Accumulation of Alpha-Synuclein and Increase in the Inflammatory Response in the substantia nigra, Jejunum, and Colon in a Model of O3 Pollution in Rats
Abstract
1. Introduction
2. Results
2.1. Oxidative Stress Generates an Increase in a-Syn in the substantia nigra, Jejunum, and Colon
2.2. Rela Expression under Exposure to Low Doses of O3
2.3. Effect of O3 Exposure to Low Doses on Interleukin IL-17
3. Discussion
4. Materials and Methods
4.1. Animals
4.2. O3 Exposure
4.3. Immunohistochemistry
4.4. qPCR
4.5. Western Blot
4.6. Statistics
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Mumby, S.; Chung, K.F.; Adcock, I.M. Transcriptional Effects of Ozone and Impact on Airway Inflammation. Front. Immunol. 2019, 10, 1610. [Google Scholar] [CrossRef] [PubMed]
- Suarez, R.G.; Osornio-Vargas, A.R.; Wine, E. Ambient Air Pollution and Pediatric Inflammatory Bowel Diseases: An Updated Scoping Review. Dig. Dis. Sci. 2022, 67, 4342–4354. [Google Scholar] [CrossRef] [PubMed]
- Bello-Medina, P.C.; Rodríguez-Martínez, E.; Prado-Alcalá, R.A.; Rivas-Arancibia, S. Ozone pollution, oxidative stress, synaptic plasticity, and neurodegeneration. Neurol. (Engl. Ed.) 2022, 37, 277–286. [Google Scholar] [CrossRef] [PubMed]
- He, L.; He, T.; Farrar, S.; Ji, L.; Liu, T.; Ma, X. Antioxidants Maintain Cellular Redox Homeostasis by Elimination of Reactive Oxygen Species. Cell. Physiol. Biochem. 2017, 44, 532–553. [Google Scholar] [CrossRef] [PubMed]
- Ajmani, G.S.; Suh, H.H.; Pinto, J.M. Effects of Ambient Air Pollution Exposure on Olfaction: A Review. Environ. Health Perspect. 2016, 124, 1683–1693. [Google Scholar] [CrossRef] [PubMed]
- Molot, J.; Sears, M.; Marshall, L.M.; Bray, R.I. Neurological susceptibility to environmental exposures: Pathophysiological mechanisms in neurodegeneration and multiple chemical sensitivity. Rev. Environ. Health 2022, 37, 509–530. [Google Scholar] [CrossRef] [PubMed]
- Rivas-Arancibia, S.; Miranda-Martínez, A.; Rodríguez-Martínez, E.; Hernández-Orozco, E.; Valdés-Fuentes, M.; De la Rosa-Sierra, R. Ozone Environmental Pollution: Relationship between the Intestine and Neurodegenerative Diseases. Antioxidants 2023, 12, 1323. [Google Scholar] [CrossRef] [PubMed]
- Velázquez-Pérez, R.; Rodríguez-Martínez, E.; Valdés-Fuentes, M.; Gelista-Herrera, N.; Gómez-Crisóstomo, N.; Rivas-Arancibia, S. Oxidative Stress Caused by Ozone Exposure Induces Changes in P2X7 Receptors, Neuroinflammation, and Neurodegeneration in the Rat Hippocampus. Oxid. Med. Cell. Longev. 2021, 2021, 3790477. [Google Scholar] [CrossRef]
- Weaver, C.T.; Elson, C.O.; Fouser, L.A.; Kolls, J.K. The Th17 pathway and inflammatory diseases of the intestines, lungs, and skin. Annu. Rev. Pathol. 2013, 8477–8512. [Google Scholar] [CrossRef]
- Zhong, Z.; Su, G.; Kijlstra, A.; Yang, P. Activation of the interleukin-23/interleukin-17 signalling pathway in autoinflammatory and autoimmune uveitis. Prog. Retin. Eye Res. 2021, 80, 100866. [Google Scholar] [CrossRef]
- Asahina, R.; Kamishina, H.; Kamishina, H.; Maeda, S. Gene transcription of pro-inflammatory cytokines and chemokines induced by IL-17A in canine keratinocytes. Vet. Dermatol. 2015, 26, 426–431.e100. [Google Scholar] [CrossRef] [PubMed]
- Carpenter, S.; Fitzgerald, K.A. Transcription of inflammatory genes: Long noncoding RNA and beyond. J. Interferon Cytokine Res. 2015, 35, 79–88. [Google Scholar] [CrossRef] [PubMed]
- De Simone, V.; Franzè, E.; Ronchetti, G.; Colantoni, A.; Fantini, M.C.; Di Fusco, D.; Sica, G.S.; Sileri, P.; MacDonald, T.T.; Pallone, F.; et al. Th17-type cytokines, IL-6 and TNF-α synergistically activate STAT3 and NF-kB to promote colorectal cancer cell growth. Oncogene 2015, 34, 3493–3503. [Google Scholar] [CrossRef] [PubMed]
- Vilar, M.; Chou, H.T.; Lührs, T.; Maji, S.K.; Riek-Loher, D.; Verel, R.; Manning, G.; Stahlberg, H.; Riek, R. The fold of alpha-synuclein fibrils. Proc. Natl. Acad. Sci. USA 2008, 105, 8637–8642. [Google Scholar] [CrossRef] [PubMed]
- Nishikawa, Y.; Choudhury, M.E.; Mikami, K.; Matsuura, T.; Kubo, M.; Nagai, M.; Yamagishi, S.; Doi, T.; Hisai, M.; Yamamoto, H.; et al. Anti-inflammatory effects of dopamine on microglia and a D1 receptor agonist ameliorates neuroinflammation of the brain in a rat delirium model. Neurochem. Int. 2023, 163, 105479. [Google Scholar] [CrossRef] [PubMed]
- Albertini, G.; Etienne, F.; Roumier, A. Regulation of microglia by neuromodulators: Modulations in major and minor modes. Neurosci. Lett. 2020, 733, 135000. [Google Scholar] [CrossRef]
- Xia, Q.P.; Cheng, Z.Y.; He, L. The modulatory role of dopamine receptors in brain neuroinflammation. Int. Immunopharmacol. 2019, 76, 105908. [Google Scholar] [CrossRef]
- Sengupta, U.; Kayed, R. Amyloid β, Tau, and α-Synuclein aggregates in the pathogenesis, prognosis, and therapeutics for neurodegenerative diseases. Prog. Neurobiol. 2022, 214, 102270. [Google Scholar] [CrossRef] [PubMed]
- Codolo, G.; Plotegher, N.; Pozzobon, T.; Brucale, M.; Tessari, I.; Bubacco, L.; de Bernard, M. Triggering of inflammasome by aggregated α-synuclein, an inflammatory response in synucleinopathies. PLoS ONE. 2013, 8, e55375. [Google Scholar] [CrossRef]
- Hirsch, E.C.; Vyas, S.; Hunot, S. Neuroinflammation in Parkinson’s disease. Park. Relat. Disord. 2012, 18 (Suppl. S1), S210–S212. [Google Scholar] [CrossRef]
- Challis, C.; Hori, A.; Sampson, T.R.; Yoo, B.B.; Challis, R.C.; Hamilton, A.M.; Mazmanian, S.K.; Volpicelli-Daley, L.A.; Gradinaru, V. Gut-seeded α-synuclein fibrils promote gut dysfunction and brain pathology specifically in aged mice. Nat. Neurosci. 2020, 23, 327–336. [Google Scholar] [CrossRef]
- Sacino, A.N.; Brooks, M.; Thomas, M.A.; McKinney, A.B.; Lee, S.; Regenhardt, R.W.; McGarvey, N.H.; Ayers, J.I.; Notterpek, L.; Borchelt, D.R.; et al. Intramuscular injection of α-synuclein induces CNS α-synuclein pathology and a rapid-onset motor phenotype in transgenic mice. Proc. Natl. Acad. Sci. USA 2014, 111, 10732–10737. [Google Scholar] [CrossRef] [PubMed]
- Luk, K.C.; Song, C.; O’Brien, P.; Stieber, A.; Branch, J.R.; Brunden, K.R.; Trojanowski, J.Q.; Lee, V.M. Exogenous alpha-synuclein fibrils seed the formation of Lewy body-like intracellular inclusions in cultured cells. Proc. Natl. Acad. Sci. USA 2009, 106, 20051–20056. [Google Scholar] [CrossRef]
- Mayer, E.A.; Tillisch, K.; Gupta, A. Gut/brain axis and the microbiota. J. Clin. Investig. 2015, 125, 926–938. [Google Scholar] [CrossRef]
- Muhammad, F.; Fan, B.; Wang, R.; Ren, J.; Jia, S.; Wang, L.; Chen, Z.; Liu, X.A. The Molecular Gut-Brain Axis in Early Brain Development. Int. J. Mol. Sci. 2022, 23, 15389. [Google Scholar] [CrossRef] [PubMed]
- Dowling, L.R.; Strazzari, M.R.; Keely, S.; Kaiko, G.E. Enteric nervous system and intestinal epithelial regulation of the gut-brain axis. J. Allergy Clin. Immunol. 2022, 150, 513–522. [Google Scholar] [CrossRef] [PubMed]
- Fung, T.C. The microbiota-immune axis as a central mediator of gut-brain communication. Neurobiol. Dis. 2020, 136, 104714. [Google Scholar] [CrossRef] [PubMed]
- Berthouzoz, E.; Lazarevic, V.; Zekeridou, A.; Castro, M.; Debove, I.; Aybek, S.; Schrenzel, J.; Burkhard, P.R.; Fleury, V. Oral and intestinal dysbiosis in Parkinson’s disease. Rev. Neurol. 2023, 179, 937–946. [Google Scholar] [CrossRef]
- Weiss, G.A.; Hennet, T. Mechanisms and consequences of intestinal dysbiosis. Cell. Mol. Life Sci. 2017, 74, 2959–2977. [Google Scholar] [CrossRef]
- Wang, R.; Ren, H.; Kaznacheyeva, E.; Lu, X.; Wang, G. Association of Glial Activation and α-Synuclein Pathology in Parkinson’s Disease. Neurosci. Bull. 2023, 39, 479–490. [Google Scholar] [CrossRef]
- Misra, D.P.; Agarwal, V. Th17.1 lymphocytes: Emerging players in the orchestra of immune-mediated inflammatory diseases. Clin. Rheumatol. 2022, 41, 2297–2308. [Google Scholar] [CrossRef] [PubMed]
- Zi, C.; Wang, D.; Gao, Y.; He, L. The role of Th17 cells in endocrine organs: Involvement of the gut, adipose tissue, liver and bone. Front. Immunol. 2022, 13, 1104943. [Google Scholar] [CrossRef] [PubMed]
- Ahmadi, A.; Niknahad, H.; Li, H.; Mobasheri, A.; Manthari, R.K.; Azarpira, N.; Mousavi, K.; Khalvati, B.; Zhao, Y.; Sun, J.; et al. The inhibition of NFκB signaling and inflammatory response as a strategy for blunting bile acid-induced hepatic and renal toxicity. Toxicol. Lett. 2021, 34912–34929. [Google Scholar] [CrossRef] [PubMed]
- Singh, A.; Nisaa, K.; Bhattacharyya, S.; Mallick, A.I. Immunogenicity and protective efficacy of mucosal delivery of recombinant hcp of Campylobacter jejuni Type VI secretion system (T6SS) in chickens. Mol. Immunol. 2019, 111, 182–197. [Google Scholar] [CrossRef] [PubMed]
- Tang, J.; Xu, L.; Zeng, Y.; Gong, F. Effect of gut microbiota on LPS-induced acute lung injury by regulating the TLR4/NF-kB signaling pathway. Int. Immunopharmacol. 2021, 91, 107272. [Google Scholar] [CrossRef] [PubMed]
- Choi, I.; Seegobin, S.P.; Liang, D.; Yue, Z. Synucleinphagy: A microglial “community cleanup program” for neuroprotection. Autophagy 2020, 16, 1718–1720. [Google Scholar] [CrossRef] [PubMed]
- Jackson, T.W.; House, J.S.; Henriquez, A.R.; Schladweiler, M.C.; Jackson, K.M.; Fisher, A.A.; Snow, S.J.; Alewel, D.I.; Motsinger-Reif, A.A.; Kodavanti, U.P. Multi-tissue transcriptomic and serum metabolomic assessment reveals systemic implications of acute ozone-induced stress response in male Wistar Kyoto rats. Metabolomics 2023, 19, 81. [Google Scholar] [CrossRef] [PubMed]
- Singh, A.; Kukreti, R.; Saso, L.; Kukreti, S. Oxidative Stress: A Key Modulator in Neurodegenerative Diseases. Molecules 2019, 24, 1583. [Google Scholar] [CrossRef] [PubMed]
- Mollenhauer, B.; Locascio, J.J.; Schulz-Schaeffer, W.; Sixel-Döring, F.; Trenkwalder, C.; Schlossmacher, M.G. α-Synuclein and tau concentrations in cerebrospinal fluid of patients presenting with parkinsonism: A cohort study. Lancet Neurol. 2011, 10, 230–240. [Google Scholar] [CrossRef]
- Pereyra-Muñoz, N.; Rugerio-Vargas, C.; Angoa-Pérez, M.; Borgonio-Pérez, G.; Rivas-Arancibia, S. Oxidative damage in substantia nigra and striatum of rats chronically exposed to ozone. J. Chem. Neuroanat. 2006, 31, 114–123. [Google Scholar] [CrossRef]
- Ohlsson, B.; Englund, E. Atrophic Myenteric and Submucosal Neurons Are Observed in Parkinson’s Disease. Park. Dis. 2019, 2019, 7935820. [Google Scholar] [CrossRef] [PubMed]
- Dumitrescu, L.; Marta, D.; Dănău, A.; Lefter, A.; Tulbă, D.; Cozma, L.; Manole, E.; Gherghiceanu, M.; Ceafalan, L.C.; Popescu, B.O. Serum and Fecal Markers of Intestinal Inflammation and Intestinal Barrier Permeability Are Elevated in Parkinson’s Disease. Front. Neurosci. 2021, 15, 689723. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Chen, Y.; Jiang, L.; Zhang, J.; Tong, X.; Chen, D.; Le, W. Intestinal Inflammation and Parkinson’s Disease. Aging Dis. 2021, 12, 2052–2068. [Google Scholar] [CrossRef] [PubMed]
- Bencsik, A.; Muselli, L.; Leboidre, M.; Lakhdar, L.; Baron, T. Early and persistent expression of phosphorylated α-synuclein in the enteric nervous system of A53T mutant human α-synuclein transgenic mice. J. Neuropathol. Exp. Neurol. 2014, 73, 1144–1151. [Google Scholar] [CrossRef] [PubMed]
- Hawkes, C.H.; Del Tredici, K.; Braak, H. Parkinson’s disease: The dual hit theory revisited. Ann. N. Y. Acad. Sci. 2009, 1170, 615–622. [Google Scholar] [CrossRef] [PubMed]
- Mulero, M.C.; Bigas, A.; Espinosa, L. IκBα beyond the NF-kB dogma. Oncotarget 2013, 4, 1550–1551. [Google Scholar] [CrossRef] [PubMed]
- Zinatizadeh, M.R.; Schock, B.; Chalbatani, G.M.; Zarandi, P.K.; Jalali, S.A.; Miri, S.R. The Nuclear Factor Kappa B (NF-kB) signaling in cancer development and immune diseases. Genes Dis. 2021, 8, 287–297. [Google Scholar] [CrossRef]
- Arimilli, S.; Johnson, J.B.; Alexander-Miller, M.A.; Parks, G.D. TLR-4 and -6 agonists reverse apoptosis and promote maturation of simian virus 5-infected human dendritic cells through NFkB-dependent pathways. Virology 2007, 365, 144–156. [Google Scholar] [CrossRef] [PubMed]
- Atarashi, K.; Tanoue, T.; Ando, M.; Kamada, N.; Nagano, Y.; Narushima, S.; Suda, W.; Imaoka, A.; Setoyama, H.; Nagamori, T.; et al. Th17 Cell Induction by Adhesion of Microbes to Intestinal Epithelial Cells. Cell 2015, 163, 367–380. [Google Scholar] [CrossRef]
- Wu, B.; Wan, Y. Molecular control of pathogenic Th17 cells in autoimmune diseases. Int. Immunopharmacol. 2020, 80, 106187. [Google Scholar] [CrossRef]
- Shi, Y.; Wei, B.; Li, L.; Wang, B.; Sun, M. Th17 cells and inflammation in neurological disorders: Possible mechanisms of action. Front. Immunol. 2022, 13, 932152. [Google Scholar] [CrossRef] [PubMed]
- Lan, G.; Wang, P.; Chan, R.B.; Liu, Z.; Yu, Z.; Liu, X.; Yang, Y.; Zhang, J. Astrocytic VEGFA: An essential mediator in blood-brain-barrier disruption in Parkinson’s disease. Glia 2022, 70, 337–353. [Google Scholar] [CrossRef] [PubMed]
- Kim, S.; Kwon, S.H.; Kam, T.I.; Panicker, N.; Karuppagounder, S.S.; Lee, S.; Lee, J.H.; Kim, W.R.; Kook, M.; Foss, C.A.; et al. Transneuronal Propagation of Pathologic α-Synuclein from the Gut to the Brain Models Parkinson’s Disease. Neuron 2019, 103, 627–641.e627. [Google Scholar] [CrossRef] [PubMed]
- Rivas-Arancibia, S.; Guevara-Guzmán, R.; López-Vidal, Y.; Rodríguez-Martínez, E.; Zanardo-Gomes, M.; Angoa-Pérez, M.; Raisman-Vozari, R. Oxidative stress caused by ozone exposure induces loss of brain repair in the hippocampus of adult rats. Toxicol. Sci. 2010, 113, 187–197. [Google Scholar] [CrossRef]





| Name | Sequence |
|---|---|
| Snca | Forward: GCCTTTCACCCCTCTTGCAT |
| Reverse: TATCTTTGCTCCACACGGCT | |
| Rela | Forward: CTT CTG GGC CAT ATG TGG AGA T |
| Reverse: TCG CAC TTG TAA CGG AAA CG | |
| IL17 | Forward: ACT TTC CGG GTG GAG AAG AT |
| Reverse: CTT AGG GGC TAG CCT CAG GT | |
| Rps18 | Forward: TTC AGC ACA TCC TGC GAG TA |
| Reverse: TTG GTG AGG TCA ATG TCT GC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Valdés-Fuentes, M.; Rodríguez-Martínez, E.; Rivas-Arancibia, S. Accumulation of Alpha-Synuclein and Increase in the Inflammatory Response in the substantia nigra, Jejunum, and Colon in a Model of O3 Pollution in Rats. Int. J. Mol. Sci. 2024, 25, 5526. https://doi.org/10.3390/ijms25105526
Valdés-Fuentes M, Rodríguez-Martínez E, Rivas-Arancibia S. Accumulation of Alpha-Synuclein and Increase in the Inflammatory Response in the substantia nigra, Jejunum, and Colon in a Model of O3 Pollution in Rats. International Journal of Molecular Sciences. 2024; 25(10):5526. https://doi.org/10.3390/ijms25105526
Chicago/Turabian StyleValdés-Fuentes, Marlen, Erika Rodríguez-Martínez, and Selva Rivas-Arancibia. 2024. "Accumulation of Alpha-Synuclein and Increase in the Inflammatory Response in the substantia nigra, Jejunum, and Colon in a Model of O3 Pollution in Rats" International Journal of Molecular Sciences 25, no. 10: 5526. https://doi.org/10.3390/ijms25105526
APA StyleValdés-Fuentes, M., Rodríguez-Martínez, E., & Rivas-Arancibia, S. (2024). Accumulation of Alpha-Synuclein and Increase in the Inflammatory Response in the substantia nigra, Jejunum, and Colon in a Model of O3 Pollution in Rats. International Journal of Molecular Sciences, 25(10), 5526. https://doi.org/10.3390/ijms25105526

