Loureirin B Reduces Insulin Resistance and Chronic Inflammation in a Rat Model of Polycystic Ovary Syndrome by Upregulating GPR120 and Activating the LKB1/AMPK Signaling Pathway
Abstract
1. Introduction
2. Results
2.1. LrB Reduced Body Weight and Lee’s Index in PCOS-IR Rats
2.2. LrB Reduced the Ovarian Area, Volume, and OI in PCOS-IR Rats
2.3. LrB Treatment Restored the Estrous Cycle in PCOS-IR Rats
2.4. LrB Reduced Dyslipidemia in PCOS-IR Rats
2.5. LrB Treatment Reduces Blood Glucose, Serum Insulin, and HOMA-IR in PCOS-IR Rats
2.6. LrB Treatment Normalizes Hormone Concentration in Serum of PCOS-IR Rats
2.7. LrB Treatment Reduces Serum TNF-α, IL-1β, -6, and -18 in PCOS-IR Rats
2.8. LrB Improves Histopathological Changes in PCOS-IR Rat Ovaries
2.9. LrB Increases GPR120 Expression in PCOS-IR Rat Ovaries
2.10. LrB Reduces the Expression of NLRP3 and Caspase-1 in the Ovaries of PCOS-IR Rats
2.11. LrB Increases LKB1 and AMPK in PCOS-IR Rat Ovaries
3. Discussion
4. Materials and Methods
4.1. Animals
4.2. Treatment
4.3. Vaginal Smears
4.4. Body Weight (BW) and Lee’s Index Measurements
4.5. FBG Measurement
4.6. Blood and Tissue Sampling
4.7. Hormone Level Measurement
4.8. Inflammatory Cytokine Assessment
4.9. Measurement of Lipid Metabolite Levels
4.10. Examination of Ovarian Tissue for Pathology
4.11. Western Blot
4.12. RNA Purification and Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)
4.13. Immunohistochemistry to Determine the Expression of LKB1 and AMPK in Rat Ovarian Tissues
4.14. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Vatier, C.; Christin-Maitre, S. Epigenetic/circadian clocks and PCOS. Hum. Reprod. 2024, 39, 1167–1175. [Google Scholar] [CrossRef] [PubMed]
- Neven, A.C.H.; Laven, J.; Teede, H.J.; Boyle, J.A. A Summary on Polycystic Ovary Syndrome: Diagnostic Criteria, Prevalence, Clinical Manifestations, and Management According to the Latest International Guidelines. Semin. Reprod. Med. 2018, 36, 5–12. [Google Scholar] [CrossRef] [PubMed]
- Moghetti, P.; Tosi, F. Insulin resistance and PCOS: Chicken or egg? J. Endocrinol. Investig. 2021, 44, 233–244. [Google Scholar] [CrossRef] [PubMed]
- Vatier, C.; Christin-Maitre, S.; Vigouroux, C. Role of insulin resistance on fertility—Focus on polycystic ovary syndrome. Ann. Endocrinol. 2022, 83, 199–202. [Google Scholar] [CrossRef]
- Barbieri, R.L.; Makris, A.; Randall, R.W.; Daniels, G.; Kistner, R.W.; Ryan, K.J. Insulin stimulates androgen accumulation in incubations of ovarian stroma obtained from women with hyperandrogenism. J. Clin. Endocrinol. Metab. 1986, 62, 904–910. [Google Scholar] [CrossRef]
- Repaci, A.; Gambineri, A.; Pasquali, R. The role of low-grade inflammation in the polycystic ovary syndrome. Mol. Cell Endocrinol. 2011, 335, 30–41. [Google Scholar] [CrossRef]
- Rudnicka, E.; Suchta, K.; Grymowicz, M.; Calik-Ksepka, A.; Smolarczyk, K.; Duszewska, A.M.; Smolarczyk, R.; Meczekalski, B. Chronic Low Grade Inflammation in Pathogenesis of PCOS. Int. J. Mol. Sci. 2021, 22, 3789. [Google Scholar] [CrossRef]
- Yu, O.; Christ, J.P.; Schulze-Rath, R.; Covey, J.; Kelley, A.; Grafton, J.; Cronkite, D.; Holden, E.; Hilpert, J.; Sacher, F.; et al. Incidence, prevalence, and trends in polycystic ovary syndrome diagnosis: A United States population-based study from 2006 to 2019. Am. J. Obstet. Gynecol. 2023, 229, 31.e1–31.e39. [Google Scholar] [CrossRef]
- Fulghesu, A.M.; Romualdi, D.; Di Florio, C.; Sanna, S.; Tagliaferri, V.; Gambineri, A.; Tomassoni, F.; Minerba, L.; Pasquali, R.; Lanzone, A. Is there a dose-response relationship of metformin treatment in patients with polycystic ovary syndrome? Results from a multicentric study. Hum. Reprod. 2012, 27, 3057–3066. [Google Scholar] [CrossRef]
- Gotoh, C.; Hong, Y.H.; Iga, T.; Hishikawa, D.; Suzuki, Y.; Song, S.H.; Choi, K.C.; Adachi, T.; Hirasawa, A.; Tsujimoto, G.; et al. The regulation of adipogenesis through GPR120. Biochem. Biophys. Res. Commun. 2007, 354, 591–597. [Google Scholar] [CrossRef]
- Hara, T.; Kimura, I.; Inoue, D.; Ichimura, A.; Hirasawa, A. Free fatty acid receptors and their role in regulation of energy metabolism. Rev. Physiol. Biochem. Pharmacol. 2013, 164, 77–116. [Google Scholar] [PubMed]
- Liu, Y.; Ding, J.; Tan, X.; Shen, Y.; Xu, L.; Li, T.; Ma, W.; Wu, J. GPR120 agonist ameliorated insulin resistance and improved ovarian function. Zygote 2022, 30, 380–385. [Google Scholar] [CrossRef] [PubMed]
- Ding, X.; Xie, H.; Shan, W.; Li, L. Agonism of GPR120 Prevented High Glucose-Induced Apoptosis of Retinal Endothelial Cells through Inhibiting NLRP3 Inflammasome. Klin. Monbl. Augenheilkd. 2023, 240, 1292–1299. [Google Scholar] [CrossRef] [PubMed]
- Wu, C.; Cai, X.Q.; Chang, Y.; Chen, C.H.; Ho, T.J.; Lai, S.C.; Chen, H.P. Rapid identification of dragon blood samples from Daemonorops draco, Dracaena cinnabari and Dracaena cochinchinensis by MALDI-TOF mass spectrometry. Phytochem. Anal. 2019, 30, 720–726. [Google Scholar] [CrossRef] [PubMed]
- Fan, J.Y.; Yi, T.; Sze-To, C.M.; Zhu, L.; Peng, W.L.; Zhang, Y.Z.; Zhao, Z.Z.; Chen, H.B. A systematic review of the botanical, phytochemical and pharmacological profile of Dracaena cochinchinensis, a plant source of the ethnomedicine “dragon’s blood”. Molecules 2014, 19, 10650–10669. [Google Scholar] [CrossRef]
- Fang, H.; Ding, Y.; Xia, S.; Chen, Q.; Niu, B. Loureirin B promotes insulin secretion through GLP-1R and AKT/PDX1 pathways. Eur. J. Pharmacol. 2022, 936, 175377. [Google Scholar] [CrossRef]
- Liu, M.; Zhang, J.F.; Zhu, W.L.; Liu, H.; Jia, X. Loureirin B protects against obesity via activation of adipose tissue ω3 PUFA-GPR120-UCP1 axis in mice. Biochem. Biophys. Res. Commun. 2022, 632, 139–149. [Google Scholar] [CrossRef]
- Ding, Y.; Xia, S.; Fang, H.; Niu, B.; Chen, Q. Loureirin B attenuates insulin resistance in HepG2 cells by regulating gluconeogenesis signaling pathway. Eur. J. Pharmacol. 2021, 910, 174481. [Google Scholar] [CrossRef]
- Zou, Y.; Zhao, Q.; Zhang, X.; Yu, H.; Zhou, Y.; Li, Z.; Xiao, M.; Xiang, Q.; Zhang, L.; Shi, W.; et al. The immunosuppressive effects and mechanisms of loureirin B on collagen-induced arthritis in rats. Front. Immunol. 2023, 14, 1094649. [Google Scholar] [CrossRef]
- Shi, S.; Zhao, Q.; Ke, C.; Long, S.; Zhang, F.; Zhang, X.; Li, Y.; Liu, X.; Hu, H.; Yin, S. Loureirin B Exerts its Immunosuppressive Effects by Inhibiting STIM1/Orai1 and K(V)1.3 Channels. Front. Pharmacol. 2021, 12, 685092. [Google Scholar] [CrossRef]
- Armanini, D.; Boscaro, M.; Bordin, L.; Sabbadin, C. Controversies in the Pathogenesis, Diagnosis and Treatment of PCOS: Focus on Insulin Resistance, Inflammation, and Hyperandrogenism. Int. J. Mol. Sci. 2022, 23, 4110. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Wu, D.; Guo, H.; Li, M. Hyperandrogenemia and insulin resistance: The chief culprit of polycystic ovary syndrome. Life Sci. 2019, 236, 116940. [Google Scholar] [CrossRef] [PubMed]
- Macut, D.; Bjekić-Macut, J.; Savić-Radojević, A. Dyslipidemia and oxidative stress in PCOS. Front. Horm. Res. 2013, 40, 51–63. [Google Scholar] [PubMed]
- Song, T.; Yang, Y.; Zhou, Y.; Wei, H.; Peng, J. GPR120: A critical role in adipogenesis, inflammation, and energy metabolism in adipose tissue. Cell Mol. Life Sci. 2017, 74, 2723–2733. [Google Scholar] [CrossRef]
- Li, Y.; Wang, B.; Shen, J.; Bai, M.; Xu, E. Berberine attenuates fructose-induced insulin resistance by stimulating the hepatic LKB1/AMPK/PGC1α pathway in mice. Pharm. Biol. 2020, 58, 385–392. [Google Scholar] [CrossRef]
- Yamada, E.; Lee, T.W.; Pessin, J.E.; Bastie, C.C. Targeted therapies of the LKB1/AMPK pathway for the treatment of insulin resistance. Future Med. Chem. 2010, 2, 1785–1796. [Google Scholar] [CrossRef]
- Xu, J.; Núñez, G. The NLRP3 inflammasome: Activation and regulation. Trends. Biochem. Sci. 2023, 48, 331–344. [Google Scholar] [CrossRef]
- Coll, R.C.; Schroder, K.; Pelegrín, P. NLRP3 and pyroptosis blockers for treating inflammatory diseases. Trends. Pharmacol. Sci.. 2022, 43, 653–668. [Google Scholar] [CrossRef]
- Lu, F.; Lan, Z.; Xin, Z.; He, C.; Guo, Z.; Xia, X.; Hu, T. Emerging insights into molecular mechanisms underlying pyroptosis and functions of inflammasomes in diseases. J. Cell Physiol. 2020, 235, 3207–3221. [Google Scholar] [CrossRef]
- Yang, Y.; Wang, H.; Kouadir, M.; Song, H.; Shi, F. Recent advances in the mechanisms of NLRP3 inflammasome activation and its inhibitors. Cell Death Dis. 2019, 10, 128. [Google Scholar] [CrossRef]
- Wang, B.; Shi, M.; Yu, C.; Pan, H.; Shen, H.; Du, Y.; Zhang, Y.; Liu, B.; Xi, D.; Sheng, J.; et al. NLRP3 Inflammasome-dependent Pathway is Involved in the Pathogenesis of Polycystic Ovary Syndrome. Reprod. Sci. 2024, 31, 1017–1027. [Google Scholar] [CrossRef] [PubMed]
- Wang, D.; Weng, Y.; Zhang, Y.; Wang, R.; Wang, T.; Zhou, J.; Shen, S.; Wang, H.; Wang, Y. Exposure to hyperandrogen drives ovarian dysfunction and fibrosis by activating the NLRP3 inflammasome in mice. Sci. Total Environ. 2020, 745, 141049. [Google Scholar] [CrossRef]
- Cabus, U.; Kabukcu, C.; Fenkci, S.; Caner, V.; Oztekin, O.; Fenkci, V.; Enli, Y. Serum Caspase-1 levels in women with polycystic ovary syndrome. Taiwan J. Obstet. Gynecol. 2020, 59, 207–210. [Google Scholar] [CrossRef]
- Wang, X.; Fu, S.; Wang, Y.; Yu, P.; Hu, J.; Gu, W.; Xu, X.M.; Lu, P. Interleukin-1beta mediates proliferation and differentiation of multipotent neural precursor cells through the activation of SAPK/JNK pathway. Mol. Cell Neurosci. 2007, 36, 343–354. [Google Scholar] [CrossRef]
- Zafari Zangeneh, F.; Naghizadeh, M.M.; Masoumi, M. Polycystic ovary syndrome and circulating inflammatory markers. Int. J. Reprod. Biomed. 2017, 15, 375–382. [Google Scholar] [CrossRef]
- Zhang, H.Y.; Zhu, F.F.; Zhu, Y.J.; Hu, Y.J.; Chen, X. Effects of IL-18 on the proliferation and steroidogenesis of bovine theca cells: Possible roles in the pathogenesis of polycystic ovary syndrome. J. Cell Mol. Med. 2021, 25, 1128–1139. [Google Scholar] [CrossRef]
- Moller, D.E. Potential role of TNF-alpha in the pathogenesis of insulin resistance and type 2 diabetes. Trends. Endocrinol. Metab. 2000, 11, 212–217. [Google Scholar] [CrossRef]
- Silva, J.R.V.; Lima, F.E.O.; Souza, A.L.P.; Silva, A.W.B. Interleukin-1β and TNF-α systems in ovarian follicles and their roles during follicular development, oocyte maturation and ovulation. Zygote 2020, 28, 270–277. [Google Scholar] [CrossRef]
- Xiao, N.; Wang, J.; Wang, T.; Xiong, X.; Zhou, J.; Su, X.; Peng, J.; Yang, C.; Li, X.; Lin, G.; et al. Metformin abrogates pathological TNF-α-producing B cells through mTOR-dependent metabolic reprogramming in polycystic ovary syndrome. Elife 2022, 11, e74713. [Google Scholar] [CrossRef]
- Rehman, K.; Akash, M.S.H.; Liaqat, A.; Kamal, S.; Qadir, M.I.; Rasul, A. Role of Interleukin-6 in Development of Insulin Resistance and Type 2 Diabetes Mellitus. Crit. Rev. Eukaryot. Gene Expr. 2017, 27, 229–236. [Google Scholar] [CrossRef]
- Borthakur, A.; Prabhu, Y.D.; Valsala Gopalakrishnan, A. Role of IL-6 signalling in Polycystic Ovarian Syndrome associated inflammation. J. Reprod. Immunol. 2020, 141, 103155. [Google Scholar] [CrossRef] [PubMed]
- Malini, N.A.; Roy, G.K. Influence of Insulin on LH, Testosterone and SHBG in various PCOS Categories based on the Mode of Secretion of LH in relation to FSH Levels. Acta Endocrinol. 2021, 17, 313–318. [Google Scholar]
- Nestler, J.E.; Jakubowicz, D.J.; de Vargas, A.F.; Brik, C.; Quintero, N.; Medina, F. Insulin stimulates testosterone biosynthesis by human thecal cells from women with polycystic ovary syndrome by activating its own receptor and using inositolglycan mediators as the signal transduction system. J. Clin. Endocrinol. Metab. 1998, 83, 2001–2005. [Google Scholar]
- Rosenfield, R.L. Current concepts of polycystic ovary syndrome. Baillieres Clin. Obstet. Gynaecol. 1997, 11, 307–333. [Google Scholar] [CrossRef]
- Pierre, A.; Taieb, J.; Giton, F.; Grynberg, M.; Touleimat, S.; El Hachem, H.; Fanchin, R.; Monniaux, D.; Cohen-Tannoudji, J.; di Clemente, N.; et al. Dysregulation of the Anti-Müllerian Hormone System by Steroids in Women With Polycystic Ovary Syndrome. J. Clin. Endocrinol. Metab. 2017, 102, 3970–3978. [Google Scholar] [CrossRef]
- Billig, H.; Furuta, I.; Hsueh, A.J. Estrogens inhibit and androgens enhance ovarian granulosa cell apoptosis. Endocrinology 1993, 133, 2204–2212. [Google Scholar] [CrossRef]
- Poretsky, L.; Clemons, J.; Bogovich, K. Hyperinsulinemia and human chorionic gonadotropin synergistically promote the growth of ovarian follicular cysts in rats. Metabolism 1992, 41, 903–910. [Google Scholar] [CrossRef]
- Blank, S.K.; McCartney, C.R.; Marshall, J.C. The origins and sequelae of abnormal neuroendocrine function in polycystic ovary syndrome. Hum. Reprod. Update 2006, 12, 351–361. [Google Scholar] [CrossRef]
- Zhao, H.; Chen, R.; Zheng, D.; Xiong, F.; Jia, F.; Liu, J.; Zhang, L.; Zhang, N.; Zhu, S.; Liu, Y.; et al. Modified Banxia Xiexin Decoction Ameliorates Polycystic Ovarian Syndrome With Insulin Resistance by Regulating Intestinal Microbiota. Front. Cell Infect. Microbiol. 2022, 12, 854796. [Google Scholar] [CrossRef]
- Zhang, N.; Liu, X.; Zhuang, L.; Liu, X.; Zhao, H.; Shan, Y.; Liu, Z.; Li, F.; Wang, Y.; Fang, J. Berberine decreases insulin resistance in a PCOS rats by improving GLUT4: Dual regulation of the PI3K/AKT and MAPK pathways. Regul. Toxicol. Pharmacol. 2020, 110, 104544. [Google Scholar] [CrossRef]
- Wang, M.X.; Yin, Q.; Xu, X. A Rat Model of Polycystic Ovary Syndrome with Insulin Resistance Induced by Letrozole Combined with High Fat Diet. Med. Sci. Monit. 2020, 26, e922136. [Google Scholar] [CrossRef] [PubMed]
- Peng, M.F.; Tian, S.; Song, Y.G.; Li, C.X.; Miao, M.S.; Ren, Z.; Li, M. Effects of total flavonoids from Eucommia ulmoides Oliv. leaves on polycystic ovary syndrome with insulin resistance model rats induced by letrozole combined with a high-fat diet. J. Ethnopharmacol. 2021, 273, 113947. [Google Scholar] [CrossRef] [PubMed]
- Qiu, S.; Wu, C.; Lin, F.; Chen, L.; Huang, Z.; Jiang, Z. Exercise training improved insulin sensitivity and ovarian morphology in rats with polycystic ovary syndrome. Horm. Metab. Res. 2009, 41, 880–885. [Google Scholar] [CrossRef] [PubMed]














| Gene Symbol | Forward Primer | Reverse Primer |
|---|---|---|
| GPR120 | TTCTTCTCCGATGTCAAGGGC | CGCTTAGGGTCATCACGTAGAAG |
| NLRP3 | GGCCTGTGTGGGAACAAGTA | GGGCGTCCTCTAGTAGTTTCG |
| CASP1 | TGCTTTCTGCTCTTCAACACC | ACCAGGCATATTCTTTCATGTGT |
| GAPDH | CTGGAGAAACCTGCCAAGTAT | GGTGGAAGAATGGGAGTTGCT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, J.; Huang, Z.; Cao, Z.; Luo, Y.; Liu, Y.; Cao, H.; Tang, X.; Fang, G. Loureirin B Reduces Insulin Resistance and Chronic Inflammation in a Rat Model of Polycystic Ovary Syndrome by Upregulating GPR120 and Activating the LKB1/AMPK Signaling Pathway. Int. J. Mol. Sci. 2024, 25, 11146. https://doi.org/10.3390/ijms252011146
Wang J, Huang Z, Cao Z, Luo Y, Liu Y, Cao H, Tang X, Fang G. Loureirin B Reduces Insulin Resistance and Chronic Inflammation in a Rat Model of Polycystic Ovary Syndrome by Upregulating GPR120 and Activating the LKB1/AMPK Signaling Pathway. International Journal of Molecular Sciences. 2024; 25(20):11146. https://doi.org/10.3390/ijms252011146
Chicago/Turabian StyleWang, Jing, Zheng Huang, Zhiyong Cao, Yehao Luo, Yueting Liu, Huilu Cao, Xiusong Tang, and Gang Fang. 2024. "Loureirin B Reduces Insulin Resistance and Chronic Inflammation in a Rat Model of Polycystic Ovary Syndrome by Upregulating GPR120 and Activating the LKB1/AMPK Signaling Pathway" International Journal of Molecular Sciences 25, no. 20: 11146. https://doi.org/10.3390/ijms252011146
APA StyleWang, J., Huang, Z., Cao, Z., Luo, Y., Liu, Y., Cao, H., Tang, X., & Fang, G. (2024). Loureirin B Reduces Insulin Resistance and Chronic Inflammation in a Rat Model of Polycystic Ovary Syndrome by Upregulating GPR120 and Activating the LKB1/AMPK Signaling Pathway. International Journal of Molecular Sciences, 25(20), 11146. https://doi.org/10.3390/ijms252011146

