Anti-Aging Effect of Hemerocallis citrina Baroni Polysaccharide-Rich Extract on Caenorhabditis elegans
Abstract
:1. Introduction
2. Results
2.1. Extraction and Component Analysis of HCPRE
2.2. Antioxidant Properties of HCPRE In Vitro
2.3. Effects of HCPRE on Body Length, Spawning Capacity, and Longevity of C. elegans
2.4. Effects of HCPRE on C. elegans under Acute Stress
2.5. Effect of HCPRE on Antioxidant Properties of C. elegans In Vivo
2.6. Effects of HCPRE on Gene Expression in C. elegans In Vivo
2.6.1. Effect of HCPRE on the Expression of Longevity-Related Genes in C. elegans
2.6.2. Effect of HCPRE on the Expression of CAT-Related Genes in C. elegans
2.6.3. Effect of HCPRE on the Expression of SOD-Related Genes in C. elegans
2.6.4. Effect of HCPRE on the Expression of Thermal-Stress-Related Genes in C. elegans
2.6.5. Effect of HCPRE on the Expression of Oxidative-Stress-Related Genes in C. elegans
3. Discussion
4. Materials and Methods
4.1. Reagents
4.2. Preparation of HCPRE
4.3. Determination of the Extraction Yield and Physicochemical Properties of HCPRE [59]
4.3.1. Determination of Extraction Yield of HCPRE
4.3.2. Determination of Protein Content of HCPRE
4.3.3. Determination of Total Phenolic Acid Content of HCPRE
4.3.4. Determination of Glucuronide Content of HCPRE
4.3.5. Starch Assay for HCPRE
4.3.6. Reducing Sugar Assay for HCPRE
4.3.7. Determination of Molecular Weight of HCPRE
4.3.8. Determination of the Monosaccharide Fraction of HCPRE
4.3.9. Determination of Antioxidant Capacity of HCPRE In Vitro [60]
Measurement of 1,1-Diphenyl-2-picrylhydrazyl (DPPH) Radical Scavenging Activity
Measurement of Total Reducing Power
4.4. Culture of E. coli
4.5. Culture and Treatment of C. elegans
4.6. Length, Spawning Capacity, and Longevity Measurements
4.7. Acute Heat Stress Experiment
4.8. Acute Oxidative Stress Experiment
4.9. Measurement of ROS Levels and CAT and SOD Activities In Vivo
4.10. Quantitative Reverse Transcription-PCR
4.11. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Koltover, V.K. Redox timer of aging: From free radical chemistry to systems theory of reliability. Free Radic. Biol. Med. 2017, 112, 53–54. [Google Scholar] [CrossRef]
- Doan, V.M.; Chen, C.X.; Lin, X.; Nguyen, V.P.; Nong, Z.H.; Li, W.S.; Chen, Q.Q.; Ming, J.J.; Xie, Q.Q.; Huang, R.B. Yulangsan polysaccharide improves redox homeostasis and immune impairment in D-galactose-induced mimetic aging. Food Funct. 2021, 12, 5668. [Google Scholar] [CrossRef]
- Ma, Q. Advances in Mechanisms of Anti-oxidation. Discov. Med. 2014, 17, 121–130. [Google Scholar]
- Koltover, V.K. Free Radical Timer of Aging: From Chemistry of Free Radicals to Systems Theory of Reliability. Curr. Aging Sci. 2017, 10, 12–17. [Google Scholar] [CrossRef]
- Zhu, Y.L.; Yu, X.F.; Ge, Q.; Li, J.; Wang, D.J.; Wei, Y.; Ouyang, Z. Antioxidant and anti-aging activities of polysaccharides from Cordyceps cicadae. Int. J. Biol. Macromol. 2020, 157, 394–400. [Google Scholar] [CrossRef]
- Wang, X.M.; Zhang, Z.S.; Zhou, H.C.; Sun, X.; Chen, X.P.; Xu, N.J. The anti-aging effects of Gracilaria lemaneiformis polysaccharide in Caenorhabditis elegans. Int. J. Biol. Macromol. 2019, 140, 600–604. [Google Scholar] [CrossRef]
- Hui, Y.; Hua, J.L.; Wang, C. Anti-oxidation and anti-aging activity of polysaccharide from Malus micromalus Makino fruit wine. Int. J. Biol. Macromol. 2019, 121, 1203–1212. [Google Scholar] [CrossRef]
- Matraszek-Gawron, R.; Chwil, M.; Terlecka, P.; Skoczylas, M.M. Recent Studies on Anti-Depressant Bioactive Substances in Selected Species from the Genera Hemerocallis and Gladiolus: A Systematic Review. Pharmaceuticals 2019, 12, 172. [Google Scholar] [CrossRef]
- Zhou, X.L.; Zhu, S.Y.; Wei, J.N.; Zhou, Y.M. Volatile metabolomics and chemometric study provide insight into the formation of the characteristic cultivar aroma of Hemerocallis. Food Chem. 2023, 404, 134495. [Google Scholar] [CrossRef]
- Li, C.F.; Chen, X.Q.; Chen, S.M.; Chen, X.M.; Di, G.; Liu, Q.; Yi, L.T. Evaluation of the toxicological properties and anti-inflammatory mechanism of Hemerocallis citrina in LPS-induced depressive-like mice. Biomed. Pharmacother. 2017, 91, 167–173. [Google Scholar] [CrossRef]
- Mori, S.; Takizawa, M.; Satou, M.; Sakasai, M.; Kusuoku, H.; Nojiri, H.; Yoshizuka, N.; Hotta, M.; Kitahara, T.; Hase, T.; et al. Enhancement of Lipolytic Responsiveness of Adipocytes by Novel Plant Extract in Rat. Exp. Biol. Med. 2009, 234, 1445–1449. [Google Scholar] [CrossRef]
- Cichewicz, R.H.; Zhang, Y.J.; Seeram, N.P.; Nair, M.G. Inhibition of human tumor cell proliferation by novel anthraquinones from daylilies. Life Sci. 2004, 74, 1791–1799. [Google Scholar] [CrossRef]
- Wang, J.; Hu, D.M.; Hou, J.; Li, S.S.; Wang, W.P.; Li, J.; Bai, J. Ethyl Acetate Fraction of Hemerocallis citrina Baroni Decreases Tert-butyl Hydroperoxide-Induced Oxidative Stress Damage in BRL-3A Cells. Oxidative Med. Cell. Longev. 2018, 2018, 1526125. [Google Scholar] [CrossRef]
- Dhananjeyan, M.R.; Milev, Y.P.; Kron, M.A.; Nair, M.G. Synthesis and activity of substituted anthraquinones against a human filarial parasite, Brugia malayi. J. Med. Chem. 2005, 48, 2822–2830. [Google Scholar] [CrossRef]
- Huang, H.Y.; Li, Y.B. The effect of flavonoe of active ingredient in Hemerocallis fulva antiatherosclerotic to diabetic rats. J. Hunan Environ.-Biol. Polytech. 2010, 16, 26–28. [Google Scholar] [CrossRef]
- Zhou, J.D.; Li, Y.D. Study on determination and antioxidant activity of polysaccharides from different organs in daylily. J. Ningbo Polytech. 2014, 18, 95–98. [Google Scholar] [CrossRef]
- Liu, Y.Z.; Liu, P.Z.; Zhao, Y.M.; Cao, J.K. Caracterization and Antioxidant Activity Analysis of Daylily Polysaccharides. Sci. Technol. Food Ind. 2022, 43, 54–61. [Google Scholar] [CrossRef]
- Ti, Y.; Zhang, Y.; Ban, Y.; Wang, X.; Hou, Y.; Song, Z. Polysaccharide from Hemerocallis citrina Borani by subcritical water with different temperatures and investigation of its physicochemical properties and antioxidant activity. Front. Nutr. 2022, 9, 982695. [Google Scholar] [CrossRef]
- Shen, P.; Yue, Y.; Zheng, J.; Park, Y. Caenorhabditis elegans: A Convenient In Vivo Model for Assessing the Impact of Food Bioactive Compounds on Obesity, Aging, and Alzheimer’s Disease. Annu. Rev. Food Sci. Technol. 2018, 9, 1–22. [Google Scholar] [CrossRef]
- Butcher, R.A. Small-molecule pheromones and hormones controlling nematode development. Nat. Chem. Biol. 2017, 13, 577–586. [Google Scholar] [CrossRef]
- Wang, Y.C. Study on the Physiological Effects of Fruit Fermentation Broth on Anti-Aging with Caenorhabditis elegans as Model. Master’s Thesis, Jilin University, Changchun, China, 2023. [Google Scholar]
- Nandi, A.; Yan, L.J.; Jana, C.K.; Das, N. Role of Catalase in Oxidative Stress- and Age-Associated Degenerative Diseases. Oxid. Med. Cell Longev. 2019, 2019, 9613090. [Google Scholar] [CrossRef]
- Azarabadi, S.; Abdollahi, H.; Torabi, M.; Salehi, Z.; Nasiri, J. ROS generation, oxidative burst and dynamic expression profiles of ROS-scavenging enzymes of superoxide dismutase (SOD), catalase (CAT) and ascorbate peroxidase (APX) in response to Erwinia amylovora in pear (Pyrus communis L.). Eur. J. Plant Pathol. 2017, 147, 279–294. [Google Scholar] [CrossRef]
- Valko, M.; Leibfritz, D.; Moncol, J.; Cronin, M.T.; Mazur, M.; Telser, J. Free radicals and antioxidants in normal physiological functions and human disease. Int. J. Biochem. Cell Biol. 2007, 39, 44–84. [Google Scholar] [CrossRef]
- Cabiscol, E.; Tamarit, J.; Ros, J. Oxidative stress in bacteria and protein damage by reactive oxygen species. Int. Microbiol. 2000, 3, 3–8. [Google Scholar]
- Ji, X.; Hou, C.; Yan, Y.; Shi, M.; Liu, Y. Comparison of structural characterization and antioxidant activity of polysaccharides from jujube (Ziziphus jujuba Mill.) fruit. Int. J. Biol. Macromol. 2020, 149, 1008–1018. [Google Scholar] [CrossRef]
- Ye, M.Z.; Wu, Z.Y.; Wu, J.S.; Zhong, Q.P. Sudy on Separation, Purification, Structural Characteristics and in Vitro Antioxidant Activity of Polysaccharides from Chinese Yam Peel. Sci. Technol. Food Ind. 2023, 44, 78–85. [Google Scholar] [CrossRef]
- Shao, X.Y. Biological Effects of Water-Soluble Polysaccharide from Pueraria lobata and the Mechanism of Extending C. elegans Lifespan under Heat Stress. Master’s Thesis, University of Science and Technology of China, Hefei, China, 2020. [Google Scholar]
- Zhao, Z.Y.; Huangfu, L.T.; Dong, L.L.; Liu, S.L. Functional groups and antioxidant activities of polysaccharides from five categories of tea. Ind. Crops Prod. 2014, 58, 31–35. [Google Scholar] [CrossRef]
- Xiong, B.; Zhang, W.; Wu, Z.; Liu, R.; Yang, C.; Hui, A.; Huang, X.; Xian, Z. Preparation, characterization, antioxidant and anti-inflammatory activities of acid-soluble pectin from okra (Abelmoschus esculentus L.). Int. J. Biol. Macromol. 2021, 181, 824–834. [Google Scholar] [CrossRef]
- Lv, Z.Y.; Meng, J.; Sun, C.X.; Chen, C. Effect of Goji Berries (Lycium barbarum) on Lifespan and Spawning of Caenorhabditis elegans and Its Antioxidant Capacity. Food Sci. 2019, 40, 183–188. [Google Scholar] [CrossRef]
- Li, Z.J.; Zhang, J.Y.; Wang, C.L.; Chen, M.H.; Wang, Y.R.; Lu, C. Effects of four toxic herbs on lethality and egg production in C. elegans. J. Toxicol. 2013, 027, 297–299. [Google Scholar]
- Li, Z.W. Anti-Aging Effect of Red Deer (Cervus elaphus) Antler Water Extract on Caenorhabditis elegans. Master’s Thesis, Changchun University of Technology, Changchun, China, 2022. [Google Scholar]
- Liu, C.; Xu, Y.; Shan, C.Y.; Zhu, C.L.; Zhao, F.; Zhang, H.S. Exploring the Antioxidant Activity in Vivo ofCoriander Extract in Caenorhabditis elegans. Food Ind. Sci. Technol. 2020, 41, 285–289. [Google Scholar] [CrossRef]
- Kimura, K.D.; Tissenbaum, H.A.; Liu, Y.; Ruvkun, G. daf-2, an insulin receptor-like gene that regulates longevity and diapause in Caenorhabditis elegans. Science 1997, 277, 942–946. [Google Scholar] [CrossRef]
- Bai, M.; Vozdek, R.; Hnízda, A.; Jiang, C.; Wang, B.; Kuchar, L.; Li, T.; Zhang, Y.; Wood, C.; Feng, L.; et al. Conserved roles of C. elegans and human MANFs in sulfatide binding and cytoprotection. Nat. Commun. 2018, 9, 897. [Google Scholar] [CrossRef]
- Ayuda-Durán, B.; González-Manzano, S.; González-Paramás, A.M.; Santos-Buelga, C. Caernohabditis elegans as a Model Organism to Evaluate the Antioxidant Effects of Phytochemicals. Molecules 2020, 25, 3194. [Google Scholar] [CrossRef]
- Wang, X.; Li, H.; Liu, Y.; Wu, H.; Wang, H.; Jin, S.; Lu, Y.; Chang, S.; Liu, R.; Peng, Y.; et al. Velvet antler methanol extracts (MEs) protects against oxidative stress in Caenorhabditis elegans by SKN-1. Biomed. Pharmacother. 2020, 121, 109668. [Google Scholar] [CrossRef]
- Grushko, D.; Boocholez, H.; Levine, A.; Cohen, E. Temporal requirements of SKN-1/NRF as a regulator of lifespan and proteostasis in Caenorhabditis elegans. PLoS ONE 2021, 16, e0243522. [Google Scholar] [CrossRef]
- Liao, V.H.C.; Yu, C.W. Caenorhabditis elegans gcs-1 confers resistance to arsenic-induced oxidative stress. Biometals 2005, 18, 519–528. [Google Scholar] [CrossRef]
- Wang, C.; An, J.; Bai, Y.C.; Li, H.; Chen, H.B.; Ou, D.; Liu, Y.D. Tris(1,3-dichloro-2-propyl) phosphate accelerated the aging process induced by the 4-hydroxynon-2-enal response to reactive oxidative species in Caenorhabditis elegans. Environ. Pollut. 2019, 246, 904–913. [Google Scholar] [CrossRef]
- Savion, N.; Levine, A.; Kotev-Emeth, S.; Bening Abu-Shach, U.; Broday, L. S-allylmercapto-N-acetylcysteine protects against oxidative stress and extends lifespan in Caenorhabditis elegans. PLoS ONE 2018, 13, e0194780. [Google Scholar] [CrossRef]
- Li, H.Y.; Su, L.P.; Su, X.; Liu, X.; Wang, D.; Li, H.M.; Ba, X.Q.; Zhang, Y.; Lu, J.; Huang, B.Q.; et al. Arginine methylation of SKN-1 promotes oxidative stress resistance in Caenorhabditis elegans. Redox Biol. 2019, 21, 101111. [Google Scholar] [CrossRef] [PubMed]
- Ayyadevara, S.; Bharill, P.; Dandapat, A.; Hu, C.P.; Khaidakov, M.; Mitra, S.; Reis, R.J.S.; Mehta, J.L. Aspirin Inhibits Oxidant Stress, Reduces Age-Associated Functional Declines, and Extends Lifespan of Caenorhabditis elegans. Antioxid. Redox Signal. 2013, 18, 481–490. [Google Scholar] [CrossRef] [PubMed]
- Ayyadevara, S.; Engle, M.R.; Singh, S.P.; Dandapat, A.; Lichti, C.F.; Benes, H.; Reis, R.J.S.; Liebau, E.; Zimniak, P. Lifespan and stress resistance of Caenorhabditis elegans are increased by expression of glutathione transferases capable of metabolizing the lipid peroxidation product 4-hydroxynonenal. Aging Cell 2005, 4, 257–271. [Google Scholar] [CrossRef] [PubMed]
- Voellmy, R.; Zürcher, O.; Zürcher, M.; de Viragh, P.A.; Hall, A.K.; Roberts, S.M. Targeted heat activation of HSP promoters in the skin of mammalian animals and humans. Cell Stress Chaperones 2018, 23, 455–466. [Google Scholar] [CrossRef] [PubMed]
- Guha, S.; Fischer, S.; Cheng, A.; Johnson, G.V.W.; Nehrke, K. A T231E Mutant that Mimics Pathologic Phosphorylation of Tau in Alzheimer’s disease Causes Activation of the Mitochondrial Unfolded Protein Response in C. elegans touch neurons. MicroPubl Biol. 2020, 2020. [Google Scholar] [CrossRef]
- Liu, S.; Saul, N.; Pan, B.; Menzel, R.; Steinberg, C.E. The non-target organism Caenorhabditis elegans withstands the impact of sulfamethoxazole. Chemosphere 2013, 93, 2373–2380. [Google Scholar] [CrossRef] [PubMed]
- Fridovich, I. The biology of oxygen radicals. Science 1978, 201, 875–880. [Google Scholar] [CrossRef] [PubMed]
- Kronberg, M.F.; Clavijo, A.; Moya, A.; Rossen, A.; Calvo, D.; Pagano, E.; Munarriz, E. Glyphosate-based herbicides modulate oxidative stress response in the nematode Caenorhabditis elegans. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 2018, 214, 1–8. [Google Scholar] [CrossRef]
- Liu, F.W.; Zaman, W.Q.; Peng, H.J.; Li, C.; Cao, X.; Huang, K.; Cui, C.Z.; Zhang, W.; Lin, K.F.; Luo, Q.S. Ecotoxicity of Caenorhabditis elegans following a step and repeated chronic exposure to tetrabromobisphenol A. Ecotoxicol. Environ. Saf. 2019, 169, 273–281. [Google Scholar] [CrossRef]
- Li, W.; Li, Z.Y.; Peng, M.J.; Zhang, X.Y.; Chen, Y.J.; Yang, Y.Y.; Zhai, X.X.; Liu, G.; Cao, Y. Oenothein B boosts antioxidant capacity and supports metabolic pathways that regulate antioxidant defense in Caenorhabditis elegans. Food Funct. 2020, 11, 9157–9167. [Google Scholar] [CrossRef]
- Li, J.; Lin, Z.; Tang, X.; Liu, G.; Chen, Y.; Zhai, X.; Huang, Q.; Cao, Y. Oxyresveratrol extracted from Artocarpus heterophyllus Lam. inhibits tyrosinase and age pigments in vitro and in vivo. Food Funct. 2020, 11, 6595–6607. [Google Scholar] [CrossRef]
- Zhu, C.J.; Peng, Y.; Tong, Z.H.; Lu, L.Y.; Cui, Y.H.; Yu, H.Q. Hormetic effect and mechanism of imidazolium-based ionic liquids on the nematode Caenorhabditis elegans. Chemosphere 2016, 157, 65–70. [Google Scholar] [CrossRef] [PubMed]
- Peng, Y.; Tong, Z.H.; Chong, H.J.; Shao, X.Y. Toxic effects of prolonged exposure to [C(14)mim]Br on Caenorhabditis elegans. Chemosphere 2018, 208, 226–232. [Google Scholar] [CrossRef] [PubMed]
- Höss, S.; Fritzsche, A.; Meyer, C.; Bosch, J.; Meckenstock, R.U.; Totsche, K.U. Size- and composition-dependent toxicity of synthetic and soil-derived Fe oxide colloids for the nematode Caenorhabditis elegans. Environ. Sci. Technol. 2015, 49, 544–552. [Google Scholar] [CrossRef] [PubMed]
- Xiao, G.; Zhao, L.; Huang, Q.; Du, H.; Guo, D.; Xia, M.; Li, G.; Chen, Z.; Wang, D. Biosafety assessment of water samples from Wanzhou watershed of Yangtze Three Gorges Reservior in the quiet season in Caenorhabditis elegans. Sci. Rep. 2018, 8, 14102. [Google Scholar] [CrossRef]
- Vatner, S.F.; Zhang, J.; Oydanich, M.; Berkman, T.; Naftalovich, R.; Vatner, D.E. Healthful aging mediated by inhibition of oxidative stress. Ageing Res. Rev. 2020, 64, 101194. [Google Scholar] [CrossRef]
- Zhou, J.D.; Li, X.D. Extraction, Structural Characterization and Antimicrobial Activity of Polysaccharides from Hemerocallis citrina Baroni. Food Sci. 2015, 36, 61–66. [Google Scholar]
- Hu, Q.; Li, J.; Liu, D.H.; Cao, Y. Antioxidant Activity of Total Flavonoids Extracts from Folium of Artemisiae argyi In Vitro and In Vivo. Sci. Technol. Food Ind. 2021, 42, 304–309. [Google Scholar] [CrossRef]
Number | Name | Relative Content (%) |
---|---|---|
1 | Glucose | 31.43 |
2 | Galactose | 31.33 |
3 | Galacturonic acid | 12.02 |
4 | Mannose | 10.08 |
5 | Arabinose | 4.80 |
6 | Rhamnose | 4.42 |
7 | Fucose | 2.68 |
8 | Xylose | 2.15 |
9 | Ribose | 0.75 |
10 | Glucuronic acid | 0.36 |
Concentration (μg/mL) | Average Life Span (Day) | Relative Life Change Rate (%) |
---|---|---|
0 | 10.78 ± 0.14 a | |
400 | 11.57 ± 0.38 a | 7.33 |
800 | 13.32 ± 0.87 b | 23.56 |
1200 | 14.30 ± 1.01 b | 32.65 |
Concentration (μg/mL) | Average Life Span (Day) | Relative Life Change Rate (%) |
---|---|---|
0 | 7.17 ± 0.18 ab | |
400 | 6.80 ± 0.31 a | −5.16 |
800 | 7.89 ± 0.68 bc | 10.04 |
1200 | 8.44 ± 0.82 c | 17.71 |
Concentration (μg/mL) | Average Life Span (Day) | Relative Life Change Rate (%) |
---|---|---|
0 | 4.51 ± 0.22 a | |
400 | 4.65 ± 0.37 a | 3.10 |
800 | 5.13 ± 0.62 ab | 13.74 |
1200 | 5.98 ± 0.83 b | 32.59 |
Gene | Upstream Primer (5′→3′) | Downstream Primer (5′→3′) |
---|---|---|
act-1 | CCGTGTTCCCATCCATTGTC | CCAGATCTTCTCCATATCATCCCAG |
daf-2 | GCTCTCGGAACAACCACTGA | GACAAGTCGAAGCCGTCTCA |
age-1 | GACGGAACTCCCGACGTATC | CCCCACTTCATCGGAGCAAT |
skn-1 | GCGACGAGACGAGACGATAA | GAGGTGTTGGACGATGGTGA |
ctl-1 | TCGTTCATGCCAAGGGAGC | GATTCTCCAGCGACCGTTGA |
ctl-2 | TCCCAGATGGGTACCGTCAT | GGTCCGAAGAGGCAAGTTGA |
sod-1 | CTCACTCAGGTCTCCAACGC | AAGTGTGGACCGGCAGAAAT |
sod-2 | TGCCACTTGGTATGAGCCAG | GGCCAGCTTCCAATACCACT |
sod-3 | ACGTGGACAAGGTGGACATC | TTCGCTTTGCTCCAAAAGGC |
sod-5 | GTGGAACTGCTGTCTTCGGA | GCAGACGTACATCCATCGGT |
gcs-1 | AGGTGAATGCGATGCTTGGA | CGATGAGACCTCCGTAAGGC |
gst-4 | CTCTTGCTGAGCCAATCCGT | GCAGTTTTTCCAGCGAGTCC |
gst-7 | GGGAGGAGGCTCAAGTCAAC | CCAGCCGACTTGAGGAAGTT |
gst-10 | ACATTCGGTTCGACTACGAGG | TTCACTAGAGCCTCCGGGAT |
hsp-60 | CCAAGGACGTCAAGTTCGGA | TCCAGCCTCCTCATTAGCCT |
hsp-16.1 | GTCTCGCAGTTCAAGCCAGA | TCGCTTCCTTCTTTGGTGCT |
hsp-16.2 | GTCCAGCTCAACGTTCCGT | CTTGGATTGATAGCGTACGACC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zou, Y.; Qin, X.; Wang, W.; Meng, Q.; Zhang, Y. Anti-Aging Effect of Hemerocallis citrina Baroni Polysaccharide-Rich Extract on Caenorhabditis elegans. Int. J. Mol. Sci. 2024, 25, 655. https://doi.org/10.3390/ijms25010655
Zou Y, Qin X, Wang W, Meng Q, Zhang Y. Anti-Aging Effect of Hemerocallis citrina Baroni Polysaccharide-Rich Extract on Caenorhabditis elegans. International Journal of Molecular Sciences. 2024; 25(1):655. https://doi.org/10.3390/ijms25010655
Chicago/Turabian StyleZou, Yunxia, Xiyue Qin, Wenli Wang, Qingyong Meng, and Yali Zhang. 2024. "Anti-Aging Effect of Hemerocallis citrina Baroni Polysaccharide-Rich Extract on Caenorhabditis elegans" International Journal of Molecular Sciences 25, no. 1: 655. https://doi.org/10.3390/ijms25010655