EGFRvIII Confers Sensitivity to Saracatinib in a STAT5-Dependent Manner in Glioblastoma
Abstract
1. Statement of Implication
2. Introduction
3. Results
3.1. STAT5 Activation Is Induced Downstream of EGFRvIII, Independent of EGF Ligand
3.2. STAT5A and STAT5B Both Augment Proliferation in GBM PDX Models
3.3. Pharmacologic Inhibition of STAT5 Concomitant with TMZ Prolongs Survival In Vivo
3.4. Src Family Kinase Activity Is Required for EGFRvIII/STAT5 Association and STAT5 Phosphorylation
3.5. Apoptosis Induced by Saracatinib in EGFRvIII+ GBM Cells Is Dependent on STAT5A/B Paralogs
3.6. Saracatinib Sensitizes EGFRvIII+ GBM Cells to TMZ and Increases Survival of EGFRvIII+ Tumor-Bearing Mice
4. Discussion
5. Materials and Methods
5.1. Antibodies and Reagents
5.2. Cell Culture
5.3. Expression Constructs and Generation of Isogenic Cell Lines
5.4. Transfection with Small Interfering RNA (siRNA)
5.5. Immunohistochemistry
5.6. Immunoblotting and Immunoprecipitation
5.7. Proliferation Assay and Doubling Time
5.8. In Vivo Studies
5.8.1. Pimozide and TMZ (Figure 2)
5.8.2. Saracatinib and TMZ (Figure 5)
5.9. Activity-Based Protein Profiling
5.10. Liquid Chromatography and Mass Spectrometry
5.11. Protein Identification and Quantification
5.12. Annexin V Assay
5.13. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Lapointe, S.; Perry, A.; Butowski, N.A. Primary brain tumours in adults. Lancet 2018, 392, 432–446. [Google Scholar] [CrossRef] [PubMed]
- Sarkaria, J.N.; Hu, L.S.; Parney, I.F.; Pafundi, D.H.; Brinkmann, D.H.; Laack, N.N.; Giannini, C.; Burns, T.C.; Kizilbash, S.H.; Laramy, J.K.; et al. Is the blood–brain barrier really disrupted in all glioblastomas? A critical assessment of existing clinical data. Neuro-Oncology 2017, 20, 184–191. [Google Scholar] [CrossRef] [PubMed]
- Birzu, C.; French, P.; Caccese, M.; Cerretti, G.; Idbaih, A.; Zagonel, V.; Lombardi, G. Recurrent Glioblastoma: From Molecular Landscape to New Treatment Perspectives. Cancers 2020, 13, 47. [Google Scholar] [CrossRef] [PubMed]
- Blomquist, M.R.; Ensign, S.F.; D’angelo, F.; Phillips, J.J.; Ceccarelli, M.; Peng, S.; Halperin, R.F.; Caruso, F.P.; Garofano, L.; Byron, S.A.; et al. Temporospatial genomic profiling in glioblastoma identifies commonly altered core pathways underlying tumor progression. Neuro-Oncol. Adv. 2020, 2, vdaa078. [Google Scholar] [CrossRef] [PubMed]
- Bradner, J.E.; Hnisz, D.; Young, R.A. Transcriptional Addiction in Cancer. Cell 2017, 168, 629–643. [Google Scholar] [CrossRef] [PubMed]
- Loh, C.-Y.; Arya, A.; Naema, A.F.; Wong, W.F.; Sethi, G.; Looi, C.Y. Signal Transducer and Activator of Transcription (STATs) Proteins in Cancer and Inflammation: Functions and Therapeutic Implication. Front. Oncol. 2019, 9, 48. [Google Scholar] [CrossRef] [PubMed]
- Harrison, D.A. The Jak/STAT pathway. Cold Spring Harb. Perspect. Biol. 2012, 4, a011205. [Google Scholar] [CrossRef]
- Villarino, A.V.; Kanno, Y.; Ferdinand, J.R.; O’shea, J.J. Mechanisms of Jak/STAT Signaling in Immunity and Disease. J. Immunol. 2015, 194, 21–27. [Google Scholar] [CrossRef] [PubMed]
- West, A.J.; Tsui, V.; Stylli, S.S.; Nguyen, H.P.T.; Morokoff, A.P.; Kaye, A.H.; Luwor, R.B. The role of interleukin-6-STAT3 signalling in glioblastoma. Oncol. Lett. 2018, 16, 4095–4104. [Google Scholar] [CrossRef]
- Piperi, C.; Papavassiliou, K.A.; Papavassiliou, A.G. Pivotal Role of STAT3 in Shaping Glioblastoma Immune Microenvironment. Cells 2019, 8, 1398. [Google Scholar] [CrossRef]
- Tan, M.S.Y.; Sandanaraj, E.; Chong, Y.K.; Lim, S.W.; Koh, L.W.H.; Ng, W.H.; Tan, N.S.; Tan, P.; Ang, B.T.; Tang, C. A STAT3-based gene signature stratifies glioma patients for targeted therapy. Nat. Commun. 2019, 10, 3601. [Google Scholar] [CrossRef] [PubMed]
- Groot, J.; Ott, M.; Wei, J.; Kassab, C.; Fang, D.; Najem, H.; O’Brien, B.; Weathers, S.-P.; Matsouka, C.K.; Majd, N.K.; et al. A first-in-human Phase I trial of the oral p-STAT3 inhibitor WP1066 in patients with recurrent malignant glioma. CNS Oncol. 2022, 11, CNS87. [Google Scholar] [CrossRef] [PubMed]
- Roos, A.; Dhruv, H.D.; Peng, S.; Inge, L.J.; Tuncali, S.; Pineda, M.; Millard, N.; Mayo, Z.; Eschbacher, J.M.; Loftus, J.C.; et al. EGFRvIII-Stat5 Signaling Enhances Glioblastoma Cell Migration and Survival. Mol. Cancer Res. 2018, 16, 1185–1195. [Google Scholar] [CrossRef] [PubMed]
- Fan, Q.W.; Cheng, C.K.; Gustafson, W.C.; Charron, E.; Zipper, P.; Wong, R.A.; Chen, J.; Lau, J.; Knobbe-Thomsen, C.; Weller, M.; et al. EGFR phosphorylates tumor-derived EGFRvIII driving STAT3/5 and progression in glioblastoma. Cancer Cell 2013, 24, 438–449. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; Robinson, G.W.; Gouilleux, F.; Groner, B.; Hennighausen, L. Cloning and expression of Stat5 and an additional homologue (Stat5b) involved in prolactin signal transduction in mouse mammary tissue. Proc. Natl. Acad. Sci. USA 1995, 92, 8831–8835. [Google Scholar] [CrossRef] [PubMed]
- Latha, K.; Li, M.; Chumbalkar, V.; Gururaj, A.; Hwang, Y.; Dakeng, S.; Sawaya, R.; Aldape, K.; Cavenee, W.K.; Bogler, O.; et al. Nuclear EGFRvIII-STAT5b complex contributes to glioblastoma cell survival by direct activation of the Bcl-XL promoter. Int. J. Cancer 2013, 132, 509–520. [Google Scholar] [CrossRef] [PubMed]
- Olayioye, M.A.; Beuvink, I.; Horsch, K.; Daly, J.M.; Hynes, N.E. ErbB receptor-induced activation of stat transcription factors is mediated by Src tyrosine kinases. J. Biol. Chem. 1999, 274, 17209–17218. [Google Scholar] [CrossRef] [PubMed]
- Kitange, G.J.; Mladek, A.C.; Carlson, B.L.; Schroeder, M.A.; Pokorny, J.L.; Cen, L.; Decker, P.A.; Wu, W.; Lomberk, G.A.; Gupta, S.K.; et al. Inhibition of histone deacetylation potentiates the evolution of acquired temozolomide resistance linked to MGMT upregulation in glioblastoma xenografts. Clin. Cancer Res. 2012, 18, 4070–4079. [Google Scholar] [CrossRef] [PubMed]
- Pandita, A.; Aldape, K.D.; Zadeh, G.; Guha, A.; James, C.D. Contrasting in vivo and in vitro fates of glioblastoma cell subpopulations with amplified EGFR. Genes Chromosomes Cancer 2004, 39, 29–36. [Google Scholar] [CrossRef]
- An, Z.; Aksoy, O.; Zheng, T.; Fan, Q.W.; Weiss, W.A. Epidermal growth factor receptor and EGFRvIII in glioblastoma: Signaling pathways and targeted therapies. Oncogene 2018, 37, 1561–1575. [Google Scholar] [CrossRef]
- Nelson, E.A.; Walker, S.R.; Weisberg, E.; Bar-Natan, M.; Barrett, R.; Gashin, L.B.; Terrell, S.; Klitgaard, J.L.; Santo, L.; Addorio, M.R.; et al. The STAT5 inhibitor pimozide decreases survival of chronic myelogenous leukemia cells resistant to kinase inhibitors. Blood 2011, 117, 3421–3429. [Google Scholar] [CrossRef] [PubMed]
- Subramaniam, D.; Angulo, P.; Ponnurangam, S.; Dandawate, P.; Ramamoorthy, P.; Srinivasan, P.; Iwakuma, T.; Weir, S.J.; Chastain, K.; Anant, S. Suppressing STAT5 signaling affects osteosarcoma growth and stemness. Cell Death Dis. 2020, 11, 149. [Google Scholar] [CrossRef] [PubMed]
- Li, L.; Puliyappadamba, V.T.; Chakraborty, S.; Rehman, A.; Vemireddy, V.; Saha, D.; Souza, R.F.; Hatanpaa, K.J.; Koduru, P.; Burma, S.; et al. EGFR wild type antagonizes EGFRvIII-mediated activation of Met in glioblastoma. Oncogene 2015, 34, 129–134. [Google Scholar] [CrossRef] [PubMed]
- Vouri, M.; Croucher, D.R.; Kennedy, S.P.; An, Q.; Pilkington, G.J.; Hafizi, S. Axl-EGFR receptor tyrosine kinase hetero-interaction provides EGFR with access to pro-invasive signalling in cancer cells. Oncogenesis 2016, 5, e266. [Google Scholar] [CrossRef] [PubMed]
- Engelman, J.A.; Zejnullahu, K.; Mitsudomi, T.; Song, Y.; Hyland, C.; Park, J.O.; Lindeman, N.; Gale, C.-M.; Zhao, X.; Christensen, J.; et al. MET amplification leads to gefitinib resistance in lung cancer by activating ERBB3 signaling. Science 2007, 316, 1039–1043. [Google Scholar] [CrossRef] [PubMed]
- Taniguchi, H.; Yamada, T.; Wang, R.; Tanimura, K.; Adachi, Y.; Nishiyama, A.; Tanimoto, A.; Takeuchi, S.; Araujo, L.H.; Boroni, M.; et al. AXL confers intrinsic resistance to osimertinib and advances the emergence of tolerant cells. Nat. Commun. 2019, 10, 259. [Google Scholar] [CrossRef]
- Giles, K.M.; Kalinowski, F.C.; Candy, P.A.; Epis, M.R.; Zhang, P.M.; Redfern, A.D.; Stuart, L.M.; Goodall, G.J.; Leedman, P.J. Axl mediates acquired resistance of head and neck cancer cells to the epidermal growth factor receptor inhibitor erlotinib. Mol. Cancer Ther. 2013, 12, 2541–2558. [Google Scholar] [CrossRef] [PubMed]
- Guo, G.; Gong, K.; Ali, S.; Ali, N.; Shallwani, S.; Hatanpaa, K.J.; Pan, E.; Mickey, B.; Burma, S.; Wang, D.H.; et al. A TNF-JNK-Axl-ERK signaling axis mediates primary resistance to EGFR inhibition in glioblastoma. Nat. Neurosci. 2017, 20, 1074–1084. [Google Scholar] [CrossRef]
- Moyama, C.; Fujita, M.; Ando, S.; Taniguchi, K.; Ii, H.; Tanigawa, S.; Hashimoto, N.; Nakata, S. Stat5b inhibition blocks proliferation and tumorigenicity of glioblastoma stem cells derived from a de novo murine brain cancer model. Am. J. Cancer Res. 2022, 12, 1129–1142. [Google Scholar]
- Han, X.; Zhang, W.; Yang, X.; Wheeler, C.G.; Langford, C.P.; Wu, L.; Filippova, N.; Friedman, G.K.; Ding, Q.; Fathallah-Shaykh, H.M.; et al. The role of Src family kinases in growth and migration of glioma stem cells. Int. J. Oncol. 2014, 45, 302–310. [Google Scholar] [CrossRef]
- Stettner, M.R.; Wang, W.; Nabors, L.B.; Bharara, S.; Flynn, D.C.; Grammer, J.R.; Gillespie, G.Y.; Gladson, C.L. Lyn kinase activity is the predominant cellular SRC kinase activity in glioblastoma tumor cells. Cancer Res. 2005, 65, 5535–5543. [Google Scholar] [CrossRef] [PubMed]
- Comba, A.; Dunn, P.J.; Argento, A.E.; Kadiyala, P.; Ventosa, M.; Patel, P.; Zamler, D.B.; Nunez, F.J.; Zhao, L.; Castro, M.G.; et al. Fyn tyrosine kinase, a downstream target of receptor tyrosine kinases, modulates antiglioma immune responses. Neuro Oncol. 2020, 22, 806–818. [Google Scholar] [CrossRef] [PubMed]
- Lewis-Tuffin, L.J.; Feathers, R.; Hari, P.; Durand, N.; Li, Z.; Rodriguez, F.J.; Bakken, K.; Carlson, B.; Schroeder, M.; Sarkaria, J.N.; et al. Src family kinases differentially influence glioma growth and motility. Mol. Oncol. 2015, 9, 1783–1798. [Google Scholar] [CrossRef] [PubMed]
- Kaufman, A.C.; Salazar, S.V.; Haas, L.T.; Yang, J.; Kostylev, M.A.; Jeng, A.T.; Robinson, S.A.; Gunther, E.C.; van Dyck, C.H.; Nygaard, H.B.; et al. Fyn inhibition rescues established memory and synapse loss in Alzheimer mice. Ann. Neurol. 2015, 77, 953–971. [Google Scholar] [CrossRef] [PubMed]
- Baselga, J.; Cervantes, A.; Martinelli, E.; Chirivella, I.; Hoekman, K.; Hurwitz, H.I.; Jodrell, D.I.; Hamberg, P.; Casado, E.; Elvin, P.; et al. Phase I safety, pharmacokinetics, and inhibition of SRC activity study of saracatinib in patients with solid tumors. Clin. Cancer Res. 2010, 16, 4876–4883. [Google Scholar] [CrossRef] [PubMed]
- Lassman, A.B.; Pugh, S.L.; Gilbert, M.R.; Aldape, K.D.; Geinoz, S.; Beumer, J.H.; Christner, S.M.; Komaki, R.; DeAngelis, L.M.; Gaur, R.; et al. Phase 2 trial of dasatinib in target-selected patients with recurrent glioblastoma (RTOG 0627). Neuro Oncol. 2015, 17, 992–998. [Google Scholar] [CrossRef] [PubMed]
- Laack, N.N. Randomized, placebo-controlled, phase II study of dasatinib with standard chemo-radiotherapy for newly diagnosed glioblastoma (GBM), NCCTG N0877 (Alliance). J. Clin. Oncol. 2015, 33, 2013. [Google Scholar] [CrossRef]
- Glassmann, A.; Reichmann, K.; Scheffler, B.; Glas, M.; Veit, N.; Probstmeier, R. Pharmacological targeting of the constitutively activated MEK/MAPK-dependent signaling pathway in glioma cells inhibits cell proliferation and migration. Int. J. Oncol. 2011, 39, 1567–1575. [Google Scholar] [PubMed]
- Dong, C.; Li, X.; Yang, J.; Yuan, D.; Zhou, Y.; Zhang, Y.; Shi, G.; Zhang, R.; Liu, J.; Fu, P.; et al. PPFIBP1 induces glioma cell migration and invasion through FAK/Src/JNK signaling pathway. Cell Death Dis. 2021, 12, 827. [Google Scholar] [CrossRef]
- Vaubel, R.A.; Tian, S.; Remonde, D.; Schroeder, M.A.; Mladek, A.C.; Kitange, G.J.; Caron, A.; Kollmeyer, T.M.; Grove, R.; Peng, S.; et al. Genomic and Phenotypic Characterization of a Broad Panel of Patient-Derived Xenografts Reflects the Diversity of Glioblastoma. Clin. Cancer Res. 2020, 26, 1094–1104. [Google Scholar] [CrossRef]
- Ariyoshi, K.; Nosaka, T.; Yamada, K.; Onishi, M.; Oka, Y.; Miyajima, A.; Kitamura, T. Constitutive activation of STAT5 by a point mutation in the SH2 domain. J. Biol. Chem. 2000, 275, 24407–24413. [Google Scholar] [CrossRef] [PubMed]
- Loftus, J.C.; Yang, Z.; Tran, N.L.; Kloss, J.; Viso, C.; Berens, M.E.; Lipinski, C.A. The Pyk2 FERM domain as a target to inhibit glioma migration. Mol. Cancer Ther. 2009, 8, 1505–1514. [Google Scholar] [CrossRef] [PubMed]
- Lang, J.D.; Hendricks, W.P.D.; Orlando, K.A.; Yin, H.; Kiefer, J.; Ramos, P.; Sharma, R.; Pirrotte, P.; Raupach, E.A.; Sereduk, C.; et al. Ponatinib Shows Potent Antitumor Activity in Small Cell Carcinoma of the Ovary Hypercalcemic Type (SCCOHT) through Multikinase Inhibition. Clin. Cancer Res. 2018, 24, 1932–1943. [Google Scholar] [CrossRef] [PubMed]
- Sharma, R.; Fedorenko, I.; Spence, P.T.; Sondak, V.K.; Smalley, K.S.; Koomen, J.M. Activity-Based Protein Profiling Shows Heterogeneous Signaling Adaptations to BRAF Inhibition. J. Proteome Res. 2016, 15, 4476–4489. [Google Scholar] [CrossRef] [PubMed]





| siRNA | Target Sequence |
|---|---|
| Qiagen siJAK1-5 | ACCGGATGAGGTTCTATTTCA |
| Qiagen siJAK1-6 | CACGGATAACATAGCTTCAT |
| Qiagen siJAK2-6 | CAGAATTAGCAAACCTTATAA |
| Qiagen siJAK2-7 | AGCCATCATACGAGATCTTAA |
| Dharmacon siTYK2-1 | GCACAAGGACCAACGUGUA |
| Dharmacon siTYK2-2 | CAAUCUUGCUGACGUCUUG |
| Qiagen siSTAT5A-2 | AGCGGTCGTGTTGTGAGTTA |
| Qiagen siSTAT5B-2 | CCGAGCGAGATTGTAAACCAT |
| Qiagen siAXL-9 | CCGGTGTTCTAAGATGTGATA |
| Qiagen siAXL-10 | TCCAAGATTCTAGATGATTAA |
| Qiagen siAXL-12 | CACTGTAGTTCTAAGACTCAA |
| Qiagen siAXL-13 | AAAGTCTCTAATTCTATTAAA |
| Qiagen siMET-7 | AACACCCATCCAGAATGTCAT |
| Qiagen siMET-8 | ACCGAGGGAATCATCATGAAA |
| Qiagen siMET-9 | CGCGCCGTGATGAATATCGAA |
| Qiagen siMET-10 | CAACACCCATCCAGAATGTCA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Blomquist, M.R.; Eghlimi, R.; Beniwal, A.; Grief, D.; Nascari, D.G.; Inge, L.; Sereduk, C.P.; Tuncali, S.; Roos, A.; Inforzato, H.; et al. EGFRvIII Confers Sensitivity to Saracatinib in a STAT5-Dependent Manner in Glioblastoma. Int. J. Mol. Sci. 2024, 25, 6279. https://doi.org/10.3390/ijms25116279
Blomquist MR, Eghlimi R, Beniwal A, Grief D, Nascari DG, Inge L, Sereduk CP, Tuncali S, Roos A, Inforzato H, et al. EGFRvIII Confers Sensitivity to Saracatinib in a STAT5-Dependent Manner in Glioblastoma. International Journal of Molecular Sciences. 2024; 25(11):6279. https://doi.org/10.3390/ijms25116279
Chicago/Turabian StyleBlomquist, Mylan R., Ryan Eghlimi, Angad Beniwal, Dustin Grief, David G. Nascari, Landon Inge, Christopher P. Sereduk, Serdar Tuncali, Alison Roos, Hannah Inforzato, and et al. 2024. "EGFRvIII Confers Sensitivity to Saracatinib in a STAT5-Dependent Manner in Glioblastoma" International Journal of Molecular Sciences 25, no. 11: 6279. https://doi.org/10.3390/ijms25116279
APA StyleBlomquist, M. R., Eghlimi, R., Beniwal, A., Grief, D., Nascari, D. G., Inge, L., Sereduk, C. P., Tuncali, S., Roos, A., Inforzato, H., Sharma, R., Pirrotte, P., Mehta, S., Fortin Ensign, S. P., Loftus, J. C., & Tran, N. L. (2024). EGFRvIII Confers Sensitivity to Saracatinib in a STAT5-Dependent Manner in Glioblastoma. International Journal of Molecular Sciences, 25(11), 6279. https://doi.org/10.3390/ijms25116279

