Elevated Netrin-4 Expression and Its Action in Infrapatellar Fat Pad
Abstract
1. Introduction
2. Results
2.1. Correlation Between Proportion of NTN4 Expression and OA Pathology
2.2. NTN4-Expressing Cells in SVF
2.3. Effect of NTN4 on IFP-Derived Fibroblastic Cells
3. Discussion
4. Materials and Methods
4.1. Patients and Methods
4.2. NTN4 Expressing Cells in Stromal-Vascular Fraction of IFP
4.3. Effect of Netrin-4 Protein in Stromal Cells
4.4. RNA-Sequencing
4.5. qPCR
4.6. Statistical Analyses
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Allen, K.D.; Thoma, L.M.; Golightly, Y.M. Epidemiology of osteoarthritis. Osteoarthr. Cartil. 2022, 30, 184–195. [Google Scholar] [CrossRef] [PubMed]
- Vina, E.R.; Kwoh, C.K. Epidemiology of osteoarthritis: Literature update. Curr. Opin. Rheumatol. 2018, 30, 160–167. [Google Scholar] [CrossRef]
- Macchi, V.; Stocco, E.; Stecco, C.; Belluzzi, E.; Favero, M.; Porzionato, A.; De Caro, R. The infrapatellar fat pad and the synovial membrane: An anatomo-functional unit. J. Anat. 2018, 233, 146–154. [Google Scholar] [CrossRef] [PubMed]
- Santangelo, K.S.; Radakovich, L.B.; Fouts, J.; Foster, M.T. Pathophysiology of obesity on knee joint homeostasis: Contributions of the infrapatellar fat pad. Horm. Mol. Biol. Clin. Investig. 2016, 26, 97–108. [Google Scholar] [CrossRef]
- Bastiaansen-Jenniskens, Y.M.; Wei, W.; Feijt, C.; Waarsing, J.H.; Verhaar, J.A.; Zuurmond, A.M.; Hanemaaijer, R.; Stoop, R.; van Osch, G.J. Stimulation of fibrotic processes by the infrapatellar fat pad in cultured synoviocytes from patients with osteoarthritis: A possible role for prostaglandin f2alpha. Arthritis Rheum. 2013, 65, 2070–2080. [Google Scholar] [CrossRef] [PubMed]
- Distel, E.; Cadoudal, T.; Durant, S.; Poignard, A.; Chevalier, X.; Benelli, C. The infrapatellar fat pad in knee osteoarthritis: An important source of interleukin-6 and its soluble receptor. Arthritis Rheum. 2009, 60, 3374–3377. [Google Scholar] [CrossRef]
- Eymard, F.; Chevalier, X. Inflammation of the infrapatellar fat pad. Jt. Bone Spine 2016, 83, 389–393. [Google Scholar] [CrossRef]
- Greif, D.N.; Kouroupis, D.; Murdock, C.J.; Griswold, A.J.; Kaplan, L.D.; Best, T.M.; Correa, D. Infrapatellar Fat Pad/Synovium Complex in Early-Stage Knee Osteoarthritis: Potential New Target and Source of Therapeutic Mesenchymal Stem/Stromal Cells. Front. Bioeng. Biotechnol. 2020, 8, 860. [Google Scholar] [CrossRef]
- Klein-Wieringa, I.R.; de Lange-Brokaar, B.J.; Yusuf, E.; Andersen, S.N.; Kwekkeboom, J.C.; Kroon, H.M.; van Osch, G.J.; Zuurmond, A.M.; Stojanovic-Susulic, V.; Nelissen, R.G.; et al. Inflammatory Cells in Patients with Endstage Knee Osteoarthritis: A Comparison between the Synovium and the Infrapatellar Fat Pad. J. Rheumatol. 2016, 43, 771–778. [Google Scholar] [CrossRef]
- Klein-Wieringa, I.R.; Kloppenburg, M.; Bastiaansen-Jenniskens, Y.M.; Yusuf, E.; Kwekkeboom, J.C.; El-Bannoudi, H.; Nelissen, R.G.; Zuurmond, A.; Stojanovic-Susulic, V.; Van Osch, G.J.; et al. The infrapatellar fat pad of patients with osteoarthritis has an inflammatory phenotype. Ann. Rheum. Dis. 2011, 70, 851–857. [Google Scholar] [CrossRef]
- Presle, N.; Pottie, P.; Dumond, H.; Guillaume, C.; Lapicque, F.; Pallu, S.; Mainard, D.; Netter, P.; Terlain, B. Differential distribution of adipokines between serum and synovial fluid in patients with osteoarthritis. Contribution of joint tissues to their articular production. Osteoarthr. Cartil. 2006, 14, 690–695. [Google Scholar] [CrossRef] [PubMed]
- Lai Wing Sun, K.; Correia, J.P.; Kennedy, T.E. Netrins: Versatile extracellular cues with diverse functions. Development 2011, 138, 2153–2169. [Google Scholar] [PubMed]
- Han, Y.; Shao, Y.; Liu, T.; Qu, Y.L.; Li, W.; Liu, Z. Therapeutic effects of topical netrin-4 inhibits corneal neovascularization in alkali-burn rats. PLoS ONE 2015, 10, e0122951. [Google Scholar] [CrossRef] [PubMed]
- Nacht, M.; St Martin, T.B.; Byrne, A.; Klinger, K.W.; Teicher, B.A.; Madden, S.L.; Jiang, Y. Netrin-4 regulates angiogenic responses and tumor cell growth. Exp. Cell Res. 2009, 315, 784–794. [Google Scholar] [CrossRef]
- Podjaski, C.; Alvarez, J.I.; Bourbonniere, L.; Larouche, S.; Terouz, S.; Bin, J.M.; Lecuyer, M.A.; Saint-Laurent, O.; Larochelle, C.; Darlington, P.J.; et al. Netrin 1 regulates blood-brain barrier function and neuroinflammation. Brain 2015, 138 Pt 6, 1598–1612. [Google Scholar] [CrossRef] [PubMed]
- Reuten, R.; Patel, T.R.; McDougall, M.; Rama, N.; Nikodemus, D.; Gibert, B.; Delcros, J.G.; Prein, C.; Meier, M.; Metzger, S.; et al. Structural decoding of netrin-4 reveals a regulatory function towards mature basement membranes. Nat. Commun. 2016, 7, 13515. [Google Scholar] [CrossRef]
- Schneiders, F.I.; Maertens, B.; Bose, K.; Li, Y.; Brunken, W.J.; Paulsson, M.; Smyth, N.; Koch, M. Binding of netrin-4 to laminin short arms regulates basement membrane assembly. J. Biol. Chem. 2007, 282, 23750–23758. [Google Scholar] [CrossRef]
- Vennela, J.; Pottakkat, B.; Vairappan, B.S.; Verma, S.K.; Mukherjee, V. Hepatic Expression of NTN4 and Its Receptors in Patients with Hepatocellular Carcinoma. Asian Pac. J. Cancer Prev. 2023, 24, 4285–4292. [Google Scholar] [CrossRef]
- Villanueva, A.A.; Puvogel, S.; Lois, P.; Munoz-Palma, E.; Ramirez Orellana, M.; Lubieniecki, F.; Casco Claro, F.; Gallegos, I.; Garcia-Castro, J.; Sanchez-Gomez, P.; et al. The Netrin-4/Laminin gamma1/Neogenin-1 complex mediates migration in SK-N-SH neuroblastoma cells. Cell Adh Migr. 2019, 13, 33–40. [Google Scholar] [CrossRef]
- Dong, F.; Liu, Y.; Yan, W.; Meng, Q.; Song, X.; Cheng, B.; Yao, R. Netrin-4: Focus on Its Role in Axon Guidance, Tissue Stability, Angiogenesis and Tumors. Cell Mol. Neurobiol. 2023, 43, 1663–1683. [Google Scholar] [CrossRef]
- Zhang, H.; Vreeken, D.; Leuning, D.G.; Bruikman, C.S.; Junaid, A.; Stam, W.; de Bruin, R.G.; Sol, W.; Rabelink, T.J.; van den Berg, B.M.; et al. Netrin-4 expression by human endothelial cells inhibits endothelial inflammation and senescence. Int. J. Biochem. Cell Biol. 2021, 134, 105960. [Google Scholar] [CrossRef] [PubMed]
- Bai, Z.; Bartelo, N.; Aslam, M.; Murphy, E.A.; Hale, C.R.; Blachere, N.E.; Parveen, S.; Spolaore, E.; DiCarlo, E.; Gravallese, E.M.; et al. Synovial fibroblast gene expression is associated with sensory nerve growth and pain in rheumatoid arthritis. Sci. Transl. Med. 2024, 16, eadk3506. [Google Scholar] [CrossRef] [PubMed]
- Bohnsack, M.; Hurschler, C.; Demirtas, T.; Ruhmann, O.; Stukenborg-Colsman, C.; Wirth, C.J. Infrapatellar fat pad pressure and volume changes of the anterior compartment during knee motion: Possible clinical consequences to the anterior knee pain syndrome. Knee Surg. Sports Traumatol. Arthrosc. 2005, 13, 135–141. [Google Scholar] [CrossRef] [PubMed]
- Onuma, H.; Tsuji, K.; Hoshino, T.; Inomata, K.; Udo, M.; Nakagawa, Y.; Katagiri, H.; Miyatake, K.; Watanabe, T.; Sekiya, I.; et al. Fibrotic changes in the infrapatellar fat pad induce new vessel formation and sensory nerve fiber endings that associate prolonged pain. J. Orthop. Res. 2020, 38, 1296–1306. [Google Scholar] [CrossRef]
- Hui, W.; Litherland, G.J.; Elias, M.S.; Kitson, G.I.; Cawston, T.E.; Rowan, A.D.; Young, D.A. Leptin produced by joint white adipose tissue induces cartilage degradation via upregulation and activation of matrix metalloproteinases. Ann. Rheum. Dis. 2012, 71, 455–462. [Google Scholar] [CrossRef]
- Bastiaansen-Jenniskens, Y.M.; Clockaerts, S.; Feijt, C.; Zuurmond, A.M.; Stojanovic-Susulic, V.; Bridts, C.; de Clerck, L.; DeGroot, J.; Verhaar, J.A.; Kloppenburg, M.; et al. Infrapatellar fat pad of patients with end-stage osteoarthritis inhibits catabolic mediators in cartilage. Ann. Rheum. Dis. 2012, 71, 288–294. [Google Scholar] [CrossRef]
- Bravo, B.; Guisasola, M.C.; Vaquero, J.; Tirado, I.; Gortazar, A.R.; Forriol, F. Gene expression, protein profiling, and chemotactic activity of infrapatellar fat pad mesenchymal stem cells in pathologies of the knee joint. J. Cell Physiol. 2019, 234, 18917–18927. [Google Scholar] [CrossRef] [PubMed]
- Kouroupis, D.; Best, T.M.; Kaplan, L.D.; Correa, D.; Griswold, A.J. Single-Cell RNA-Sequencing Identifies Infrapatellar Fat Pad Macrophage Polarization in Acute Synovitis/Fat Pad Fibrosis and Cell Therapy. Bioengineering 2021, 8, 166. [Google Scholar] [CrossRef]
- Ma, S.; Murakami, K.; Saito, R.; Ito, H.; Murata, K.; Nishitani, K.; Hashimoto, M.; Tanaka, M.; Taniguchi, M.; Kitagori, K.; et al. Increased Ratio of CD14(++)CD80(+) Cells/CD14(++)CD163(+) Cells in the Infrapatellar Fat Pad of End-Stage Arthropathy Patients. Front. Immunol. 2021, 12, 774177. [Google Scholar] [CrossRef]
- Sae-Jung, T.; Sengprasert, P.; Apinun, J.; Ngarmukos, S.; Yuktanandana, P.; Tanavalee, A.; Reantragoon, R. Functional and T Cell Receptor Repertoire Analyses of Peripheral Blood and Infrapatellar Fat Pad T Cells in Knee Osteoarthritis. J. Rheumatol. 2019, 46, 309–317. [Google Scholar] [CrossRef]
- Burrage, P.S.; Mix, K.S.; Brinckerhoff, C.E. Matrix metalloproteinases: Role in arthritis. Front. Biosci. 2006, 11, 529–543. [Google Scholar] [CrossRef] [PubMed]
- Tsuchiya, M.; Ohashi, Y.; Kodera, Y.; Satoh, M.; Matsui, T.; Fukushima, K.; Iwase, D.; Aikawa, J.; Mukai, M.; Inoue, G.; et al. CD39+CD55- Fb Subset Exhibits Myofibroblast-Like Phenotype and Is Associated with Pain in Osteoarthritis of the Knee. Biomedicines 2023, 11, 3047. [Google Scholar] [CrossRef] [PubMed]





| Age (years) | 72.9 ± 8.49 |
| Sex, male/female, n | 20/62 |
| BMI (kg/m2) | 26.5 ± 4.3 |
| KL grade (2/3/4), n | 4/21/57 |
| VAS at rest (mm) | 3.3 ± 3.1 |
| VAS on movement (mm) | 6.6 ± 2.7 |
| Variable | F Value | p Value |
|---|---|---|
| Age (years) | 0.292 | 0.591 |
| Sex, male/female | 3.722 | 0.058 |
| BMI (kg/m2) | 2.077 | 0.154 |
| KL grade | 3.804 | 0.027 |
| VAS at rest (mm) | 0.310 | 0.580 |
| VAS on movement (mm) | 0.068 | 0.795 |
| Variable | β | p Value |
|---|---|---|
| Age (years) | −0.059 | 0.591 |
| Sex, male/female | −0.211 | 0.057 |
| BMI (kg/m2) | 0.156 | 0.147 |
| KL grade | 0.309 | 0.007 |
| VAS at rest (mm) | −0.066 | 0.586 |
| VAS on movement (mm) | −0.030 | 0.805 |
| Sample 1 | Sample 2 | |||
|---|---|---|---|---|
| Log2 FC | p Value | Log2 FC | p Value | |
| C3 | 1.14 | 5.12 × 10−55 | 1.17 | 1.86 × 10−71 |
| CXCL1 | 1.19 | 7.43 × 10−33 | 1.06 | 8.22 × 10−16 |
| CXCL6 | 1.16 | 1.85 × 10−40 | 1.47 | 3.16 × 10−96 |
| CXCL8 | 1.07 | 5.49 × 10−16 | 5.04 | 2.29 × 10−9 |
| IL6 | 3.77 | 5.41 × 10−10 | 3.37 | 4.51 × 10−7 |
| MMP1 | 1.07 | 9.45 × 10−151 | 1.23 | 1.85 × 10−17 |
| VCAM1 | 1.10 | 1.41 × 10−60 | 1.43 | 7.16 × 10−59 |
| ENSG00000264668 | 2.43 | 1.06 × 10−12 | 11.15 | 2.53 × 10−7 |
| Gene | Sequence | bp | |
|---|---|---|---|
| C3 | F | ACAAGCTCTGCCGTGATGAA | 154 |
| R | AGCTGAACCTTGACCAGTCG | ||
| CXCL1 | F | GCTTGCCTCAATCCTGCATC | 73 |
| R | AGTTGGATTTGTCACTGTTCAGC | ||
| CXCL6 | F | GGTCCTTCGGGCTCCTTGTG | 125 |
| R | ACGCGTAAACAAGTGCAACG | ||
| CXCL8 | F | ACACTGCGCCAACACAGAAA | 89 |
| R | CAACCCTCTGCACCCAGTTT | ||
| IL6 | F | GAGGAGACTTGCCTGGTGAAA | 199 |
| R | TGGCATTTGTGGTTGGGTCA | ||
| MMP1 | F | ACTTACATCGTGTTGCGGCT | 164 |
| R | CGATGGGCTGGACAGGATTT | ||
| NTN4 | F | TGTTGTCAAGAAGGGCGCTA | 159 |
| R | ACGCGAAGGTTGGTGATCTT | ||
| VCAM1 | F | CCATCCACAAAGCTGCAAGA | 70 |
| R | CTGGAGCTGGTAGACCCTCG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Uekusa, Y.; Mukai, M.; Tsukada, A.; Iwase, D.; Aikawa, J.; Shibata, N.; Ohashi, Y.; Inoue, G.; Takaso, M.; Uchida, K. Elevated Netrin-4 Expression and Its Action in Infrapatellar Fat Pad. Int. J. Mol. Sci. 2024, 25, 11369. https://doi.org/10.3390/ijms252111369
Uekusa Y, Mukai M, Tsukada A, Iwase D, Aikawa J, Shibata N, Ohashi Y, Inoue G, Takaso M, Uchida K. Elevated Netrin-4 Expression and Its Action in Infrapatellar Fat Pad. International Journal of Molecular Sciences. 2024; 25(21):11369. https://doi.org/10.3390/ijms252111369
Chicago/Turabian StyleUekusa, Yui, Manabu Mukai, Ayumi Tsukada, Dai Iwase, Jun Aikawa, Naoya Shibata, Yoshihisa Ohashi, Gen Inoue, Masashi Takaso, and Kentaro Uchida. 2024. "Elevated Netrin-4 Expression and Its Action in Infrapatellar Fat Pad" International Journal of Molecular Sciences 25, no. 21: 11369. https://doi.org/10.3390/ijms252111369
APA StyleUekusa, Y., Mukai, M., Tsukada, A., Iwase, D., Aikawa, J., Shibata, N., Ohashi, Y., Inoue, G., Takaso, M., & Uchida, K. (2024). Elevated Netrin-4 Expression and Its Action in Infrapatellar Fat Pad. International Journal of Molecular Sciences, 25(21), 11369. https://doi.org/10.3390/ijms252111369

