Exosomes Derived from Adipose Mesenchymal Stem Cells Promote Regeneration of Injured Liver in Minipigs
Abstract
1. Introduction
2. Results
2.1. ADSCs-exo Improved the Histopathological Changes after Liver Injury
2.2. ADSCs-exo Improved Liver Function after Injury
2.3. ADSCs-exo Modulated the Inflammatory Balance after Liver Injury
2.4. ADSCs-exo Promoted Liver Regeneration after Injury
2.5. ADSCs-exo Has a Similar Pro-Regenerative Capacity to ADSCs after Liver Injury
3. Discussion
4. Materials and Methods
4.1. Preparation of ADSCs and ADSCs-exo
4.2. Animals
4.3. Surgical Procedure of Laparoscopic Partial Hepatectomy Combined with IRI
4.4. Liver-Function Analysis
4.5. Histopathological Assessment
4.6. Enzyme-Linked Immunosorbent Assay (ELISA)
4.7. Ki67 Immunofluorescence Staining
4.8. Reverse Transcription–Quantitative Polymerase Chain Reaction (RT-qPCR)
4.9. Western Blotting
4.10. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
ADSCs | Adipose-derived mesenchymal stem cells |
ADSCs-exo | Exosomes from adipose-derived mesenchymal stem cells |
ALT | Alanine aminotransferase |
ANG | Angiogenin |
CRP | C-Reactive Protein |
HA | Hyaluronic acid |
HGF | Hepatocyte growth factor |
IRI | Ischemia/reperfusion injury |
IL | Interleukin |
MSCs | mesenchymal stem cells |
MSCs-exo | MSCs-derived exosomes |
NF-κB | Nuclear factor kappa B |
PCNA | Proliferating cell nuclear antigen |
STAT | Signal transducer and activator of transcription |
SOCS3 | Suppressor of cytokine signalling |
TBIL | Total bilirubin |
TGF | Transforming growth factor |
TNF | Tumor necrosis factor |
VEGF | Vascular endothelial growth factor |
References
- Dorweiler, B.; Pruefer, D.; Andrasi, T.B.; Maksan, S.M.; Schmiedt, W.; Neufang, A.; Vahl, C.F. Ischemia-reperfusion injury—Pathophysiology and clinical implications. Eur. J. Trauma Emerg. Surg. 2007, 33, 600–612. [Google Scholar] [CrossRef] [PubMed]
- van Gulik, T.M.; de Graaf, W.; Dinant, S.; Busch, O.R.C.; Gouma, D.J. Vascular occlusion techniques during liver resection. Dig. Surg. 2007, 24, 274–281. [Google Scholar] [CrossRef] [PubMed]
- Abshagen, K.; Eipel, C.; Vollmar, B. A critical appraisal of the hemodynamic signal driving liver regeneration. Langenbeck’s Arch. Surg. 2012, 397, 579–590. [Google Scholar] [CrossRef] [PubMed]
- Kim, Y.-I. Ischemia-reperfusion injury of the human liver during hepatic resection. J. Hepato-Biliary-Pancreat. Surg. 2003, 10, 195–199. [Google Scholar] [CrossRef] [PubMed]
- Nastos, C.; Kalimeris, K.; Papoutsidakis, N.; Tasoulis, M.K.; Lykoudis, P.M.; Theodoraki, K.; Nastou, D.; Smyrniotis, V.; Arkadopoulos, N. Global Consequences of Liver Ischemia/Reperfusion Injury. Oxidative Med. Cell. Longev. 2014, 2014, 13. [Google Scholar] [CrossRef] [PubMed]
- Dar, W.A.; Sullivan, E.; Bynon, J.S.; Eltzschig, H.; Ju, C. Ischaemia reperfusion injury in liver transplantation: Cellular and molecular mechanisms. Liver Int. 2019, 39, 788–801. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Man, K. Mechanistic Insight and Clinical Implications of Ischemia/Reperfusion Injury Post Liver Transplantation. Cell. Mol. Gastroenterol. Hepatol. 2023, 15, 1463–1474. [Google Scholar] [CrossRef] [PubMed]
- Caplan, A.I. Adult mesenchymal stem cells for tissue engineering versus regenerative medicine. J. Cell. Physiol. 2007, 213, 341–347. [Google Scholar] [CrossRef]
- Vizoso, F.J.; Eiro, N.; Cid, S.; Schneider, J.; Perez-Fernandez, R. Mesenchymal Stem Cell Secretome: Toward Cell-Free Therapeutic Strategies in Regenerative Medicine. Int. J. Mol. Sci. 2017, 18, 24. [Google Scholar] [CrossRef]
- Lee, S.K.; Lee, S.C.; Kim, S.J. A novel cell-free strategy for promoting mouse liver regeneration: Utilization of a conditioned medium from adipose-derived stem cells. Hepatol. Int. 2015, 9, 310–320. [Google Scholar] [CrossRef]
- Bussche, L.; Van de Walle, G.R. Peripheral Blood-Derived Mesenchymal Stromal Cells Promote Angiogenesis via Paracrine Stimulation of Vascular Endothelial Growth Factor Secretion in the Equine Model. Stem Cells Transl. Med. 2014, 3, 1514–1525. [Google Scholar] [CrossRef]
- Linero, I.; Chaparro, O. Paracrine Effect of Mesenchymal Stem Cells Derived from Human Adipose Tissue in Bone Regeneration. PLoS ONE 2014, 9, 12. [Google Scholar] [CrossRef] [PubMed]
- Mayourian, J.; Cashman, T.J.; Ceholski, D.K.; Johnson, B.V.; Sachs, D.; Kaji, D.A.; Sahoo, S.; Hare, J.M.; Hajjar, R.J.; Sobie, E.A.; et al. Experimental and Computational Insight Into Human Mesenchymal Stem Cell Paracrine Signaling and Heterocellular Coupling Effects on Cardiac Contractility and Arrhythmogenicity. Circ. Res. 2017, 121, 411–423. [Google Scholar] [CrossRef] [PubMed]
- Xia, X.F.; Chan, K.F.; Wong, G.T.Y.; Wang, P.; Liu, L.; Yeung, B.P.M.; Ng, E.K.W.; Lau, J.Y.W.; Chiu, P.W.Y. Mesenchymal stem cells promote healing of nonsteroidal anti-inflammatory drug-related peptic ulcer through paracrine actions in pigs. Sci. Transl. Med. 2019, 11, 14. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.M.; Wu, Y.N.; Yang, D.H.; Neo, S.H.; Kadir, N.D.; Goh, D.; Tan, J.X.; Denslin, V.; Lee, E.H.; Yang, Z. Secretive derived from hypoxia preconditioned mesenchymal stem cells promote cartilage regeneration and mitigate joint inflammation via extracellular vesicles. Bioact. Mater. 2023, 27, 98–112. [Google Scholar] [CrossRef]
- Furuta, T.; Miyaki, S.; Ishitobi, H.; Ogura, T.; Kato, Y.; Kamei, N.; Miyado, K.; Higashi, Y.; Ochi, M. Mesenchymal Stem Cell-Derived Exosomes Promote Fracture Healing in a Mouse Model. Stem Cells Transl. Med. 2016, 5, 1620–1630. [Google Scholar] [CrossRef]
- Luo, J.T.; Zhao, S.K.; Wang, J.M.; Luo, L.M.; Li, E.M.; Zhu, Z.G.; Liu, Y.Z.; Kang, R.; Zhao, Z.G. Bone marrow mesenchymal stem cells reduce ureteral stricture formation in a rat model via the paracrine effect of extracellular vesicles. J. Cell. Mol. Med. 2018, 22, 4449–4459. [Google Scholar] [CrossRef]
- Wang, S.T.; Liu, Z.W.; Yang, S.; Huo, N.; Qiao, B.; Zhang, T.; Xu, J.; Shi, Q. Extracellular vesicles secreted by human gingival mesenchymal stem cells promote bone regeneration in rat femoral bone defects. Front. Bioeng. Biotechnol. 2023, 11, 12. [Google Scholar] [CrossRef]
- Lelek, J.; Zuba-Surma, E.K. Perspectives for Future Use of Extracellular Vesicles from Umbilical Cord- and Adipose Tissue-Derived Mesenchymal Stem/Stromal Cells in Regenerative Therapies-Synthetic Review. Int. J. Mol. Sci. 2020, 21, 19. [Google Scholar] [CrossRef]
- Kalluri, R.; LeBleu, V.S. The biology, function, and biomedical applications of exosomes. Science 2020, 367, eaau6977. [Google Scholar] [CrossRef]
- Damania, A.; Jaiman, D.; Teotia, A.K.; Kumar, A. Mesenchymal stromal cell-derived exosome-rich fractionated secretome confers a hepatoprotective effect in liver injury. Stem Cell Res. Ther. 2018, 9, 12. [Google Scholar] [CrossRef] [PubMed]
- Martins, P.N.A.; Theruvath, T.P.; Neuhaus, P. Rodent models of partial hepatectomies. Liver Int. 2008, 28, 3–11. [Google Scholar] [CrossRef] [PubMed]
- Fujiwara, S. Humanized mice: A brief overview on their diverse applications in biomedical research. J. Cell. Physiol. 2018, 233, 2889–2901. [Google Scholar] [CrossRef] [PubMed]
- Cinelli, L.; Muttillo, E.M.; Felli, E.; Baiocchini, A.; Giannone, F.; Marescaux, J.; Mutter, D.; De Mathelin, M.; Gioux, S.; Felli, E. Surgical Models of Liver Regeneration in Pigs: A Practical Review of the Literature for Researchers. Cells 2023, 12, 603. [Google Scholar] [CrossRef] [PubMed]
- Jiao, Z.H.; Ma, Y.J.; Zhang, Q.Z.; Wang, Y.; Liu, T.; Liu, X.N.; Piao, C.X.; Liu, B.Y.; Wang, H.B. The adipose-derived mesenchymal stem cell secretome promotes hepatic regeneration in miniature pigs after liver ischaemia-reperfusion combined with partial resection. Stem Cell Res. Ther. 2021, 12, 12. [Google Scholar] [CrossRef] [PubMed]
- Thorling, C.A.; Liu, X.; Burczynski, F.J.; Fletcher, L.M.; Gobe, G.C.; Roberts, M.S. Multiphoton microscopy can visualize zonal damage and decreased cellular metabolic activity in hepatic ischemia-reperfusion injury in rats. J. Biomed. Opt. 2011, 16, 8. [Google Scholar] [CrossRef] [PubMed]
- Ferri, D.; Moro, L.; Mastrodonato, M.; Capuano, F.; Marra, E.; Liquori, G.E.; Greco, M. Ultrastructural zonal heterogeneity of hepatocytes and mitochondria within the hepatic acinus during liver regeneration after partial hepatectomy. Biol. Cell 2005, 97, 277–288. [Google Scholar] [CrossRef] [PubMed]
- Niiya, T.; Murakami, M.; Aoki, T.; Murai, N.; Shimizu, Y.; Kusano, M. Immediate increase of portal pressure, reflecting sinusoidal shear stress, induced liver regeneration after partial hepatectomy. J. Hepato-Biliary-Pancreat. Surg. 1999, 6, 275–280. [Google Scholar] [CrossRef] [PubMed]
- Jia, C. Advances in the regulation of liver regeneration. Expert Rev. Gastroenterol. Hepatol. 2011, 5, 105–121. [Google Scholar] [CrossRef]
- Camargo, C.A., Jr.; Madden, J.F.; Gao, W.; Selvan, R.S.; Clavien, P.A. Interleukin-6 protects liver against warm ischemia/reperfusion injury and promotes hepatocyte proliferation in the rodent. Hepatology 1997, 26, 1513–1520. [Google Scholar] [CrossRef]
- Yin, S.; Wang, H.; Park, O.; Wei, W.; Shen, J.L.; Gao, B. Enhanced Liver Regeneration in IL-10-Deficient Mice after Partial Hepatectomy via Stimulating Inflammatory Response and Activating Hepatocyte STAT3. Am. J. Pathol. 2011, 178, 1614–1621. [Google Scholar] [CrossRef] [PubMed]
- Michalopoulos, G.K. Liver regeneration. J. Cell. Physiol. 2007, 213, 286–300. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Y.; Ye, W.; Wang, Y.-D.; Chen, W.-D. HGF/c-Met: A key promoter in liver regeneration. Front. Pharmacol. 2022, 13, 808855. [Google Scholar] [CrossRef] [PubMed]
- Li, M.; Zhou, X.; Mei, J.; Geng, X.; Zhou, Y.; Zhang, W.; Xu, C. Study on the activity of the signaling pathways regulating hepatocytes from G0 phase into G1 phase during rat liver regeneration. Cell. Mol. Biol. Lett. 2014, 19, 181–200. [Google Scholar] [CrossRef] [PubMed]
- Schwabe, R.F.; Bradham, C.A.; Uehara, T.; Hatano, E.; Bennett, B.L.; Schoonhoven, R.; Brenner, D.A. c-Jun-N-terminal kinase drives cyclin D1 expression and proliferation during liver regeneration. Hepatology 2003, 37, 824–832. [Google Scholar] [CrossRef] [PubMed]
- Muskhelishvili, L.; Latendresse, J.R.; Kodell, R.L.; Henderson, E.B. Evaluation of cell proliferation in rat tissues with BrdU, PCNA, Ki-67(MIB-5) immunohistochemistry and in situ hybridization for histone mRNA. J. Histochem. Cytochem. 2003, 51, 1681–1688. [Google Scholar] [CrossRef] [PubMed]
- Li, Z.W.; Wang, L. The role of liver sinusoidal endothelial cells in liver remodeling after injury. Hepatobiliary Pancreat. Dis. Int. 2023, 22, 22–27. [Google Scholar] [CrossRef] [PubMed]
- Ito, Y.; Hosono, K.; Amano, H. Responses of hepatic sinusoidal cells to liver ischemia-reperfusion injury. Front. Cell Dev. Biol. 2023, 11, 18. [Google Scholar] [CrossRef] [PubMed]
- LeCouter, J.; Moritz, D.R.; Li, B.; Phillips, G.L.; Liang, X.H.; Gerber, H.P.; Hillan, K.J.; Ferrara, N. Angiogenesis-independent endothelial protection of liver: Role of VEGFR-1. Science 2003, 299, 890–893. [Google Scholar] [CrossRef]
- Asahara, T.; Chen, D.; Takahashi, T.; Fujikawa, K.; Kearney, M.; Magner, M.; Yancopoulos, G.D.; Isner, J.M. Tie2 receptor ligands, angiopoietin-1 and angiopoietin-2, modulate VEGF-induced postnatal neovascularization. Circ. Res. 1998, 83, 233–240. [Google Scholar] [CrossRef]
- Cottart, C.H.; Do, L.; Blanc, M.C.; Vaubourdolle, M.; Descamps, G.; Durand, D.; Galen, F.X.; Clot, J.P. Hepatoprotective effect of endogenous nitric oxide during ischemia-reperfusion in the rat. Hepatology 1999, 29, 809–813. [Google Scholar] [CrossRef] [PubMed]
- Thenappan, A.; Li, Y.; Kitisin, K.; Rashid, A.; Shetty, K.; Johnson, L.; Mishra, L. Role of transforming growth factor β signaling and expansion of progenitor cells in regenerating liver. Hepatology 2010, 51, 1373–1382. [Google Scholar] [CrossRef] [PubMed]
- Khan, M.G.M.; Ghosh, A.; Variya, B.; Santharam, M.A.; Kandhi, R.; Ramanathan, S.; Ilangumaran, S. Hepatocyte growth control by SOCS1 and SOCS3. Cytokine 2019, 121, 154733. [Google Scholar] [CrossRef] [PubMed]
- Tan, C.Y.; Lai, R.C.; Wong, W.; Dan, Y.Y.; Lim, S.K.; Ho, H.K. Mesenchymal stem cell-derived exosomes promote hepatic regeneration in drug-induced liver injury models. Stem Cell Res. Ther. 2014, 5, 76. [Google Scholar] [CrossRef] [PubMed]
- Rong, X.; Liu, J.; Yao, X.; Jiang, T.; Wang, Y.; Xie, F. Human bone marrow mesenchymal stem cells-derived exosomes alleviate liver fibrosis through the Wnt/beta-catenin pathway. Stem Cell Res. Ther. 2019, 10, 98. [Google Scholar] [CrossRef] [PubMed]
- Jin, Y.; Wang, J.; Li, H.; Gao, S.; Shi, R.; Yang, D.; Wang, X.; Wang, X.; Zhu, L.; Wang, X.; et al. Extracellular Vesicles Secreted by Human Adipose-derived Stem Cells (hASCs) Improve Survival Rate of Rats with Acute Liver Failure by Releasing lncRNA H19. eBioMedicine 2018, 34, 231–242. [Google Scholar] [CrossRef] [PubMed]
- Anger, F.; Camara, M.; Ellinger, E.; Germer, C.T.; Schlegel, N.; Otto, C.; Klein, I. Human Mesenchymal Stromal Cell-Derived Extracellular Vesicles Improve Liver Regeneration After Ischemia Reperfusion Injury in Mice. Stem Cells Dev. 2019, 28, 1451–1462. [Google Scholar] [CrossRef]
- Ichinohe, N.; Ishii, M.; Tanimizu, N.; Mizuguchi, T.; Yoshioka, Y.; Ochiya, T.; Suzuki, H.; Mitaka, T. Extracellular vesicles containing miR-146a-5p secreted by bone marrow mesenchymal cells activate hepatocytic progenitors in regenerating rat livers. Stem Cell Res. Ther. 2021, 12, 312. [Google Scholar] [CrossRef] [PubMed]
- Piao, C.X.; Sang, J.F.; Kou, Z.P.; Wang, Y.; Liu, T.; Lu, X.Y.; Jiao, Z.H.; Wang, H.B. Effects of Exosomes Derived from Adipose-Derived Mesenchymal Stem Cells on Pyroptosis and Regeneration of Injured Liver. Int. J. Mol. Sci. 2022, 23, 12065. [Google Scholar] [CrossRef]
- Rostom, D.M.; Attia, N.; Khalifa, H.M.; Abou Nazel, M.W.; El Sabaawy, E.A. The Therapeutic Potential of Extracellular Vesicles Versus Mesenchymal Stem Cells in Liver Damage. Tissue Eng. Regen. Med. 2020, 17, 537–552. [Google Scholar] [CrossRef]
- Zhang, J.; Gao, J.; Li, X.L.; Lin, D.N.; Li, Z.H.; Wang, J.L.; Chen, J.F.; Gao, Z.L.; Lin, B.L. Bone marrow mesenchymal stem cell-derived small extracellular vesicles promote liver regeneration via miR-20a-5p/PTEN. Front. Pharmacol. 2023, 14, 15. [Google Scholar] [CrossRef] [PubMed]
- Chen, L.; Xiang, B.Y.; Wang, X.J.; Xiang, C. Exosomes derived from human menstrual blood-derived stem cells alleviate fulminant hepatic failure. Stem Cell Res. Ther. 2017, 8, 9. [Google Scholar] [CrossRef] [PubMed]
- Jiang, Y.; Hong, S.; Zhu, X.; Zhang, L.; Tang, H.; Jordan, K.L.; Saadiq, I.M.; Huang, W.; Lerman, A.; Eirin, A.; et al. IL-10 partly mediates the ability of MSC-derived extracellular vesicles to attenuate myocardial damage in experimental metabolic renovascular hypertension. Front. Immunol. 2022, 13, 940093. [Google Scholar] [CrossRef] [PubMed]
- Xu, J.; Chen, P.; Yu, C.; Shi, Q.; Wei, S.; Li, Y.; Qi, H.; Cao, Q.; Guo, C.; Wu, X.; et al. Hypoxic bone marrow mesenchymal stromal cells-derived exosomal miR-182-5p promotes liver regeneration via FOXO1-mediated macrophage polarization. FASEB J. 2022, 36, e22553. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Song, Y.; Chen, L.; Li, D.; Feng, H.; Lu, Z.; Fan, T.; Chen, Z.; Livingston, M.J.; Geng, Q. MiR-20a-containing exosomes from umbilical cord mesenchymal stem cells alleviates liver ischemia/reperfusion injury. J. Cell. Physiol. 2019, 235, 3698–3710. [Google Scholar] [CrossRef] [PubMed]
- Eirin, A.; Zhu, X.-Y.; Puranik, A.S.; Woollard, J.R.; Tang, H.; Dasari, S.; Lerman, A.; Van Wijnen, A.J.; Lerman, L.O. Comparative proteomic analysis of extracellular vesicles isolated from porcine adipose tissue-derived mesenchymal stem/stromal cells. Sci. Rep. 2016, 6, 36120. [Google Scholar] [CrossRef] [PubMed]
- Eirin, A.; Zhu, X.-Y.; Puranik, A.S.; Woollard, J.R.; Tang, H.; Dasari, S.; Lerman, A.; Van Wijnen, A.J.; Lerman, L.O. Integrated transcriptomic and proteomic analysis of the molecular cargo of extracellular vesicles derived from porcine adipose tissue-derived mesenchymal stem cells. PLoS ONE 2017, 12, e0174303. [Google Scholar] [CrossRef] [PubMed]
- Jaeschke, H.; Bautista, A.P.; Spolarics, Z.; Spitzer, J.J. Superoxide generation by Kupffer cells and priming of neutrophils during reperfusion after hepatic ischemia. Free Radic. Res. Commun. 1991, 15, 277–284. [Google Scholar] [CrossRef]
- Zhang, G.; Huang, X.; Xiu, H.; Sun, Y.; Chen, J.; Cheng, G.; Song, Z.; Peng, Y.; Shen, Y.; Wang, J. Extracellular vesicles: Natural liver-accumulating drug delivery vehicles for the treatment of liver diseases. J. Extracell. Vesicles 2020, 10, e12030. [Google Scholar] [CrossRef]
- Wang, C.; Ma, C.; Gong, L.H.; Guo, Y.Q.; Fu, K.; Zhang, Y.F.; Zhou, H.L.; Li, Y.X. Macrophage Polarization and Its Role in Liver Disease. Front. Immunol. 2021, 12, 25. [Google Scholar] [CrossRef]
- Zhao, J.; Li, X.; Hu, J.; Chen, F.; Qiao, S.; Sun, X.; Gao, L.; Xie, J.; Xu, B. Mesenchymal stromal cell-derived exosomes attenuate myocardial ischaemia-reperfusion injury through miR-182-regulated macrophage polarization. Cardiovasc. Res. 2019, 115, 1205–1216. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Jing, Y.L.; Bai, F.; Wu, Y.; Wang, L.M.; Yan, Y.T.; Jia, Y.X.; Yu, Y.; Jia, B.Z.; Ali, F. Induced pluripotent stem cells as natural biofactories for exosomes carrying miR-199b-5p in the treatment of spinal cord injury. Front. Pharmacol. 2023, 13, 10. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Liu, T.; Jiao, G.; Lv, Y.; Piao, C.; Lu, X.; Ma, H.; Wang, H. Exosomes from adipose-derived mesenchymal stem cells can attenuate liver injury caused by minimally invasive hemihepatectomy combined with ischemia-reperfusion in minipigs by modulating the endoplasmic reticulum stress response. Life Sci. 2023, 321, 121618. [Google Scholar] [CrossRef] [PubMed]
Gene | Forward Primer Sequence (5′-3′) | Reverse Primer Sequence (5′-3′) |
---|---|---|
PCNA | GGCTCTATCCTGAAGAAGGTGCTG | GACATGAGACGAGTCCATGCTCTG |
CyclinD1 | AAGTGCGTGCAGAAGGAAAT | AGGAAGCGGTCCAGGTAGTT |
HGF | TGATCAACTCAGACGGCCTA | AGCCCCAGCACATATTTCAG |
STAT3 | GTGGAGAAGGACATCAGCGGTAAG | AGGTAGACCAGCGGAGACACAAG |
SOCS3 | GGTCACCCACAGCAAGTTTCCC | TCCAGTAGAAGCCGCTCTCCTG |
VEGF | CATGGCAGAAGGAGACCAGAAACC | CACAGGACGGCTTGAAGATGTACTC |
ANG1 | AAATGGAGGGGAAGCACAAGGAAG | ACTGTTATTGGTGGTGGCTCTGTTC |
ANG2 | CACCTACACGCTGACCTTTCCTAAC | CGCTGAATAACTGTCCATCCACCTC |
TGF-β | CCATTCGCGGCCAGATT | GCTCCGGTTCGACACTTTC |
β-actin | TCTGGCACCACACCTTCT | TGATCTGGGTCATCTTCTCAC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, Y.; Piao, C.; Liu, T.; Lu, X.; Ma, Y.; Zhang, J.; Ma, H.; Wang, H. Exosomes Derived from Adipose Mesenchymal Stem Cells Promote Regeneration of Injured Liver in Minipigs. Int. J. Mol. Sci. 2024, 25, 6604. https://doi.org/10.3390/ijms25126604
Wang Y, Piao C, Liu T, Lu X, Ma Y, Zhang J, Ma H, Wang H. Exosomes Derived from Adipose Mesenchymal Stem Cells Promote Regeneration of Injured Liver in Minipigs. International Journal of Molecular Sciences. 2024; 25(12):6604. https://doi.org/10.3390/ijms25126604
Chicago/Turabian StyleWang, Yue, Chenxi Piao, Tao Liu, Xiangyu Lu, Yajun Ma, Jiantao Zhang, Haiyang Ma, and Hongbin Wang. 2024. "Exosomes Derived from Adipose Mesenchymal Stem Cells Promote Regeneration of Injured Liver in Minipigs" International Journal of Molecular Sciences 25, no. 12: 6604. https://doi.org/10.3390/ijms25126604
APA StyleWang, Y., Piao, C., Liu, T., Lu, X., Ma, Y., Zhang, J., Ma, H., & Wang, H. (2024). Exosomes Derived from Adipose Mesenchymal Stem Cells Promote Regeneration of Injured Liver in Minipigs. International Journal of Molecular Sciences, 25(12), 6604. https://doi.org/10.3390/ijms25126604