Myo-Inositol and D-Chiro-Inositol Reduce DHT-Stimulated Changes in the Steroidogenic Activity of Adult Granulosa Cell Tumors
Abstract
1. Introduction
2. Results
2.1. AGCTs Are More Sensitive to Androgen Action than Noncancer Granulosa Cells
2.2. KGN Cell Viability Is Not Affected by DHT
2.3. Steroidogenic Enzymes Are Highly Expressed in AGCTs
2.4. DHT Induces E2 Secretion in KGN Cells by Affecting the Expression of Steroidogenic Enzymes
2.5. Neither Mio-Inositol nor D-Chiro-Inositol Affects the Viability of HGrC1 or KGN Cells
2.6. MI and DCI Strongly Reduce Steroidogenesis in Adult GC Tumors
2.7. Cotreatment with MI and DCI Reduces DHT-Stimulated Steroid Secretion via Steroidogenic Enzymes
3. Discussion
4. Materials and Methods
4.1. Treatments
4.2. Cell Line Culture
4.3. Cell Treatments
4.4. Cell Viability
4.5. Nile Red Staining
4.6. Hormone Determination
4.7. Real-Time PCR Analysis
4.8. Western Blot Analysis
4.9. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Haltia, U.M.; Pihlajoki, M.; Andersson, N.; Mäkinen, L.; Tapper, J.; Cervera, A.; Horlings, H.M.; Turpeinen, U.; Anttonen, M.; Bützow, R.; et al. Functional Profiling of FSH and Estradiol in Ovarian Granulosa Cell Tumors. J. Endocr. Soc. 2020, 4, bvaa034. [Google Scholar] [CrossRef] [PubMed]
- Macut, D.; Ilić, D.; Mitrović Jovanović, A.; Bjekić-Macut, J. Androgen-Secreting Ovarian Tumors. Front. Horm. Res. 2019, 53, 100–107. [Google Scholar] [CrossRef] [PubMed]
- Summey, R.M.; Rader, J.S.; Moh, M.; Bradley, W.; Uyar, D.; Bishop, E.; McAlarnen, L.; Hopp, E. A Case Series of Triplet Anti-Hormonal Therapy in Androgen Receptor-Positive Recurrent Adult Ovarian Granulosa Cell Tumor. Gynecol. Oncol. Rep. 2022, 44, 101118. [Google Scholar] [CrossRef]
- Färkkilä, A.; Haltia, U.M.; Tapper, J.; McConechy, M.K.; Huntsman, D.G.; Heikinheimo, M. Pathogenesis and Treatment of Adult-Type Granulosa Cell Tumor of the Ovary. Ann. Med. 2017, 49, 435–447. [Google Scholar] [CrossRef]
- Llano, E.; Todeschini, A.L.; Felipe-Medina, N.; Corte-Torres, M.D.; Condezo, Y.B.; Sanchez-Martin, M.; López-Tamargo, S.; Astudillo, A.; Puente, X.S.; Pendas, A.M.; et al. The Oncogenic FOXL2 C134W Mutation Is a Key Driver of Granulosa Cell Tumors. Cancer Res. 2023, 83, 239–250. [Google Scholar] [CrossRef]
- Li, X.; Tian, B.; Liu, M.; Miao, C.; Wang, D. Adult-Type Granulosa Cell Tumor of the Ovary. Am. J. Cancer Res. 2022, 12, 3495–3511. [Google Scholar] [PubMed]
- Belli, M.; Iwata, N.; Nakamura, T.; Iwase, A.; Stupack, D.; Shimasaki, S. FOXL2C134W-Induced CYP19 Expression via Cooperation with SMAD3 in HGrC1 Cells. Endocrinology 2018, 159, 1690–1703. [Google Scholar] [CrossRef]
- Yang, L.; Yang, M.; Cui, C.; Long, X.; Li, Y.; Dai, W.; Lang, T.; Zhou, Q. The Myo-Inositol Biosynthesis Rate-Limiting Enzyme ISYNA1 Suppresses the Stemness of Ovarian Cancer via Notch1 Pathway. Cell Signal 2023, 107, 110688. [Google Scholar] [CrossRef]
- Watkins, O.C.; Pillai, R.A.; Selvam, P.; Yong, H.E.J.; Cracknell-Hazra, V.K.B.; Sharma, N.; Cazenave-Gassiot, A.; Bendt, A.K.; Godfrey, K.M.; Lewis, R.M.; et al. Myo-Inositol Alters the Effects of Glucose, Leptin and Insulin on Placental Palmitic Acid and Oleic Acid Metabolism. J. Physiol. 2023, 601, 4151–4169. [Google Scholar] [CrossRef]
- Al-Suod, H.; Ligor, M.; Rațiu, I.A.; Rafińska, K.; Górecki, R.; Buszewski, B. A Window on Cyclitols: Characterization and Analytics of Inositols. Phytochem. Lett. 2017, 20, 507–519. [Google Scholar] [CrossRef]
- Genazzani, A.D.; Santagni, S.; Rattighieri, E.; Chierchia, E.; Despini, G.; Marini, G.; Prati, A.; Simoncini, T. Modulatory Role of D-Chiro-Inositol (DCI) on LH and Insulin Secretion in Obese PCOS Patients. Gynecol. Endocrinol. 2014, 30, 438–443. [Google Scholar] [CrossRef] [PubMed]
- Unfer, V.; Facchinetti, F.; Orrù, B.; Giordani, B.; Nestler, J. Myo-Inositol Effects in Women with PCOS: A Meta-Analysis of Randomized Controlled Trials. Endocr. Connect 2017, 6, 647–658. [Google Scholar] [CrossRef]
- Greff, D.; Juhász, A.E.; Váncsa, S.; Váradi, A.; Sipos, Z.; Szinte, J.; Park, S.; Hegyi, P.; Nyirády, P.; Ács, N.; et al. Inositol Is an Effective and Safe Treatment in Polycystic Ovary Syndrome: A Systematic Review and Meta-Analysis of Randomized Controlled Trials. Reprod. Biol. Endocrinol. 2023, 21, 10. [Google Scholar] [CrossRef]
- Amabile, M.I.; De Luca, A.; Tripodi, D.; D’alberti, E.; Melcarne, R.; Imbimbo, G.; Picconi, O.; D’andrea, V.; Vergine, M.; Sorrenti, S.; et al. Effects of Inositol Hexaphosphate and Myo-Inositol Administration in Breast Cancer Patients during Adjuvant Chemotherapy. J. Pers. Med. 2021, 11, 756. [Google Scholar] [CrossRef]
- Monti, N.; Dinicola, S.; Querqui, A.; Fabrizi, G.; Fedeli, V.; Gesualdi, L.; Catizone, A.; Unfer, V.; Bizzarri, M. Myo-Inositol Reverses TGF-Β1-Induced EMT in MCF-10A Non-Tumorigenic Breast Cells. Cancers 2023, 15, 2317. [Google Scholar] [CrossRef] [PubMed]
- Gambioli, R.; Forte, G.; Aragona, C.; Bevilacqua, A.; Bizzarri, M.; Unfer, V. The Use of D-Chiro-Inositol in Clinical Practice. Eur. Rev. Med. Pharmacol. Sci. 2021, 25, 438–446. [Google Scholar] [CrossRef] [PubMed]
- Sacchi, S.; Marinaro, F.; Tondelli, D.; Lui, J.; Xella, S.; Marsella, T.; Tagliasacchi, D.; Argento, C.; Tirelli, A.; Giulini, S.; et al. Modulation of Gonadotrophin Induced Steroidogenic Enzymes in Granulosa Cells by D-Chiroinositol. Reprod. Biol. Endocrinol. 2016, 14, 52. [Google Scholar] [CrossRef]
- Bizzarri, M.; Monti, N.; Piombarolo, A.; Angeloni, A.; Verna, R. Myo-Inositol and D-Chiro-Inositol as Modulators of Ovary Steroidogenesis: A Narrative Review. Nutrients 2023, 15, 1875. [Google Scholar] [CrossRef] [PubMed]
- Otala, M.; Mäkinen, S.; Tuuri, T.; Sjöberg, J.; Pentikäinen, V.; Matikainen, T.; Dunkel, L. Effects of Testosterone, Dihydrotestosterone, and 17-Estradiol on Human Ovarian Tissue Survival in Culture. Fertil. Steril. 2004, 82, 1078–1085. [Google Scholar] [CrossRef]
- Adefris, M.; Fekadu, E. Postmenopausal Mild Hirsutism and Hyperandrogenemia Due to Granulosa Cell Tumor of the Ovary: A Case Report. J. Med. Case Rep. 2017, 11, 242. [Google Scholar] [CrossRef]
- Jiang, Z.; Qiu, Y.; Hu, S.; Li, Y.; Chen, X.; Jin, Y.; Dai, H. Testosterone Elevation in Ovarian Adult Granulosa Cell Tumor: A Case Report and Review of the Literature. Medicine 2023, 102, E33763. [Google Scholar] [CrossRef] [PubMed]
- Šepić, T.S.; Severinski, N.S.; Eminović, S.; Badovinac, A.R.; Višnić, A. Complete Restoration of Fertility in a Patient Treated for Androgensecreting Granulosa Cell Tumor-Case Report. JBRA Assist. Reprod. 2023, 27, 747–751. [Google Scholar] [CrossRef]
- Rajamani, K.; Moore, R.G.; Stanard, S.M.; Astapova, O. Testosterone-Secreting Endometrioid Ovarian Carcinoma Presenting With Hyperandrogenism. AACE Clin. Case Rep. 2022, 8, 135–138. [Google Scholar] [CrossRef]
- Uhlenhaut, N.H.; Jakob, S.; Anlag, K.; Eisenberger, T.; Sekido, R.; Kress, J.; Treier, A.C.; Klugmann, C.; Klasen, C.; Holter, N.I.; et al. Somatic Sex Reprogramming of Adult Ovaries to Testes by FOXL2 Ablation. Cell 2009, 139, 1130–1142. [Google Scholar] [CrossRef]
- Butler, L.M.; Centenera, M.M.; Swinnen, J.V. Androgen Control of Lipid Metabolism in Prostate Cancer: Novel Insights and Future Applications. Endocr.-Relat. Cancer 2016, 23, R219–R227. [Google Scholar] [CrossRef]
- Majumder, A.; Singh, M.; Tyagi, S.C. Post-Menopausal Breast Cancer: From Estrogen to Androgen Receptor. Oncotarget 2017, 8, 102739–102758. [Google Scholar] [CrossRef] [PubMed]
- Wu, Y.; Vadgama, J.V. Androgen Receptor as a Potential Target for Treatment of Breast Cancer. Int. J. Cancer Res. Mol. Mech. 2017, 3. [Google Scholar] [CrossRef]
- Jakimiuk, A.J.; Weitsman, S.R.; Magoffin, D.A. 5-Reductase Activity in Women with Polycystic Ovary Syndrome. J. Clin. Endocrinol. Metab. 1999, 84, 2414–2418. [Google Scholar] [CrossRef] [PubMed]
- Swinnent, J.V.; Van Veldhoven, P.P.; Esquenet, M.; Heyns, W.; Verhoeven, G. Androgens Markedly Stimulate the Accumulation of Neutral Lipids in the Human Prostatic Adenocarcinoma Cell Line LNCaP. Endocrinology 1996, 137, 4468–4474. [Google Scholar] [CrossRef]
- Tousignant, K.D.; Rockstroh, A.; Fard, A.T.; Lehman, M.L.; Wang, C.; McPherson, S.J.; Philp, L.K.; Bartonicek, N.; Dinger, M.E.; Nelson, C.C.; et al. Lipid Uptake Is an Androgen-Enhanced Lipid Supply Pathway Associated with Prostate Cancer Disease Progression and Bone Metastasis. Mol. Cancer Res. 2019, 17, 1166–1179. [Google Scholar] [CrossRef]
- Cardoso, H.J.; Figueira, M.I.; Carvalho, T.M.A.; Serra, C.D.M.; Vaz, C.V.; Madureira, P.A.; Socorro, S. Androgens and Low Density Lipoprotein-Cholesterol Interplay in Modulating Prostate Cancer Cell Fate and Metabolism. Pathol. Res. Pract. 2022, 240, 154181. [Google Scholar] [CrossRef] [PubMed]
- Doblado, M.; Zhang, L.; Toloubeydokhti, T.; Garzo, G.T.; Chang, R.J.; Duleba, A.J. Androgens Modulate Rat Granulosa Cell Steroidogenesis. Reprod. Sci. 2020, 27, 1002–1007. [Google Scholar] [CrossRef] [PubMed]
- Dinicola, S.; Unfer, V.; Soulage, C.O.; Yap-Garcia, M.I.M.; Bevilacqua, A.; Benvenga, S.; Barbaro, D.; Wdowiak, A.; Nordio, M.; Dewailly, D.; et al. D-Chiro-Inositol in Clinical Practice: A Perspective from the Experts Group on Inositol in Basic and Clinical Research (EGOI). Gynecol. Obstet. Investig. 2024, 89, 284–294. [Google Scholar] [CrossRef]
- Fatima, K.; Jamil, Z.; Faheem, S.; Adnan, A.; Javaid, S.S.; Naeem, H.; Mohiuddin, N.; Sajid, A.; Ochani, S. Effects of Myo-Inositol vs. Metformin on Hormonal and Metabolic Parameters in Women with PCOS: A Meta-Analysis. Ir. J. Med. Sci. 2023, 192, 2801–2808. [Google Scholar] [CrossRef]
- Motuhifonua, S.K.; Lin, L.; Alsweiler, J.; Crawford, T.J.; Crowther, C.A. Antenatal Dietary Supplementation with Myo-Inositol for Preventing Gestational Diabetes. Cochrane Database Syst. Rev. 2023, 2, CD011507. [Google Scholar] [CrossRef]
- Fedeli, V.; Catizone, A.; Querqui, A.; Unfer, V.; Bizzarri, M. The Role of Inositols in the Hyperandrogenic Phenotypes of PCOS: A Re-Reading of Larner’s Results. Int. J. Mol. Sci. 2023, 24, 6296. [Google Scholar] [CrossRef]
- Monastra, G.; Vazquez-Levin, M.; Bezerra Espinola, M.S.; Bilotta, G.; Laganà, A.S.; Unfer, V. D-Chiro-Inositol, an Aromatase down-Modulator, Increases Androgens and Reduces Estrogens in Male Volunteers: A Pilot Study. Basic Clin. Androl. 2021, 31, 13. [Google Scholar] [CrossRef] [PubMed]
- Jamieson, S.; Butzow, R.; Andersson, N.; Alexiadis, M.; Unkila-Kallio, L.; Heikinheimo, M.; Fuller, P.J.; Anttonen, M. The FOXL2 C134W Mutation Is Characteristic of Adult Granulosa Cell Tumors of the Ovary. Mod. Pathol. 2010, 23, 1477–1485. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Gogola, J.; Hoffmann, M.; Ptak, A. Persistent Endocrine-Disrupting Chemicals Found in Human Follicular Fluid Stimulate the Proliferation of Granulosa Tumor Spheroids via GPR30 and IGF1R but Not via the Classic Estrogen Receptors. Chemosphere 2019, 217, 100–110. [Google Scholar] [CrossRef]







| Gene | SYBR Green Primers | TaqMan Primers |
|---|---|---|
| StAR | R-5′tgcgctggcagtacatgtg3′; F-5′gctgcttgttctgtggtgttg3′ | Hs00986559_g1 |
| CYP11A1 | R-5′ccctctcctggtgacaatgg3′; F-5′tgacataaaccgactccacgtt3′ | Hs00167984_m1 |
| CYP19A1 | R-5′gatagcagaaaaaagacgcaggat3′;F-5′ttagggtgctttgcaatgagaa3′ | Hs00903411_m1 |
| β-actin | R-5′tcctccctggagaagagct3′; F-5′tttcgtggatgccacaggat3′ | - |
| 3βHSD | - | Hs04194787_g1 |
| AR | - | Hs00171172_m1 |
| SRD5A1 | - | Hs00971645_g1 |
| GAPDH | - | 4310884E |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wojciechowska, A.M.; Zając, P.; Gogola-Mruk, J.; Kowalik, M.K.; Ptak, A. Myo-Inositol and D-Chiro-Inositol Reduce DHT-Stimulated Changes in the Steroidogenic Activity of Adult Granulosa Cell Tumors. Int. J. Mol. Sci. 2024, 25, 10974. https://doi.org/10.3390/ijms252010974
Wojciechowska AM, Zając P, Gogola-Mruk J, Kowalik MK, Ptak A. Myo-Inositol and D-Chiro-Inositol Reduce DHT-Stimulated Changes in the Steroidogenic Activity of Adult Granulosa Cell Tumors. International Journal of Molecular Sciences. 2024; 25(20):10974. https://doi.org/10.3390/ijms252010974
Chicago/Turabian StyleWojciechowska, Anna Maria, Paulina Zając, Justyna Gogola-Mruk, Magdalena Karolina Kowalik, and Anna Ptak. 2024. "Myo-Inositol and D-Chiro-Inositol Reduce DHT-Stimulated Changes in the Steroidogenic Activity of Adult Granulosa Cell Tumors" International Journal of Molecular Sciences 25, no. 20: 10974. https://doi.org/10.3390/ijms252010974
APA StyleWojciechowska, A. M., Zając, P., Gogola-Mruk, J., Kowalik, M. K., & Ptak, A. (2024). Myo-Inositol and D-Chiro-Inositol Reduce DHT-Stimulated Changes in the Steroidogenic Activity of Adult Granulosa Cell Tumors. International Journal of Molecular Sciences, 25(20), 10974. https://doi.org/10.3390/ijms252010974

