analysis of Sequence Conservation. Int. J. Mol. Sci. 2024, 25, 5481. [Google Scholar] [CrossRef] [PubMed]
- Gionda, P.O.; Gomes-Gouvea, M.; Malta, F.d.M.; Sebe, P.; Salles, A.P.M.; Francisco, R.d.S.; José-Abrego, A.; Roman, S.; Panduro, A.; Pinho, J.R.R. Analysis of the complete genome of HBV genotypes F and H found in Brazil and Mexico using the next generation sequencing method. Ann. Hepatol. 2022, 27, 100569. [Google Scholar] [CrossRef] [PubMed]
- Chotiyaputta, W.; Lok, A.S.F. Hepatitis B virus variants. Nat. Rev. Gastroenterol. Hepatol. 2009, 6, 453–462. [Google Scholar] [CrossRef]
- Kimbi, G.C.; Kramvis, A.; Kew, M.C. Distinctive sequence characteristics of subgenotype A1 isolates of hepatitis B virus from South Africa. J. Gen. Virol. 2004, 85, 1211–1220. [Google Scholar] [CrossRef]
- Jose-Abrego, A.; Roman, S.; Pinho, J.R.R.; de Castro, V.F.D.; Panduro, A. Hepatitis B Virus (HBV) Genotype Mixtures, Viral Load, and Liver Damage in HBV Patients Co-infected With Human Immunodeficiency Virus. Front. Microbiol. 2021, 12, 640889. [Google Scholar] [CrossRef]
- Kafeero, H.M.; Ndagire, D.; Ocama, P.; Kato, C.D.; Wampande, E.; Walusansa, A.; Kajumbula, H.; Kateete, D.; Ssenku, J.E.; Sendagire, H. Mapping hepatitis B virus genotypes on the African continent from 1997 to 2021: A systematic review with meta-analysis. Sci. Rep. 2023, 13, 5723. [Google Scholar] [CrossRef]
- Tyler, B.; Meeds, H.L.; Odegard, E.A.; Ismael, N.; Vubil, A.; Zicai, A.F.; Mabunda, N.; Blackard, J.T. Hepatitis B Virus Genotype E/A Recombinants from Blood Donors in Beira, Mozambique. Microbiol. Resour. Announc. 2023, 12, e0018223. [Google Scholar] [CrossRef]
- Chen, B.F.; Liu, C.; Jow, G.; Chen, P.; Kao, J.; Chen, D. High prevalence and mapping of pre-S deletion in hepatitis B virus carriers with progressive liver diseases. Gastroenterology 2006, 130, 1153–1168. [Google Scholar] [CrossRef]
- Beggel, B.; Neumann-Fraune, M.; Döring, M.; Lawyer, G.; Kaiser, R.; Verheyen, J.; Lengauer, T. Genotyping hepatitis B virus dual infections using population-based sequence data. J. Gen. Virol. 2012, 93, 1899–1907. [Google Scholar] [CrossRef]
- Neumann-Fraune, M.; Beggel, B.; Kaiser, R.; Obermeier, M. Hepatitis B virus drug resistance tools: One sequence, two predictions. Intervirology 2014, 57, 232–236. [Google Scholar] [CrossRef] [PubMed]
- Mokaya, J.; McNaughton, A.L.; Hadley, M.J.; Beloukas, A.; Geretti, A.-M.; Goedhals, D.; Matthews, P.C. A systematic review of hepatitis B virus (HBV) drug and vaccine escape mutations in Africa: A call for urgent action. PLoS Neglected Trop. Dis. 2018, 12, e0006629. [Google Scholar] [CrossRef] [PubMed]
- Spearman, C.W.N.; Sonderup, M.W.; Botha, J.F.; Van der Merwe, S.W.; Song, E.; Kassianides, C.; A Newton, K.; Hairwadzi, H.N. South African guideline for the management of chronic hepatitis B: 2013. S. Afr. Med. J. 2013, 103, 337–349. [Google Scholar] [CrossRef] [PubMed]
- Lee, H.W.; Chang, H.Y.; Yang, S.Y.; Kim, H.J. Viral evolutionary changes during tenofovir treatment in a chronic hepatitis B patient with sequential nucleos(t)ide therapy. J. Clin. Virol. 2014, 60, 313–316. [Google Scholar] [CrossRef] [PubMed]
- Tegally, H.; Wilkinson, E.; Giovanetti, M.; Iranzadeh, A.; Fonseca, V.; Giandhari, J.; Doolabh, D.; Pillay, S.; San, E.J.; Msomi, N.; et al. Detection of a SARS-CoV-2 variant of concern in South Africa. Nature 2021, 592, 438–443. [Google Scholar] [CrossRef]
- Tyson, J.R.; James, P.; Stoddart, D.; Sparks, N.; Wickenhagen, A.; Hall, G.; Choi, J.H.; Lapointe, H.; Kamelian, K.; Smith, A.D.; et al. Improvements to the ARTIC multiplex PCR method for SARS-CoV-2 genome sequencing using nanopore. BioRxiv 2020. [Google Scholar] [CrossRef]
- Katoh, K.; Standley, D.M. MAFFT Multiple Sequence Alignment Software Version 7: Improvements in Performance and Usability. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef]
- Martin, D.P.; Varsani, A.; Roumagnac, P.; Botha, G.; Maslamoney, S.; Schwab, T.; Kelz, Z.; Kumar, V.; Murrell, B. RDP5: A computer program for analyzing recombination in, and removing signals of recombination from, nucleotide sequence datasets. Virus Evol. 2021, 7, veaa087. [Google Scholar] [CrossRef]
- Martin, D.; Rybicki, E. RDP: Detection of recombination amongst aligned sequences. Bioinformatics 2000, 16, 562–563. [Google Scholar] [CrossRef]
- Padidam, M.; Sawyer, S.; Fauquet, C.M. Possible emergence of new geminiviruses by frequent recombination. Virology 1999, 265, 218–225. [Google Scholar] [CrossRef]
- Smith, J.M. Analyzing the mosaic structure of genes. J. Mol. Evol. 1992, 34, 126–129. [Google Scholar] [CrossRef] [PubMed]
- Martin, D.P.; Posada, D.; Crandall, K.; Williamson, C. A modified bootscan algorithm for automated identification of recombinant sequences and recombination breakpoints. AIDS Res. Hum. Retroviruses 2005, 21, 98–102. [Google Scholar] [CrossRef] [PubMed]
- Posada, D.; Crandall, K.A. Evaluation of methods for detecting recombination from DNA sequences: Computer simulations. Proc. Natl. Acad. Sci. USA 2001, 98, 13757–13762. [Google Scholar] [CrossRef] [PubMed]
- Gibbs, M.J.; Armstrong, J.S.; Gibbs, A.J. Sister-Scanning: A Monte Carlo procedure for assessing signals in recombinant sequences. Bioinformatics 2000, 16, 573–582. [Google Scholar] [CrossRef]
- Lam, H.M.; Ratmann, O.; Boni, M.F. Improved Algorithmic Complexity for the 3SEQ Recombination Detection Algorithm. Mol. Biol. Evol. 2018, 35, 247–251. [Google Scholar] [CrossRef]
- Kiwelu, I.E.; Novitsky, V.; Margolin, L.; Baca, J.; Manongi, R.; Sam, N.; Shao, J.; McLane, M.F.; Kapiga, S.H.; Essex, M. Frequent intra-subtype recombination among HIV-1 circulating in Tanzania. PLoS ONE 2013, 8, e71131. [Google Scholar] [CrossRef]
- Martin, D.P.; Lemey, P.; Lott, M.; Moulton, V.; Posada, D.; Lefeuvre, P. RDP3: A flexible and fast computer program for analyzing recombination. Bioinformatics 2010, 26, 2462–2463. [Google Scholar] [CrossRef]
- Sentandreu, V.; Jiménez-Hernández, N.; Torres-Puente, M.; Bracho, M.A.; Valero, A.; Gosalbes, M.J.; Ortega, E.; Moya, A.; González-Candelas, F. Evidence of Recombination in Intrapatient Populations of Hepatitis C Virus. PLoS ONE 2008, 3, e3239. [Google Scholar] [CrossRef]






| Characteristic | Total N = 138 (%) |
|---|---|
| Gender | |
| Male | 86 (62.32) |
| Female | 52 (37.68) |
| Age | |
| <18 | 2 (1.45) |
| 18–24 | 6 (4.35) |
| 25–34 | 30 (21.74) |
| 35–44 | 44 (31.88) |
| ≥45 | 56 (40.58) |
| HBV viral load (IU/mL) | |
| <2000 | 39 (28.26) |
| 2000–20,000 | 31 (22,46) |
| >20,000 | 68 (49.28) |
| Mutation | Adefovir | Entecavir | Lamuvidine | Telbivudine |
|---|---|---|---|---|
| 180M | 0 | 4 | 4 | 0 |
| 204V | 0 | 5 | 5 | 5 |
| 181T | 1 | 0 | 0 | 0 |
| 202K | 0 | 2 | 0 | 0 |
| 250S | 0 | 1 | 0 | 0 |
| 250N | 0 | 1 | 0 | 0 |
| Primer Name | Sequence | Genomic Positions (bp) |
|---|---|---|
| SC_1_LEFT | TTC CAC CAA GCT CTG CAA GATC | 11–32 |
| SC_1_RIGHT | AGAGGAATATGATAAAACGCCGCA | 384–407 |
| SC_2_LEFT | CATCATCATCAT CACCA CCTCC | 325–346 |
| SC_2_RIGHT | AAAGCCCTACGAACCACTGAAC | 692–713 |
| SC_3_LEFT | AAATACCTATGGGAGTGGGCCT | 632–653 |
| SC_3_RIGHT | TTGTGTAAATGGAGCGGCAAAG | 1655–1676 |
| SC_4_LEFT | AGAAAACTTCCTGTTAACAGACCTATTG | 949–976 |
| SC_4_RIGHT | GGACGACAGAATTATCAGTCCCG | 1326–1348 |
| SC_5_LEFT | TCCATACTGCGGAACTCCTAGC | 1265–1286 |
| SC_5_RIGHT | TGTAAGACCTTGGGCAGGATTTG | 1632–1654 |
| SC_6_LEFT | CTTCTCATCTGCCGGTCCGTGT | 1559–1580 |
| SC_6_RIGHT | AGAAGTCAGAAGGCAAACGAGA | 1947–1970 |
| SC_7_LEFT | GGCTTTGGGGCATGGACATT | 1890–1909 |
| SC_7_RIGHT | ATCCACACTCCGAAAGAGACCA | 2256–2277 |
| SC_8_LEFT | GACAACTATTGTGGTTTCATATTTCT | 2193–2218 |
| SC_8_RIGHT | TTGTTGACACCTATTAATAATGTCCTCA | 2576–2594 |
| SC_9_LEFT | TGGGCTTTATTCCTCTACTGTCCC | 2492–2515 |
| SC_9_RIGHT | GGGAACAGAAAGATTCGTCCCC | 2889–2910 |
| SC_10_LEFT | TTGCGGGTCACCATATTCTTGG | 2816–2837 |
| SC_10_RIGHT | GGCCTGAGGATGACTGTCTCTT | 3189–3210 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tshiabuila, D.; Choga, W.; San, J.E.; Maponga, T.; Van Zyl, G.; Giandhari, J.; Pillay, S.; Preiser, W.; Naidoo, Y.; Baxter, C.; et al. An Oxford Nanopore Technology-Based Hepatitis B Virus Sequencing Protocol Suitable for Genomic Surveillance Within Clinical Diagnostic Settings. Int. J. Mol. Sci. 2024, 25, 11702. https://doi.org/10.3390/ijms252111702
Tshiabuila D, Choga W, San JE, Maponga T, Van Zyl G, Giandhari J, Pillay S, Preiser W, Naidoo Y, Baxter C, et al. An Oxford Nanopore Technology-Based Hepatitis B Virus Sequencing Protocol Suitable for Genomic Surveillance Within Clinical Diagnostic Settings. International Journal of Molecular Sciences. 2024; 25(21):11702. https://doi.org/10.3390/ijms252111702
Chicago/Turabian StyleTshiabuila, Derek, Wonderful Choga, James E. San, Tongai Maponga, Gert Van Zyl, Jennifer Giandhari, Sureshnee Pillay, Wolfgang Preiser, Yeshnee Naidoo, Cheryl Baxter, and et al. 2024. "An Oxford Nanopore Technology-Based Hepatitis B Virus Sequencing Protocol Suitable for Genomic Surveillance Within Clinical Diagnostic Settings" International Journal of Molecular Sciences 25, no. 21: 11702. https://doi.org/10.3390/ijms252111702
APA StyleTshiabuila, D., Choga, W., San, J. E., Maponga, T., Van Zyl, G., Giandhari, J., Pillay, S., Preiser, W., Naidoo, Y., Baxter, C., Martin, D. P., & de Oliveira, T. (2024). An Oxford Nanopore Technology-Based Hepatitis B Virus Sequencing Protocol Suitable for Genomic Surveillance Within Clinical Diagnostic Settings. International Journal of Molecular Sciences, 25(21), 11702. https://doi.org/10.3390/ijms252111702

