Next Article in Journal
NK Cell Degranulation Triggered by Rituximab Identifies Potential Markers of Subpopulations with Enhanced Cytotoxicity toward Malignant B Cells
Next Article in Special Issue
Withania somnifera and Chrysanthemum zawadskii Herbich var. latilobum (Maxim.) Kitamura Complex Attenuates Obesity in High-Fat-Diet-Induced Obese Mice
Previous Article in Journal
Impact of Eccentric Exercise Interventions with Small and Large Ranges of Motion on Rat Skeletal Muscle Tissue and Muscle Force Production
Previous Article in Special Issue
Anti-Obesity Effects of GABA in C57BL/6J Mice with High-Fat Diet-Induced Obesity and 3T3-L1 Adipocytes
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Capsaicin Reduces Obesity by Reducing Chronic Low-Grade Inflammation

College of Animal and Veterinary Sciences, Southwest Minzu University, Chengdu 610041, China
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2024, 25(16), 8979; https://doi.org/10.3390/ijms25168979
Submission received: 17 July 2024 / Revised: 10 August 2024 / Accepted: 16 August 2024 / Published: 18 August 2024

Abstract

Chronic low-grade inflammation (CLGI) is associated with obesity and is one of its pathogenetic mechanisms. Lipopolysaccharide (LPS), a component of Gram-negative bacterial cell walls, is the principal cause of CLGI. Studies have found that capsaicin significantly reduces the relative abundance of LPS-producing bacteria. In the present study, TRPV1-knockout (TRPV1−/−) C57BL/6J mice and the intestinal epithelial cell line Caco-2 (TRPV1−/−) were used as models to determine the effect of capsaicin on CLGI and elucidate the mechanism by which it mediates weight loss in vivo and in vitro. We found that the intragastric administration of capsaicin significantly blunted increases in body weight, food intake, blood lipid, and blood glucose in TRPV1−/− mice fed a high-fat diet, suggesting an anti-obesity effect of capsaicin. Capsaicin reduced LPS levels in the intestine by reducing the relative abundance of Proteobacteria such as Helicobacter, Desulfovibrio, and Sutterella. Toll-like receptor 4 (TLR4) levels decreased following decreases in LPS levels. Then, the local inflammation of the intestine was reduced by reducing the expression of tumor necrosis factor (TNF)-α and interleukin (IL)-6 mediated by TLR4. Attenuating local intestinal inflammation led to the increased expression of tight junction proteins zonula occludens 1 (ZO-1) and occludin and the restoration of the intestinal barrier function. Capsaicin increased the expression of ZO-1 and occludin at the transcriptional and translational levels, thereby increasing trans-endothelial electrical resistance and restoring intestinal barrier function. The restoration of intestinal barrier function decreases intestinal permeability, which reduces the concentration of LPS entering the circulation, and reduced endotoxemia leads to decreased serum concentrations of inflammatory cytokines such as TNF-α and IL-6, thereby attenuating CLGI. This study sheds light on the anti-obesity effect of capsaicin and its mechanism by reducing CLGI, increasing our understanding of the anti-obesity effects of capsaicin. It has been confirmed that capsaicin can stimulate the expression of intestinal transmembrane protein ZO-1 and cytoplasmic protein occludin, increase the trans-epithelial electrical resistance value, and repair intestinal barrier function.

1. Introduction

Obesity has become one of the most significant health problems worldwide; its incidence worldwide is increasing yearly [1]. Various chronic diseases induced by obesity threaten public health and impose heavy economic burdens on society [2]. Obesity is influenced by various factors, including traditional ones such as energy balance and genetic predispositions and environmental factors like dietary and exercise habits. Recent studies have also linked obesity to molecular-level factors, including alterations in gut microbiota, short-chain fatty acids, neurohumoral regulatory systems, localized inflammation in intestinal or adipose tissue, and systemic inflammatory responses [3]. Several lines of evidence suggest that chronic low-grade inflammation (CLGI) is associated with obesity [4,5]. Lipopolysaccharide (LPS) is a component of the cell wall of Gram-negative bacteria and is the main pro-inflammatory component of bacteria. Studies have reported that obesity and related diseases caused by Western high-calorie diets might be caused by increased systemic LPS concentrations (i.e., endotoxemia) [6,7]. LPS-induced endotoxemia has been demonstrated to be the primary mechanism of CLGI [8]. These findings suggest that increased numbers of Gram-negative bacteria in the intestine will cause CLGI and lead to obesity. Proteobacteria is the largest phylum of bacteria, and all bacteria in the phylum are Gram-negative. The relative abundance of Proteobacteria in the gastrointestinal tract of healthy people is between 2% and 5%; in individuals with obesity, metabolic disorder, or intestinal inflammation, the relative abundance is as high as 15% [9]. As a component of the Gram-negative bacterial cell wall, the concentration of LPS increases with the relative abundance of Proteobacteria. Studies have shown that the increased abundance of Proteobacteria in the intestinal flora activates immune signaling pathways, leading to CLGI [10], suggesting that the abundance of Proteobacteria in the intestine may substantially impact metabolism and may be a risk factor for obesity. Previous studies found a high-fat diet-induced increase in the number of Escherichia, Helicobacter, Desulfovibrio, and Sutterella bacteria in Proteobacteria in the intestinal of mice, while capsaicin significantly reduced their relative abundance [11]. For these reasons, we hypothesized that capsaicin would mediate weight loss by reducing CLGI.
The intestinal barrier is critically involved in the development of CLGI. In a study of capsaicin reducing CLGI function, Kang et al. found that capsaicin significantly increased the mRNA expression of occludens 1 (ZO-1) and occludin gene [12]. Wang et al. studied the effects of Galactooligosaccharide on repairing intestinal barrier function and promoting the expression of occludin, claudin-1, and ZO-1 gene [13]. Wang et al. found that paeoniflorin inhibited the ability of LPS to damage intestinal barrier function and increased the expression of occludin, claudin-5, and ZO-1 gene to mediate repair of the intestinal barrier [14]. In a study of the effect of Bifidobacteria on intestinal function, Zhao et al. obtained similar results [15]. Nevertheless, the ability of capsaicin to repair intestinal barrier function requires more experimental support. We performed the present study to investigate whether repair may be one of the mechanisms by which capsaicin reduces CLGI and achieves weight loss.
Capsaicin, a vanillamide alkaloid derived from chili peppers, is characterized by a strong irritant odor [16]. Modern pharmacological studies have demonstrated that capsaicin possesses multiple therapeutic effects, including anti-itch and analgesic properties, weight loss and lipid regulation, anticancer activities, antibacterial effects, blood pressure reduction, endocrine system regulation, and the protection of cardiovascular, cerebrovascular, and digestive systems. Consequently, capsaicin has potential applications in treating conditions such as neuropathic pain, arthritis, obesity, diabetes, and cancer [17]. Capsaicin has an anti-obesity effect, and the mechanisms of this effect, which are mainly through activation of the transient receptor potential vanilloid-1 (TRPV1) channel, have been extensively studied in both rodents and other species [18]. Our previous study found that capsaicin still has an anti-obesity effect without TRPV1 cation channel activation. Therefore, the anti-obesity effect of capsaicin may involve an alternative mechanism, needing further studies. At the same time, the effect trend of capsaicin on the composition of the gut microbiota of C57BL/6J mice and TRPV1-knockout (TRPV1−/−) C57BL/6J mice was also consistent. This study aims to verify the effects of capsaicin on CLGI both in vivo and in vitro and to elucidate the mechanism by which capsaicin mediates weight loss independently of TRPV1 cationic channel activation, thereby further enriching the understanding of capsaicin’s weight-loss effects.

2. Results

2.1. Effects of Capsaicin on Body Weight and Food Intake

As shown in Table 1, after 12 weeks, the weight of mice in the HFD group (feed with high-fat diet) increased by 19.16 ± 0.63 g, significantly higher than that of the mice in the SLD group (feed with standard lipid diet) (p < 0.05). The weight of mice fed with HFD increased significantly, indicating that the obesity model was successfully established. Capsaicin significantly inhibited HFD-induced weight gain (p < 0.05). Body weights in the HFDC group (fed with a high-fat diet and capsaicin) increased by 13.43 ± 1.52 g, significantly lower than that of the HFD group, suggesting that capsaicin inhibited weight gain. The average weekly food intake was lower in the HFDC group than in the HFD group. After 12 weeks, the total food intake of the HFDC group was significantly lower than that of the HFD group (p < 0.05), suggesting that capsaicin inhibited food intake.

2.2. Effect of Capsaicin on Serum Biochemical Indices

The effects of capsaicin on serum biochemical indicators are shown in Figure 1. Levels of fasting blood glucose, triglycerides, total cholesterol, low-density cholesterol, and insulin in the HFD group were significantly higher than those in the SLD group (p < 0.05). Capsaicin significantly inhibited the HFD-induced increases in blood lipids and glucose. Compared with the HFD group, the mice of the HFDC group had 30% lower fasting blood glucose levels and 20% lower insulin levels. Triglyceride and cholesterol levels were also significantly lower than those of the HFD group (p < 0.05), suggesting that capsaicin has a lipid-lowering effect. There were no significant differences in triglyceride, total cholesterol, or low-density lipoprotein cholesterol levels between the HFDC and SLD groups (p > 0.05).

2.3. Effect of Capsaicin on Oral Glucose Tolerance in Mice

The oral glucose tolerance test was performed in the 11th week. Glucose tolerance was obtained by calculating the area under the curve (AUC) generated by blood glucose levels from 0 to 120 min. In the HFD group, which was fed a high-fat diet, blood glucose levels were higher than those of SLD mice between 15 and 120 min (Figure 2A). Capsaicin significantly inhibited the HFD-induced increase in AUC (Figure 2B), and the AUC of the HFDC group was 14% lower than the HFD group (p < 0.05), suggesting that capsaicin significantly reduced blood glucose levels in obese mice.

2.4. Effect of Capsaicin on Proteobacteria

The relative abundances of Helicobacter, Desulfovibrio, and Sutterella in fecal samples of the mice in each group were quantified using quantitative fluorescence PCR (Figure 3). These relative abundances in the HFD group were significantly higher than those of the SLD group (p < 0.05), and capsaicin significantly reduced these abundances, suggesting that capsaicin decreased abundance of Proteobacteria induced by HFD.

2.5. Changes in LPS Levels in the Intestine

Toll-like receptor 4(TLR4) is a specific receptor for LPS. TLR4 gene expression increases with the increase in LPS concentration in the intestine. The results of mRNA expression of TLR4 gene in intestinal tissue are shown in Figure 4. mRNA expression of TLR4 gene in the intestinal tract of mice in the HFD group was significantly higher than that of the SLD group, suggesting that the HFD led to an increase in the number of LPS-producing bacteria and increased the concentrations of LPS in the intestine. The mRNA expression of TLR4 gene increased correspondingly. The mRNA expression of TLR4 gene in the HFDC group was significantly lower than that of the HFD group, suggesting that capsaicin reduced the relative abundance of LPS-producing bacteria in the intestine, thereby reducing the production of LPS and the mRNA expression of TLR4 gene.

2.6. Effect of Capsaicin on Local LPS-Induced Inflammatory Responses

The effect of capsaicin on local inflammation induced by LPS in vivo was evaluated by measuring the mRNA expression and concentrations of tumor necrosis factor (TNF)-α and interleukin (IL)-6 in intestinal tissues and histopathological sections. As shown in Figure 5, pathological sections of intestinal tissue showed that the villus lengths of the duodenum, jejunum, and ileum of mice in the HFD group became shorter, and the recess depth became deeper, resulting in significantly lower villus gland ratios than in the SLD group (p < 0.05) (Figure 6). As shown in Figure 7, the mRNA expression of TNF-α and IL-6 gene in the intestine of the HFD group was significantly higher than that of the control group (p < 0.05), and their concentrations in tissues were also significantly higher (p < 0.05), suggesting that HFD aggravates local intestinal inflammation. Compared with the HFD group, the mRNA expression of TNF-α and IL-6 gene and their concentrations in intestinal tissue of the HFDC group were significantly lower (p < 0.05). Histopathology showed that intestinal lesions in the HFDC group were milder than those in the HFD group. The villus gland ratio was significantly greater (p < 0.05), suggesting that the local intestinal inflammatory response in the intestine of the mice was attenuated after feeding with capsaicin.
The effect of capsaicin on LPS-induced local inflammation in vitro was evaluated by measuring the mRNA expression and concentrations of TLR4, TNF-α, and IL-6 in Caco-2 (TRPV1−/−) cells. As shown in Figure 8, in vitro tests revealed that there was no significant difference in mRNA expression of TLR4, TNF-α, or IL-6 gene in the cells of LPS and LPSC groups (p > 0.05), and there were no significant differences levels of TNF-α or IL-6 gene (p > 0.05) in the supernatants of cell culture medium. However, the mRNA expression of TLR4, TNF-α, and IL-6 gene and the concentration in the supernatants of the two groups were significantly higher than those of the control group (p < 0.05), suggesting that LPS caused local inflammatory responses in the Caco-2 (TRPV1−/−) cell model and that the inflammatory response model was established. Capsaicin did not affect the local inflammatory response in the Caco-2 (TRPV1−/−) cells.

2.7. Effect of Capsaicin on Intestinal Barrier Function

Transmembrane protein occludin and cytoplasmic protein ZO-1 are essential for maintaining the barrier function of epithelia. The detrimental impact of LPS on the intestinal barrier function has been well established. To investigate the effect of capsaicin on this function, an in vitro intestinal epithelial cell layer formed by Caco-2 (TRPV1−/−) cells was treated with LPS, and the integrity of the Caco-2 (TRPV1−/−) cell monolayer was assessed using the Trans-epithelial electrical resistance (TEER) method. The TEER values decreased significantly after 24 h of LPS treatment. Therefore, to determine whether the repair effect of capsaicin on the intestinal barrier was related to occludin and ZO-1, we measured mRNA and protein levels of occludin and ZO-1 in cells in vitro and small intestine tissues in vivo. As shown in Figure 9 and Figure 10, in intestinal tissues and cells, respectively, mRNA and protein levels of occludin and ZO-1 in the HFD and LPS groups (respectively) were significantly lower than those of the SLD or control group, suggesting that the damage of LPS to intestinal barrier function was achieved by destroying occludin and ZO-1. The mRNA and protein expressions of occludin and ZO-1 in the HFDC and LPSC groups treated with capsaicin were significantly higher than those in the HFD and LPS groups, suggesting that capsaicin repairs the intestinal barrier function by upregulating the expression of occludin and ZO-1.
LPS-mediated damage to intestinal barrier function has been confirmed. To study the effect of capsaicin on intestinal barrier function, intestinal epithelial cell layers formed by Caco-2 (TRPV1−/−) cells in vitro were treated with LPS. To evaluate the cell barrier effect, the monolayer integrity of Caco-2 (TRPV1−/−) cells was determined using the TEER method. TEER was measured at 3, 6, 12, 18, and 24 h after adding LPS and capsaicin. As shown in Figure 11, the TEER value of the LPS group decreased over time, and there was a significant decrease after 6 h (p < 0.05) to nearly 50% after 24 h, suggesting a destructive effect of LPS on the cell layer. Capsaicin significantly inhibited the effect of LPS. The TEER value of the LPSC group decreased less than that of the LPS group. After 12 h, there was a significant difference between the LPS and LPSC groups (p < 0.05). After 24 h, the TEER value of LPS groups was nearly 50% less than that of the LPSC group, suggesting that capsaicin reduced intestinal epithelial permeability and repaired the intestinal barrier.

2.8. Effects of Capsaicin on Systemic Endotoxemia and Inflammatory Response

The damage to intestinal barrier function leads to LPS entering the systemic circulation, resulting in endotoxemia, which leads to systemic inflammation. To study the effects of capsaicin on endotoxemia and systemic inflammation, we measured serum levels of LPS, TNF-α, and IL-6. As shown in Figure 12, serum levels of LPS, TNF- α, and IL-6 in the HFD group were significantly higher than those of the SLD group, suggesting that the HFD led to an increase in the number of LPS-producing bacteria in the intestine, thereby causing an increase in LPS level. In the HFDC group, the concentrations of LPS, TNF-α, and IL-6 were significantly lower than those in the HFD group, suggesting that capsaicin reduced the relative abundance of LPS-producing bacteria in the intestine, attenuating the damage to the intestinal barrier. The concentration of LPS entering the circulation was ultimately reduced, secondary endotoxemia was inhibited, and CLGI was ultimately reduced.

3. Discussion

We showed that capsaicin significantly reduced body weight, food intake, triglyceride, cholesterol, fasting blood glucose, glucose tolerance, and insulin levels in TRPV1−/− mice fed an HFD. These results agree with our previous study [11], confirming that capsaicin lowers lipid levels without TRPV1 cation channel activation. We also quantified Proteobacteria in fecal samples using fluorescent PCR methods. We found that the relative abundances of Helicobacter, Desulfovibrio, and Sutterella in the HFDC group were significantly lower than in the HFD group, and the capsaicin-induced trend of Proteobacteria in the intestine also agreed with our previous results [11]. These findings suggest that capsaicin reduces the abundance of Proteobacteria.
CLGI is a significant cause of obesity [4,5], and LPS endotoxemia is a primary mechanism of CLGI. The increase in LPS concentration in the intestine leads to local inflammation of intestinal epithelial cells, damaging the intestinal barrier function. LPS then passes through the intestinal barrier and enters the systemic circulation, causing endotoxemia. Endotoxemia triggers the innate immune system to release large amounts of inflammatory cytokines, resulting in CLGI throughout the body, which ultimately contributes to obesity, an inflammatory response in itself [8].
TLR4 is a pattern-recognition receptor for LPS. The binding of LPS to TLR4 results in the release of inflammatory cytokines and local intestinal inflammation [19]. Increased LPS concentrations in the intestines of obesity-prone rats coincided with the increase in TLR4 expression. However, TLR4 was not expressed in the intestine of non-obese rats [8]. In the present study, the mRNA expression of TLR4 gene in the intestinal tract of the HFDC group was significantly lower than that of the HFD group, and the expression of TLR4 gene positively correlated with LPS levels, suggesting that the concentration of LPS in the intestinal tract of the HFDC group decreased significantly and was consistent with the quantitative detection of Proteobacteria. Bacteria of the phylum Proteobacteria are Gram-negative and produce large amounts of LPS in the intestine. The decrease in its relative abundance likely results in decreased LPS concentrations in the intestine.
LPS plays an essential role in intestinal and systemic inflammation [20]. Jamar et al. found that the concentration of LPS increased, and TLR4 in the intestine was activated in mice fed with Western-style HFD, leading to the release of inflammatory cytokines (TNF-α, IL-6, IL-10, and IL-1 β) and ultimately to local intestinal inflammation [21]. In the present study, mRNA expression levels and concentrations of TNF-α and IL-6 in the intestinal tissue of the HFDC group were significantly lower than those of the HFD group. The pathological changes in the intestinal tissue in the HFDC group were also less than those in the HFD group, suggesting that capsaicin reduced local intestinal inflammation in the HFDC group. We found that the mRNA expression levels of TNF-α and IL-6 gene and their concentrations in intestinal tissue of mice in the HFD group were significantly higher than those of the SLD group, suggesting that HFD leads to an increase in the number of LPS-producing bacteria in the intestine, thereby causing increased LPS concentrations and local inflammation. Our findings suggest that capsaicin reduces the concentration of LPS in the intestine by reducing the number of LPS-producing bacteria and weakening the local inflammatory response.
Other studies showed that capsaicin inhibited the LPS-induced release of inflammatory cytokines, including TNF-α, IL-6, IL-10, and IL-1 β [22,23,24]. Tang et al. found that capsaicin inhibited LPS-induced inflammatory cytokine release by upregulating the human liver X receptor Alpha [25]. Takeshi et al. found that capsaicin treated chronic gastritis induced by Helicobacter in Mongolian gerbils [26]. The study of the mechanism found that the TRPV1 receptor plays a substantial role [24,27,28,29,30]. In contrast, in vitro experiments showed that the mRNA expression of TLR4, TNF-α, and IL-6 gene in the cells of the LPSC group was not significantly different from those of the LPS group, and levels of TNF-α and IL-6 in cell supernatants were not significantly different from those of the LPS group but were significantly higher than those of the control group. These findings suggest that the inhibition of local inflammation by capsaicin in intestinal tissue, as in other tissue, depends on the TRPV1 receptor. The cells used in our study were TRPV1-deletion strains, which explains why the in vitro experiments did not appear to demonstrate inhibition of inflammatory cytokines. We found that the mRNA expression of TLR4, TNF-α, and IL-6 gene and the concentrations of TNF-α and IL-6 in the intestinal tissue of the HFDC group of TRPV1-deletion mice were significantly lower than those of the HFD group, which was attributed to the reduction in the number of LPS-producing bacteria in the intestinal tract by capsaicin, thereby reducing the local inflammatory response caused by LPS. The inhibitory effect of capsaicin on inflammatory factors through the TRPV1 receptor was not involved.
Intestinal epithelial cells (IECs) form tight junctions (TJs) at the apical side of the intestinal epithelium. TJ proteins are the most critical intercellular junctions in the junctional multiprotein complex [31]. These proteins seal off paracellular gaps between adjacent IECs to form a selectively permeable intercellular barrier that regulates molecular paracellular movement between the intestinal lumen and the subepithelial tissue. The formation of functional TJs is essential for maintaining intestinal permeability and intestinal barrier function [32,33]. Physiological functions of the TJ are maintained by ZO-1, occludin, and claudins. Studies have shown that the upregulation of ZO-1 and occludin inhibits increases in intestinal permeability [34]. The prevention of the destruction of ZO-1 and occludin is essential for the maintenance of intestinal barrier function [35,36]. Local inflammation increases intestinal permeability by destroying the TJs formed by the interaction between the transmembrane protein occludin and the cytoplasmic protein ZO-1 [6,7]. The present study showed that the mRNA and protein expressions of ZO-1 and occludin gene were significantly higher in the HFDC group than the HFD group but lower than in the SLD group. This finding suggests that the HFDC group’s barrier function is less impaired than that of the HFD group, which is consistent with the results of Kang et al. and Santos et al. concerning the repairment of the intestinal barrier function by capsaicin [12,37]. Our findings suggest that capsaicin reduces the concentration of LPS in the intestine by reducing the number of LPS-producing bacteria, thereby reducing the damage to the intestinal barrier function while increasing the mRNA and protein expression levels of ZO-1 and occludin. The same results were obtained in a study of substances that repair the intestinal barrier function, including Bifidobacterium, paeoniflorin, and Galactooligosaccharide [13,14,15]. Our in vitro experiments showed that, at the same concentration of LPS, the mRNA and protein expressions of ZO-1 and occludin in the LPSC group supplemented with capsaicin were significantly higher than those of the control group, suggesting that capsaicin mediates the repair of intestinal barrier function. This may be attributed to capsaicin’s ability to repair intestinal barrier function, thereby reducing lipid absorption in the intestine and causing blood lipid levels in the HFDC group to return to normal levels similar to those in the SLD group.
TEER measures the information of the ion current resistance of monolayer cells, which is directly related to the integrity of intercellular TJs [38]. Higher TEER values suggest more complete monolayers and lower permeability, representing the integrity of the barrier function. In the present study, we measured the restoration of the intestinal barrier function by capsaicin by measuring TEER. We found that at the same concentration of LPS, the TEER value of the LPS group decreased significantly, suggesting that the model can be used as the control group. The TEER value of the LPSC group was significantly higher than that of the LPS group, and the permeability decreased, further suggesting the reparative effect of capsaicin on intestinal barrier function. This result is consistent with the decrease in the LPS concentration in blood and the attenuation of endotoxemia in vivo.
The impairment of intestinal barrier function leads to the entry of LPS into the systemic circulation through the damaged intestinal epithelium, i.e., endotoxemia [7,21]. Endotoxemia activates the innate immune system to synthesize and release large amounts of inflammatory cytokines [39]. The levels of LPS, TNF-α, and IL-6 in the blood of mice in the HFD group were significantly higher than those in the SLD group, while levels in the HFDC group were significantly lower than those in the HFD group but higher than those of the SLD group. This finding suggests that capsaicin reduces LPS levels, endotoxemia, and, therefore, systemic CLGI. Although the result is consistent with the conclusion of Kang et al., they showed that bacteria from the S24-7 family were responsible for increasing the LPS concentration in mice fed an HFD, which induced CLGI [12], while we showed that Proteobacteria cause CLGI. S24-7 are members of the phylum Bacteroidetes; a higher relative abundance of the Bacteroides may benefit obese people [40]. Other studies showed that S24-7 has therapeutic effects on glucose intolerance and obesity [41,42]. CLGI caused by the phylum Proteobacteria has also been demonstrated [43,44,45].

4. Materials and Methods

4.1. Materials

Capsaicin (M2028, ≥95%) and LPS (L2880) were purchased from Sigma-Aldrich, Inc. (St. Louis, MO, USA). A standard lipid diet (SLD, D12450B, 10% calories as fat) and a high-fat diet (HFD, D12492, 60% calories as fat) were purchased from Research Diets (New Brunswick, NJ, USA). All other reagents were of the highest commercially available grade.

4.2. Animals and Experimental Design

Eight-week-old female B6.129X1-Trpv1tm1Jul/J (TRPV1−/−) mice were housed under standard conditions (temperature, 22 ± 2 °C; humidity, 55 ± 5%), with free access to food and water and a 12 h light/dark cycle. After a 1-week acclimation and feeding of an SLD for 2 weeks, TRPV1−/− mice were randomly divided into three groups (n = 10 each): the SLD group (feed with SLD), the HFD group (feed with HFD), and the HFDC group (feed with HFD and capsaicin), with one mouse per cage. Each mouse in the HFDC group was intragastrically fed capsaicin 2 mg/kg body mass capsaicin dissolved in 0.9% saline containing 3% ethanol and 10% Tween-80 on alternate days, and SLD and HFD group mice were given the corresponding vehicle for 12 weeks.
The three days before the end of the experiment, fresh feces from each mouse were collected and mixed for three consecutive days, then stored at −80 °C until use. The day before the end of the experiment, the mice in each group were fasted for 12 h and then sacrificed after CO2 anesthesia. Fresh blood was anticoagulated with EDTA and subsequently used for serum preparation. The serum was packaged and freezing at −80 °C. Two centimeters of each mouse’s duodenum, jejunum, and ileum were collected and stored in liquid nitrogen.
The human colon adenocarcinoma cell line Caco-2 (TRPV1−/−) with TRPV1 knockout and the same proliferation rate as wild-type Caco-2 cells (HTB-37, purchased from ATCC at cell passages of 50 to 60) was generated using CRISPR-Cas9 genome-editing technology [46]. The resuscitation, passage, and subculture of cells were carried out according to conditions recommended by ATCC. The number and the viability of the cells in suspension were measured using a cell viability detector. The suspensions were diluted proportionally with fresh DMEM culture medium (with 10% fetal bovine serum) at 5 × 105 cells/mL and then inoculated into 6-well cell culture plates. Then, 2.5 mL of cell suspensions were inoculated per well and incubated at 37 °C and 5% CO2 for static culture. When cell growth reached 80–90% confluence, the cells were divided into six groups of 6-well cells each. Groups one and two were the control groups, which received fresh DMEM (The concentration of DMSO was the same as that of LPSC group). Groups three and four were the LPS groups, which received 1 μg/mL LPS in DMEM (the concentration of DMSO was the same as that of the LPSC group). Groups five and six were the LPSC groups, which received DMEM with 1 μg/mL LPS and 75 μM capsaicin (30.5 mg capsaicin dissolved in 1 mL DMSO solution, prepare a 0.1 M solution). The concentration of capsaicin was determined according to the Cell Counting Kit-8 (Tongren Chemistry Co., Ltd., Kumamoto, Japan), and 75 μM was the maximum concentration of capsaicin with the lowest cytotoxicity to Caco-2 (TRPV1−/−) cells. The cells were mixed gently and cultured at 37 °C and 5% CO2. After 24 h of culture, the medium was removed for later assay. The plates were placed on ice and rinsed with 2 mL of pre-cooled phosphate-buffered saline (PBS). After removing PBS, the first, third, and fifth groups were given 1 mL of pre-cooled RNA extraction reagent (TRI Reagent) to extract RNA for the quantitative determination of mRNA. The second, fourth, and sixth groups were treated with 200 μL pre-cooled SD001 lysate to extract protein for western blotting.

4.3. Detection of Biochemical Indicators

Serum triglycerides, blood glucose, cholesterol, low-density cholesterol, high-density cholesterol, and other biochemical indicators were determined using a BS-200 automatic biochemical analyzer (Shenzhen Mindray Medical, Shenzhen, China). Serum insulin concentrations were measured using a mouse insulin ELISA kit (Mercodia, Uppsala, Sweden).

4.4. Glucose Tolerance Tests

After 11 weeks of treatment, mice were fasted overnight (9 h). They were then gavaged with 1 g/kg body mass D-glucose solution, and their blood glucose concentrations were measured with a glucometer (ACCU-CHEK Aviva meter, Roche, Cupertino, CA, USA) at 0, 15, 30, 60, and 120 min.

4.5. Quantitative PCR Detection

We used 200 mg of fecal samples to extract total DNA. Briefly, after adding 20 μL RNase A (10 mg/mL), the samples were incubated at 37 °C for 20 min to remove RNA. The purity and concentration of the extracted total DNA were measured on a Nanodrop ND-2000 instrument. The standard of the purity determination is that the OD260/280 value should be between 1.8 and 2.0, and the concentration of the sample was diluted to 20 ng/μL. According to the primers, probes, reaction system, and conditions reported in the literature (Table 2), the contents of Helicobacter, Desulfovibrio, and Sutterella in the feces of mice in each group were measured using quantitative fluorescence PCR [47,48,49]. The changes in the relative amounts of Proteobacteria in the HFD and HFDC groups were measured with reference to the value of mice in the SLD group.

4.6. Detection of Endotoxin

The anticoagulated blood samples were centrifuged at 1000 rpm for 15 min, and the supernatants were removed to measure LPS concentrations. The method was carried out according to the instructions of the endotoxin test kit (ToxinsensorTM chromogenic LAL endotoxin assay kit).

4.7. Detection of Inflammatory Cytokines

Serum samples from mice were collected as follows: anticoagulated blood samples with EDTA were centrifuged at 1000 rpm for 15 min, and the supernatants were removed for measurements.
The mice’s intestinal tissue was treated as follows: intestinal tissue was rinsed with pre-cooled PBS (0.01 M, pH = 7.4, containing protease inhibitor) to remove residual blood. Equal amounts of each intestinal tissue were mixed and minced. Minced tissue and PBS solution were placed in glass homogenizers according to the weight to volume ratio of 1:5; they were fully ground on ice and then subjected to ultrasonic crushing. Finally, homogenates were centrifuged at 5000 rpm for 10 min, and supernatants were removed for measurement.
Supernatants of culture medium were treated as follows: Cell culture medium was transferred to sterile centrifuge tubes and centrifuged at 1000 rpm at 4 °C for 20 min, and the supernatants were removed for measurement. According to the manufacturer’s instructions, levels of IL-6 and TNF-α in serum, intestinal tissue, and supernatants were measured using a double-antibody sandwich ELISA kit.

4.8. Histopathological Examination

Fresh duodenum, jejunum, and ileum were fixed in 4% paraformaldehyde for 24 h at room temperature. The fixed samples were processed, embedded in paraffin, sectioned at 2 to 4 μm, stained with hematoxylin and eosin, and examined under an optical microscope. Images were obtained from areas with the best quality. The villus length and recess depth of each intestinal segment were measured using image analysis software to calculate the villus gland ratios.

4.9. Detection of the Relative Expression Level of RNA

In each group, mice’s duodenum, jejunum, and ileum tissues were homogenized; 50 mg of tissue homogenates and cell samples were used for total RNA extraction. The cDNA obtained by reverse transcription was diluted using the two-fold dilution method. The standard curves for amplifying each gene were generated in our laboratory according to the primers, reaction system, and conditions reported in the literature (Table 3) to verify the amplification efficiency [12,14,50,51,52]. According to the instructions of the TB green ® Premix Ex Taq™ II kit, quantitative detection of each gene was performed on the CFX96 Touch™ real-time PCR detection system, with GAPDH as the internal reference gene. Calibrations and normalizations were performed using the 2−ΔΔCT method. The relative expression levels of genes in different groups were calculated to determine the relative expression levels of each gene.

4.10. Western Blotting

Total protein from the duodenum, jejunum, and ileum of mice in each group was extracted according to the operation instructions of MinuteTM Total Protein Extraction Kit for Animal Cultured Cell and Tissues. Total protein was extracted from 20 mg of tissue homogenates and cell samples. Protein concentrations were measured for western blotting. Antibody dilution ratios of target proteins ZO-1, occludin, and GAPDH were 1:2000, 1:1000, and 1:2500, respectively.

4.11. Measurement of Trans-Epithelial Electrical Resistance (TEER)

Cell suspensions were subjected to viability detection and counting using a cell viability detector. With fresh DMEM culture medium, the cells that survived at more than 95% were diluted into suspension at 2.5 × 105 cells/mL, then inoculated into 12-well Transwell culture plates (pore size 0.4 μm). We added 1.5 mL fresh DMEM into the lower compartments and inoculated 0.5 mL of cell suspension into the upper compartments. Two wells were reserved for each plate as blank controls. We added 0.5 mL DMEM into the upper chamber and 1.5 mL fresh DMEM into the lower chamber. Finally, the plate was placed in an incubator at 37 °C and 5% CO2 for static culture.
The culture medium was replaced every other day during the first week and every day after one week. The resistance of each well and the cell membrane integrity were measured after 21 days. Wells with similar cell resistance values were selected and divided into three groups of six wells per group. The first group was the control group, to which was added with fresh DMEM, and the second group was the LPS group, to which was added with 1 μg/mL LPS in DMEM. The third group was the LPSC group, to which was added with DMEM with 1 μg/mL LPS and 75 μM capsaicin. After mixing gently, the cells were incubated at 37 °C with 5% CO2, and the transmembrane resistance of cells in each group was measured at 3, 6, 12, 18, and 24 h.

4.12. Statistical Analysis

Statistical analyses were conducted with GraphPad Prism 8.0 software (GraphPad Software, San Diego, CA, USA). After testing the normal distribution of sample data, one-way analysis of variance and Dunnett’s tests were used to compare the differences between groups. All data were expressed as mean ± SD, and a p-value less than 0.05 indicated statistically significant differences.

5. Conclusions

Capsaicin mediates lower weight gain by reducing CLGI. Capsaicin reduces the relative abundance of Proteobacteria in the intestine, reduces the concentration of LPS in the intestine, weakens the local inflammation mediated by TLR4, and thus reduces the damage to the intestinal barrier. Capsaicin promotes the upregulation of the expressions of transmembrane protein ZO-1 and cytoplasmic protein occludin, improving TEER. The compound restores intestinal barrier function and reduces intestinal permeability, thereby reducing the concentration of LPS entering the circulation and alleviating endotoxemia. This phenomenon reduces serum concentrations of inflammatory cytokines (TNF-α and IL-6), weakens CLGI, and ultimately reduces weight gain, food intake, levels of triglyceride and cholesterol, and fasting blood glucose levels. There is also improvement in glucose tolerance and insulin levels in HFDC-fed TRPV1−/− mice, helping the animals lower weight gain. This study systematically elucidates the mechanism by which capsaicin reduces LPS concentration in the intestine, attenuates CLGI, and facilitates lipid reduction and weight loss. It was confirmed that capsaicin can stimulate the expression of the intestinal transmembrane protein ZO-1 and the cytoplasmic protein Occludin, increase TEER values, and repair intestinal barrier function. These findings further enhance our understanding of capsaicin’s lipid-lowering mechanisms. Capsaicin’s ability to repair the intestinal barrier function not only reduces the translocation of inflammatory factors into the bloodstream but also significantly affects lipid absorption. Therefore, further studies are necessary to determine whether capsaicin’s impact on intestinal lipid absorption is a key mechanism underlying its lipid-lowering effects.

Author Contributions

J.Y.: Investigation, Formal analysis, Writing—original draft. W.L.: Writing—review and editing. Y.W.: Conceptualization, Writing—review and editing. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Natural Science Foundation of Sichuan Province (grant No. 2022NSFSC0584) and the Fundamental Research Funds for the Central Universities, Southwest Minzu University (grant No. ZYN2024085).

Institutional Review Board Statement

Animal experiments were carried out according to the Guide for the Care and Use of Laboratory Animals requirements and were approved by the Ethics Committee of Laboratory Animal Management Committee of Sichuan Province, China. (Approval number: SYXK-2019-184.)

Informed Consent Statement

Not applicable.

Data Availability Statement

This published article includes all data generated or analyzed during this study.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Unwin, D. Reducing overweight and obesity; so how are we doing? BMJ Nutr. Prev. Health 2024, 7, 1–3. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Yang, M.; Liu, S.; Zhang, C. The Related Metabolic Diseases and Treatments of Obesity. Healthcare 2022, 10, 1616. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Gasmi, A.; Noor, S.; Menzel, A.; Dosa, A.; Pivina, L.; Bjorklund, G. Obesity and Insulin Resistance: Associations with Chronic Inflammation, Genetic and Epigenetic Factors. Curr. Med. Chem. 2021, 28, 800–826. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Zhang, X.; Ha, S.; Lau, H.C.; Yu, J. Excess body weight: Novel insights into its roles in obesity comorbidities. Semin. Cancer Biol. 2023, 92, 16–27. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  5. Varra, F.N.; Varras, M.; Varra, V.K.; Theodosis-Nobelos, P. Molecular and pathophysiological relationship between obesity and chronic inflammation in the manifestation of metabolic dysfunctions and their inflammation-mediating treatment options. Mol. Med. Rep. 2024, 29, 95. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  6. Xu, S.; Lu, F.; Gao, J.; Yuan, Y. Inflammation-mediated metabolic regulation in adipose tissue. Obes. Rev. 2024, 25, e13724. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  7. Miranda, C.S.; Santana-Oliveira, D.A.; Vasques-Monteiro, I.L.; Dantas-Miranda, N.S.; Glauser, J.S.O.; Silva-Veiga, F.M.; Souza-Mello, V. Time-dependent impact of a high-fat diet on the intestinal barrier of male mice. World J. Methodol. 2024, 14, 89723. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  8. Liu, Y.; Zeng, Y.; Liu, Y.; Wang, X.; Chen, Y.; Lepp, D.; Tsao, R.; Sadakiyo, T.; Zhang, H.; Mine, Y. Regulatory Effect of Isomaltodextrin on a High-Fat Diet Mouse Model with LPS-Induced Low-Grade Chronic Inflammation. J. Agric. Food Chem. 2022, 70, 11258–11273. [Google Scholar] [CrossRef] [Scilit]
  9. de Lemos, G.M.; Resende, C.M.M.; Campello, C.P.; Ribeiro, I.S.; Mendes, A.K.; de Lima, E.L.S.; de Oliveira, R.M.D.C.; Barbosa Filho, V.C.; Correia, M.J.; Muniz, M.T.C. Is oral microbiota associated with overweight and obesity in children and adolescents? A systematic review. Crit. Rev. Food Sci. Nutr. 2024, 64, 4275–4285. [Google Scholar] [CrossRef] [Scilit]
  10. Gyriki, D.; Nikolaidis, C.; Stavropoulou, E.; Bezirtzoglou, I.; Tsigalou, C.; Vradelis, S.; Bezirtzoglou, E. Exploring the Gut Microbiome’s Role in Inflammatory Bowel Disease: Insights and Interventions. J. Pers. Med. 2024, 14, 507. [Google Scholar] [CrossRef] [Scilit]
  11. Wang, Y.; Tang, C.; Tang, Y.; Yin, H.; Liu, X. Capsaicin has an anti-obesity effect through alterations in gut microbiota populations and short-chain fatty acid concentrations. Food Nutr. Res. 2020, 64, 3525. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Kang, C.; Wang, B.; Kaliannan, K.; Wang, X.; Lang, H.; Hui, S.; Huang, L.; Zhang, Y.; Zhou, M.; Chen, M.; et al. Gut Microbiota Mediates the Protective Effects of Dietary Capsaicin against Chronic Low-Grade Inflammation and Associated Obesity Induced by High-Fat Diet. mBio 2017, 8, e00470-17. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Wang, G.; Sun, W.; Pei, X.; Jin, Y.; Wang, H.; Tao, W.; Xiao, Z.; Liu, L.; Wang, M. Galactooligosaccharide pretreatment alleviates damage of the intestinal barrier and inflammatory responses in LPS-challenged mice. Food Funct. 2021, 12, 1569–1579. [Google Scholar] [CrossRef] [Scilit]
  14. Wu, X.X.; Huang, X.L.; Chen, R.R.; Li, T.; Ye, H.J.; Xie, W.; Huang, Z.M.; Cao, G.Z. Paeoniflorin Prevents Intestinal Barrier Disruption and Inhibits Lipopolysaccharide (LPS)-Induced Inflammation in Caco-2 Cell Monolayers. Inflammation 2019, 42, 2215–2225. [Google Scholar] [CrossRef] [Scilit]
  15. Zhao, L.; Xie, Q.; Etareri Evivie, S.; Liu, D.; Dong, J.; Ping, L.; Liu, F.; Li, B.; Huo, G. Bifidobacterium dentium N8 with potential probiotic characteristics prevents LPS-induced intestinal barrier injury by alleviating the inflammatory response and regulating the tight junction in Caco-2 cell monolayers. Food Funct. 2021, 12, 7171–7184. [Google Scholar] [CrossRef] [Scilit]
  16. Thornton, T.; Mills, D.; Bliss, E. Capsaicin: A Potential Treatment to Improve Cerebrovascular Function and Cognition in Obesity and Ageing. Nutrients 2023, 15, 1537. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  17. Zhang, W.; Zhang, Y.; Fan, J.; Feng, Z.; Song, X. Pharmacological activity of capsaicin: Mechanisms and controversies (Review). Mol. Med. Rep. 2024, 29, 38. [Google Scholar] [CrossRef] [Scilit]
  18. Li, R.; Lan, Y.; Chen, C.; Cao, Y.; Huang, Q.; Ho, C.T.; Lu, M. Anti-obesity effects of capsaicin and the underlying mechanisms: A review. Food Funct. 2020, 11, 7356–7370. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  19. Lu, Y.C.; Yeh, W.C.; Ohashi, P.S. LPS/TLR4 signal transduction pathway. Cytokine 2008, 42, 145–151. [Google Scholar] [CrossRef] [Scilit]
  20. Li, X.; Gui, R.; Wang, X.; Ning, E.; Zhang, L.; Fan, Y.; Chen, L.; Yu, L.; Zhu, J.; Li, Z.; et al. Oligosaccharides isolated from Rehmannia glutinosa protect LPS-induced intestinal inflammation and barrier injury in mice. Front. Nutr. 2023, 10, 1139006. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  21. Jamar, G.; Pisani, L.P. Inflammatory crosstalk between saturated fatty acids and gut microbiota-white adipose tissue axis. Eur. J. Nutr. 2023, 62, 1077–1091. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  22. Azimirad, M.; Noori, M.; Azimirad, F.; Gholami, F.; Naseri, K.; Yadegar, A.; Asadzadeh Aghdaei, H.; Zali, M.R. Curcumin and capsaicin regulate apoptosis and alleviate intestinal inflammation induced by Clostridioides difficile in vitro. Ann. Clin. Microbiol. Antimicrob. 2022, 21, 41. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Vasanthkumar, T.; Hanumanthappa, M.; Lakshminarayana, R. Curcumin and capsaicin modulates LPS induced expression of COX-2, IL-6 and TGF-beta in human peripheral blood mononuclear cells. Cytotechnology 2019, 71, 963–976. [Google Scholar] [CrossRef] [Scilit]
  24. Chen, Y.S.; Lian, Y.Z.; Chen, W.C.; Chang, C.C.; Tinkov, A.A.; Skalny, A.V.; Chao, J.C. Lycium barbarum Polysaccharides and Capsaicin Inhibit Oxidative Stress, Inflammatory Responses, and Pain Signaling in Rats with Dextran Sulfate Sodium-Induced Colitis. Int. J. Mol. Sci. 2022, 23, 2423. [Google Scholar] [CrossRef] [Scilit]
  25. Zhang, Y.; Zhang, X.Y.; Shi, S.R.; Ma, C.N.; Lin, Y.P.; Song, W.G.; Guo, S.D. Natural products in atherosclerosis therapy by targeting PPARs: A review focusing on lipid metabolism and inflammation. Front. Cardiovasc. Med. 2024, 11, 1372055. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  26. Toyoda, T.; Shi, L.; Takasu, S.; Cho, Y.M.; Kiriyama, Y.; Nishikawa, A.; Ogawa, K.; Tatematsu, M.; Tsukamoto, T. Anti-Inflammatory Effects of Capsaicin and Piperine on Helicobacter pylori-Induced Chronic Gastritis in Mongolian Gerbils. Helicobacter 2016, 21, 131–142. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  27. Andrei, C.; Zanfirescu, A.; Nițulescu, G.M.; Olaru, O.T.; Negreș, S. Natural Active Ingredients and TRPV1 Modulation: Focus on Key Chemical Moieties Involved in Ligand-Target Interaction. Plants 2023, 12, 339. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  28. Güzel, M.; Akpınar, O. Hydroxychloroquine Attenuates Acute Inflammation (LPS)-Induced Apoptosis via Inhibiting TRPV1 Channel/ROS Signaling Pathways in Human Monocytes. Biology 2021, 10, 967. [Google Scholar] [CrossRef] [Scilit]
  29. Vašek, D.; Fikarová, N.; Marková, V.N.; Honc, O.; Pacáková, L.; Porubská, B.; Somova, V.; Novotný, J.; Melkes, B.; Krulová, M. Lipopolysaccharide pretreatment increases the sensitivity of the TRPV1 channel and promotes an anti-inflammatory phenotype of capsaicin-activated macrophages. J. Inflamm. 2024, 21, 17. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  30. Zhong, B.; Ma, S.; Wang, D.H. Ablation of TRPV1 Elevates Nocturnal Blood Pressure in Western Diet-fed Mice. Curr. Hypertens. Rev. 2019, 15, 144–153. [Google Scholar] [CrossRef] [Scilit]
  31. Kuo, W.T.; Odenwald, M.A.; Turner, J.R.; Zuo, L. Tight junction proteins occludin and ZO-1 as regulators of epithelial proliferation and survival. Ann. N. Y. Acad. Sci. 2022, 1514, 21–33. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. Moonwiriyakit, A.; Pathomthongtaweechai, N.; Steinhagen, P.R.; Chantawichitwong, P.; Satianrapapong, W.; Pongkorpsakol, P. Tight junctions: From molecules to gastrointestinal diseases. Tissue Barriers 2023, 11, 2077620. [Google Scholar] [CrossRef] [Scilit]
  33. Dunleavy, K.A.; Raffals, L.E.; Camilleri, M. Intestinal Barrier Dysfunction in Inflammatory Bowel Disease: Underpinning Pathogenesis and Therapeutics. Dig. Dis. Sci. 2023, 68, 4306–4320. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Fang, X.; Nong, K.; Wang, Z.; Jin, Y.; Gao, F.; Zeng, Q.; Wang, X.; Zhang, H. Human cathelicidin LL-37 exerts amelioration effects against EHEC O157:H7 infection regarding inflammation, enteric dysbacteriosis, and impairment of gut barrier function. Peptides 2023, 159, 170903. [Google Scholar] [CrossRef] [Scilit]
  35. He, K.Y.; Lei, X.Y.; Wu, D.H.; Zhang, L.; Li, J.Q.; Li, Q.T.; Yin, W.T.; Zhao, Z.L.; Liu, H.; Xiang, X.Y.; et al. Akkermansia muciniphila protects the intestine from irradiation-induced injury by secretion of propionic acid. Gut Microbes 2023, 15, 2293312. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  36. Jian, Y.; Zhang, D.; Liu, M.; Wang, Y.; Xu, Z.X. The Impact of Gut Microbiota on Radiation-Induced Enteritis. Front. Cell Infect. Microbiol. 2021, 11, 586392. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  37. Santos, E.A.; Silva, J.L.; Leocádio, P.C.L.; Andrade, M.E.R.; Queiroz-Junior, C.M.; Oliveira, N.S.S.; Alves, J.L.; Oliveira, J.S.; Aguilar, E.C.; Boujour, K.; et al. Cutaneous Application of Capsaicin Cream Reduces Clinical Signs of Experimental Colitis and Repairs Intestinal Barrier Integrity by Modulating the Gut Microbiota and Tight Junction Proteins. ACS Pharmacol. Transl. Sci. 2024, 7, 2143–2153. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  38. Nazari, H.; Shrestha, J.; Naei, V.Y.; Bazaz, S.R.; Sabbagh, M.; Thiery, J.P.; Warkiani, M.E. Advances in TEER measurements of biological barriers in microphysiological systems. Biosens. Bioelectron. 2023, 234, 115355. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  39. Jang, S.Y.; Kim, S.Y.; Song, H.A.; Kim, H.; Chung, K.S.; Lee, J.K.; Lee, K.T. Protective effect of hydrangenol on lipopolysaccharide-induced endotoxemia by suppressing intestinal inflammation. Int. Immunopharmacol. 2023, 125, 111083. [Google Scholar] [CrossRef] [Scilit]
  40. Guo, S.; Zhao, H.; Ma, Z.; Zhang, S.; Li, M.; Zheng, Z.; Ren, X.; Ho, C.T.; Bai, N. Anti-Obesity and Gut Microbiota Modulation Effect of Secoiridoid-Enriched Extract from Fraxinus mandshurica Seeds on High-Fat Diet-Fed Mice. Molecules 2020, 25, 4001. [Google Scholar] [CrossRef] [Scilit]
  41. Li, Y.; Liu, Q.; Peng, C.; Ruan, B. Both Gut Microbiota and Differentially Expressed Proteins Are Relevant to the Development of Obesity. Biomed. Res. Int. 2020, 2020, 5376108. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  42. Wei, G.; Ye, Y.; Yan, X.; Chao, X.; Yang, F.; Wang, M.; Zhang, W.; Yuan, C.; Zeng, Q. Effect of banana pulp dietary fibers on metabolic syndrome and gut microbiota diversity in high-fat diet mice. J. Food Biochem. 2020, 44, e13362. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  43. Li, J.; Lv, J.L.; Cao, X.Y.; Zhang, H.P.; Tan, Y.J.; Chu, T.; Zhao, L.L.; Liu, Z.; Ren, Y.S. Gut microbiota dysbiosis as an inflammaging condition that regulates obesity-related retinopathy and nephropathy. Front. Microbiol. 2022, 13, 1040846. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  44. Cao, Y.; Zou, L.; Li, W.; Song, Y.; Zhao, G.; Hu, Y. Dietary quinoa (Chenopodium quinoa Willd.) polysaccharides ameliorate high-fat diet-induced hyperlipidemia and modulate gut microbiota. Int. J. Biol. Macromol. 2020, 163, 55–65. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  45. Di Vincenzo, F.; Del Gaudio, A.; Petito, V.; Lopetuso, L.R.; Scaldaferri, F. Gut microbiota, intestinal permeability, and systemic inflammation: A narrative review. Intern. Emerg. Med. 2024, 19, 275–293. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  46. Wang, Y.; Liu, X. Construction of TRPV1 gene knockout Caco -2 stable cell line based on CRISPR/Cas9 technology. J. Southwest Minzu Univ. 2020, 46, 241–249. [Google Scholar]
  47. Benejat, L.; Ducournau, A.; Lehours, P.; Megraud, F. Real-time PCR for Helicobacter pylori diagnosis. The best tools available. Helicobacter 2018, 23, e12512. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  48. Fite, A.; Macfarlane, G.T.; Cummings, J.H.; Hopkins, M.J.; Kong, S.C.; Furrie, E.; Macfarlane, S. Identification and quantitation of mucosal and faecal desulfovibrios using real time polymerase chain reaction. Gut 2004, 53, 523–529. [Google Scholar] [CrossRef] [Scilit]
  49. Williams, B.L.; Hornig, M.; Parekh, T.; Lipkin, W.I. Application of novel PCR-based methods for detection, quantitation, and phylogenetic characterization of Sutterella species in intestinal biopsy samples from children with autism and gastrointestinal disturbances. mBio 2012, 3, e00261-11. [Google Scholar] [CrossRef] [Scilit]
  50. Tu, J.; Xu, Y.; Xu, J.; Ling, Y.; Cai, Y. Chitosan nanoparticles reduce LPS-induced inflammatory reaction via inhibition of NF-kappaB pathway in Caco-2 cells. Int. J. Biol. Macromol. 2016, 86, 848–856. [Google Scholar] [CrossRef] [Scilit]
  51. Li, X.F.; Zhang, X.J.; Zhang, C.; Wang, L.N.; Li, Y.R.; Zhang, Y.; He, T.T.; Zhu, X.Y.; Cui, L.L.; Gao, B.L. Ulinastatin protects brain against cerebral ischemia/reperfusion injury through inhibiting MMP-9 and alleviating loss of ZO-1 and occludin proteins in mice. Exp. Neurol. 2018, 302, 68–74. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  52. Kalantari, N.; Ghasemi, M.; Bayani, M.; Ghaffari, S. Effect of honey on mRNA expression of TNF-alpha, IL-1beta and IL-6 following acute toxoplasmosis in mice. Cytokine 2016, 88, 85–90. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Figure 1. Effects of capsaicin on plasma parameters in TRPV1−/− mice. Data are expressed as mean ± SD (n = 10). *, HFD group vs. SLD group, #, HFDC group vs. HFD group. (After testing the normal distribution of sample data, one-way ANOVA followed by Dunnett’s test was performed. p < 0.05.)
Figure 1. Effects of capsaicin on plasma parameters in TRPV1−/− mice. Data are expressed as mean ± SD (n = 10). *, HFD group vs. SLD group, #, HFDC group vs. HFD group. (After testing the normal distribution of sample data, one-way ANOVA followed by Dunnett’s test was performed. p < 0.05.)
Ijms 25 08979 g001
Figure 2. Effects of capsaicin on the oral glucose tolerance test (OGTT) of TRPV1−/− mice. Data are expressed as mean ± SD (n = 10). *, HFD group vs. SLD group, #, HFDC group vs. HFD group. (After testing the normal distribution of sample data, one-way ANOVA followed by Dunnett’s test was performed. p < 0.05.)
Figure 2. Effects of capsaicin on the oral glucose tolerance test (OGTT) of TRPV1−/− mice. Data are expressed as mean ± SD (n = 10). *, HFD group vs. SLD group, #, HFDC group vs. HFD group. (After testing the normal distribution of sample data, one-way ANOVA followed by Dunnett’s test was performed. p < 0.05.)
Ijms 25 08979 g002
Figure 3. Capsaicin reversed the HFD-induced alteration in the microbial composition. Data are expressed as mean ± SD (n = 10). *, HFD group vs. SLD group, #, HFDC group vs. HFD group. (After testing the normal distribution of sample data, one-way ANOVA followed by Dunnett’s test was performed. p < 0.05.)
Figure 3. Capsaicin reversed the HFD-induced alteration in the microbial composition. Data are expressed as mean ± SD (n = 10). *, HFD group vs. SLD group, #, HFDC group vs. HFD group. (After testing the normal distribution of sample data, one-way ANOVA followed by Dunnett’s test was performed. p < 0.05.)
Ijms 25 08979 g003
Figure 4. The expressions of TLR4 gene in the intestinal tissue of TRPV1−/− mice. Data are expressed as mean ± SD (n = 10). *, HFD group vs. SLD group, #, HFDC group vs. HFD group. (After testing the normal distribution of sample data, one-way ANOVA followed by Dunnett’s test was performed. p < 0.05.)
Figure 4. The expressions of TLR4 gene in the intestinal tissue of TRPV1−/− mice. Data are expressed as mean ± SD (n = 10). *, HFD group vs. SLD group, #, HFDC group vs. HFD group. (After testing the normal distribution of sample data, one-way ANOVA followed by Dunnett’s test was performed. p < 0.05.)
Ijms 25 08979 g004
Figure 5. Effect of capsaicin on the histopathology of the intestinal tract in TRPV1−/− mice.
Figure 5. Effect of capsaicin on the histopathology of the intestinal tract in TRPV1−/− mice.
Ijms 25 08979 g005
Figure 6. Effect of capsaicin on the villus-to-crypt ratio of the intestinal tract in TRPV1−/− mice. Data are expressed as mean ± SD (n = 10). *, HFD group vs. SLD group, #, HFDC group vs. HFD group. (After testing the normal distribution of sample data, one-way ANOVA followed by Dunnett’s test was performed. p < 0.05.)
Figure 6. Effect of capsaicin on the villus-to-crypt ratio of the intestinal tract in TRPV1−/− mice. Data are expressed as mean ± SD (n = 10). *, HFD group vs. SLD group, #, HFDC group vs. HFD group. (After testing the normal distribution of sample data, one-way ANOVA followed by Dunnett’s test was performed. p < 0.05.)
Ijms 25 08979 g006
Figure 7. The expressions of IL-6 and TNF-α gene in the intestinal tissue of TRPV1−/− mice. Data are expressed as mean ± SD (n = 10). *, HFD group vs. SLD group, #, HFDC group vs. HFD group. (After testing the normal distribution of sample data, one-way ANOVA followed by Dunnett’s test was performed. p < 0.05.)
Figure 7. The expressions of IL-6 and TNF-α gene in the intestinal tissue of TRPV1−/− mice. Data are expressed as mean ± SD (n = 10). *, HFD group vs. SLD group, #, HFDC group vs. HFD group. (After testing the normal distribution of sample data, one-way ANOVA followed by Dunnett’s test was performed. p < 0.05.)
Ijms 25 08979 g007
Figure 8. The expressions of TLR4, IL-6 and TNF-α gene in Caco-2 (TRPV1−/−). Data are expressed as mean ± SD (n = 6). *, LPS group vs. control group. (After testing the normal distribution of sample data, one-way ANOVA followed by Dunnett’s test was performed. p < 0.05.)
Figure 8. The expressions of TLR4, IL-6 and TNF-α gene in Caco-2 (TRPV1−/−). Data are expressed as mean ± SD (n = 6). *, LPS group vs. control group. (After testing the normal distribution of sample data, one-way ANOVA followed by Dunnett’s test was performed. p < 0.05.)
Ijms 25 08979 g008
Figure 9. The expressions of occludin and ZO-1 in the intestinal tissue of mice. Data are expressed as mean ± SD (n = 10). *, HFD group vs. SLD group, #, HFDC group vs. HFD group. (After testing the normal distribution of sample data, one-way ANOVA followed by Dunnett’s test was performed. p < 0.05.)
Figure 9. The expressions of occludin and ZO-1 in the intestinal tissue of mice. Data are expressed as mean ± SD (n = 10). *, HFD group vs. SLD group, #, HFDC group vs. HFD group. (After testing the normal distribution of sample data, one-way ANOVA followed by Dunnett’s test was performed. p < 0.05.)
Ijms 25 08979 g009
Figure 10. The expressions of occludin and ZO-1 in Caco-2(TRPV1−/−). Data are expressed as mean ± SD (n = 6). *, LPS group vs. Control group, #, LPSC group vs. LPS group. (After testing the normal distribution of sample data, one-way ANOVA followed by Dunnett’s test was performed. p < 0.05.)
Figure 10. The expressions of occludin and ZO-1 in Caco-2(TRPV1−/−). Data are expressed as mean ± SD (n = 6). *, LPS group vs. Control group, #, LPSC group vs. LPS group. (After testing the normal distribution of sample data, one-way ANOVA followed by Dunnett’s test was performed. p < 0.05.)
Ijms 25 08979 g010
Figure 11. The influence of capsaicin on Caco-2 (TRPV1−/−) cells on TEER values. Data are expressed as mean ± SD (n = 6). *, LPS group vs. Control group, #, LPSC group vs. LPS group. (After testing the normal distribution of sample data, one-way ANOVA followed by Dunnett’s test was performed. p < 0.05.)
Figure 11. The influence of capsaicin on Caco-2 (TRPV1−/−) cells on TEER values. Data are expressed as mean ± SD (n = 6). *, LPS group vs. Control group, #, LPSC group vs. LPS group. (After testing the normal distribution of sample data, one-way ANOVA followed by Dunnett’s test was performed. p < 0.05.)
Ijms 25 08979 g011
Figure 12. IL-6, TNF-α and LPS concentrations in the serum of TRPV1−/− mice. Data are expressed as mean ± SD (n = 10). *, HFD group vs. SLD group, #, HFDC group vs. HFD group. (After testing the normal distribution of sample data, one-way ANOVA followed by Dunnett’s test was performed. p < 0.05.)
Figure 12. IL-6, TNF-α and LPS concentrations in the serum of TRPV1−/− mice. Data are expressed as mean ± SD (n = 10). *, HFD group vs. SLD group, #, HFDC group vs. HFD group. (After testing the normal distribution of sample data, one-way ANOVA followed by Dunnett’s test was performed. p < 0.05.)
Ijms 25 08979 g012
Table 1. Effects of capsaicin on food intake and body weight in TRPV1−/− mice.
Table 1. Effects of capsaicin on food intake and body weight in TRPV1−/− mice.
ParameterSLDHFDHFDC
Initial Body Weight (g)22.12 ± 0.9521.90 ± 0.7422.27 ± 1.06
Final Body Weight (g)31.04 ± 0.9641.06 ± 1.16 *35.70 ± 1.65 #
Body Weight Gain(g)8.92 ± 0.6719.16 ± 0.63 *13.43 ± 1.52 #
Average Feed Intake (g/d)3.27 ± 0.135.16 ± 0.11 *4.09 ± 0.13 #
Total Feed Intake (g)274.47 ± 11.34433.16 ± 9.40 *343.42 ± 10.80 #
Data are expressed as mean ± SD (n = 10). *, HFD group vs. SLD group, #, HFDC group vs. HFD. (After testing the normal distribution of sample data, one-way ANOVA followed by Dunnett’s test was performed. p < 0.05.)
Table 2. List of primers of gut microbiota.
Table 2. List of primers of gut microbiota.
Bacterial SpeciesPrimerSequence(5′-3′)References
HelicobaterForwardGCTCTCACTTCCATAGGCTATAATGTG[47]
ReverseGCGCATGTCTTCGGTTAAAAA
ProbeFAM-TAGGGCCTATGCCTACCCCTGCGA-TAMARA
DesulfovibrioForward CCGTAGATATCTGGAGGAACATCAG [48]
Reverse ACATCTAGCATCCATCGTTTACAGC
SutterellaForwardCGCGAAAAACCTTACCTAGCC[49]
ReverseGACGTGTGAGGCCCTAGCC
ProbeFAM-CACAGGTGCTGCATGGCTGTCGT-NFQ
Table 3. The primers used for real-time RT-PCR.
Table 3. The primers used for real-time RT-PCR.
GenePrimerSequence(5′-3′)References
ZO-1(human)Forward GGTGAAGTGAAGACAATG [14]
Reverse GGTAATATGGTGAAGTTAGAG
Occludin(human)Forward GAGTTGTATCTGTTGTTGT
Reverse TTCGTGGTATAGCATTCT
IL-6(human)Forward GACAGCCACTCACCTCTTCA
Reverse TTCACCAGGCAAGTCTCCTC
TNF-α(human)Forward GTCAGATCATCTTCTCGA ACC
Reverse CAGATAGATGGGCTCATACC
TLR 4(human)Forward CTGGAAATATGACCACAGTCAGAA [50]
Reverse TCAATCA CCCTAGACCTGCTCAA
GAPDH(human)Forward CTGACTTCAACAGCGACACC
Reverse AGCCAAATTCGTTGTCATACC
Occludin(mice)Forward CCTTCTGCTTCATCGCTTCCTTA [51]
Reverse CGTCGGGTTCACTCCCATTAT
ZO-1(mice)Forward GATAGTTTGGCAGCAAGAGATGGTA
Reverse AGGTCAGGGACGTTCAGTAAGGTAG
IL-6(mice)Forward CACATGTTCTCTGGGAAATCG [52]
Reverse TTGTATCTCTGGAAGTTTCAGATTGTT
TNF-α(mice)Forward GCCACCACGCTCTTCTGTCTAC
Reverse GGGTCTGGGCCATAGAACTGAT
TLR 4(mice)Forward CGCTTTCACCTCTGCCTTCACTACAG [12]
Reverse ACACTACCACAATAACCTTCCGGCTC
GAPDH(mice)Forward GCATCCACTGGTGCTGCC
Reverse TCATCATACTTGGCAGGTTTC
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Yang, J.; Li, W.; Wang, Y. Capsaicin Reduces Obesity by Reducing Chronic Low-Grade Inflammation. Int. J. Mol. Sci. 2024, 25, 8979. https://doi.org/10.3390/ijms25168979

AMA Style

Yang J, Li W, Wang Y. Capsaicin Reduces Obesity by Reducing Chronic Low-Grade Inflammation. International Journal of Molecular Sciences. 2024; 25(16):8979. https://doi.org/10.3390/ijms25168979

Chicago/Turabian Style

Yang, Jiaxin, Wanyi Li, and Yuanwei Wang. 2024. "Capsaicin Reduces Obesity by Reducing Chronic Low-Grade Inflammation" International Journal of Molecular Sciences 25, no. 16: 8979. https://doi.org/10.3390/ijms25168979

APA Style

Yang, J., Li, W., & Wang, Y. (2024). Capsaicin Reduces Obesity by Reducing Chronic Low-Grade Inflammation. International Journal of Molecular Sciences, 25(16), 8979. https://doi.org/10.3390/ijms25168979

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop